ID: 1132826704

View in Genome Browser
Species Human (GRCh38)
Location 16:1908829-1908851
Sequence AATAAGGAGCGCATGTAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826694_1132826704 27 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826704 16:1908829-1908851 AATAAGGAGCGCATGTAGGACGG No data
1132826701_1132826704 -2 Left 1132826701 16:1908808-1908830 CCAGTGTGGTGGGCGTGCTGGAA No data
Right 1132826704 16:1908829-1908851 AATAAGGAGCGCATGTAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826704 Original CRISPR AATAAGGAGCGCATGTAGGA CGG Intergenic