ID: 1132826705

View in Genome Browser
Species Human (GRCh38)
Location 16:1908832-1908854
Sequence AAGGAGCGCATGTAGGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132826701_1132826705 1 Left 1132826701 16:1908808-1908830 CCAGTGTGGTGGGCGTGCTGGAA No data
Right 1132826705 16:1908832-1908854 AAGGAGCGCATGTAGGACGGAGG No data
1132826694_1132826705 30 Left 1132826694 16:1908779-1908801 CCACGGCAGGTGGAAGGAGCTGG No data
Right 1132826705 16:1908832-1908854 AAGGAGCGCATGTAGGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132826705 Original CRISPR AAGGAGCGCATGTAGGACGG AGG Intergenic