ID: 1132828194

View in Genome Browser
Species Human (GRCh38)
Location 16:1915201-1915223
Sequence CTTGCAAACCAGGAACTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 127}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132828181_1132828194 18 Left 1132828181 16:1915160-1915182 CCCCACTACATACTCAGACCCCA 0: 1
1: 0
2: 0
3: 23
4: 221
Right 1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
1132828186_1132828194 -2 Left 1132828186 16:1915180-1915202 CCACTCCCTGCACCCACTGCTCT 0: 1
1: 1
2: 6
3: 107
4: 950
Right 1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
1132828185_1132828194 -1 Left 1132828185 16:1915179-1915201 CCCACTCCCTGCACCCACTGCTC 0: 1
1: 0
2: 10
3: 68
4: 693
Right 1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
1132828184_1132828194 0 Left 1132828184 16:1915178-1915200 CCCCACTCCCTGCACCCACTGCT 0: 1
1: 1
2: 10
3: 86
4: 785
Right 1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
1132828188_1132828194 -8 Left 1132828188 16:1915186-1915208 CCTGCACCCACTGCTCTTGCAAA 0: 1
1: 0
2: 2
3: 22
4: 237
Right 1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
1132828183_1132828194 16 Left 1132828183 16:1915162-1915184 CCACTACATACTCAGACCCCACT 0: 1
1: 0
2: 0
3: 20
4: 173
Right 1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
1132828187_1132828194 -7 Left 1132828187 16:1915185-1915207 CCCTGCACCCACTGCTCTTGCAA 0: 1
1: 0
2: 1
3: 25
4: 278
Right 1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
1132828182_1132828194 17 Left 1132828182 16:1915161-1915183 CCCACTACATACTCAGACCCCAC 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 127
1132828180_1132828194 28 Left 1132828180 16:1915150-1915172 CCGGGTTCTTCCCCACTACATAC 0: 1
1: 0
2: 1
3: 8
4: 189
Right 1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132828194 Original CRISPR CTTGCAAACCAGGAACTAAG GGG Intronic
909903828 1:81172629-81172651 CTTGCAAACCAGGAGAGAATGGG - Intergenic
912884778 1:113458959-113458981 CTTCAAAACCAGGAACTTACAGG - Intronic
914222883 1:145696182-145696204 CTTGCAACCCCTGGACTAAGAGG - Intronic
915240954 1:154521363-154521385 CTTGCAATCCAGGAGCTGAATGG + Exonic
915664740 1:157434283-157434305 CTTGCAACCCAGGAAGCAATAGG + Intergenic
919137131 1:193524168-193524190 CTTGCAAGGGAAGAACTAAGAGG - Intergenic
919703530 1:200655122-200655144 CCTGCAAATGATGAACTAAGGGG - Intronic
921029917 1:211327583-211327605 CCTGCAGAACAGGAACAAAGTGG - Intronic
923250462 1:232175776-232175798 CTTCCAACCCTGGAACGAAGAGG + Intergenic
1070953666 10:80450675-80450697 TTTGCAAACCATGGACTGAGCGG - Intergenic
1071425919 10:85551007-85551029 TTTGCAAACCAGGAACCGAAAGG + Intergenic
1073645487 10:105297602-105297624 CTTGCAAGCCAGGAGATAATGGG + Intergenic
1075504668 10:123011302-123011324 CTTGCAAATGAGGAACTCGGAGG + Intronic
1077845810 11:6023577-6023599 CCTGCAAACCAGGGAGTGAGGGG + Intergenic
1079460791 11:20676127-20676149 CATGCAAACGAGGAACAAACTGG - Intronic
1083303109 11:61749038-61749060 CTTGCATACAAGGACCTAGGGGG - Intergenic
1083696442 11:64446173-64446195 CCTGAAAACCAGAAACTAAATGG - Intergenic
1084148146 11:67275771-67275793 CTTGCACTCCAGGAACCCAGTGG + Intronic
1086347479 11:85911902-85911924 CTTGCATACAAGAAACCAAGTGG + Intronic
1089685664 11:120145163-120145185 CTTGGAAAACAGGACCTGAGAGG + Intronic
1093783547 12:23166200-23166222 CCTTCAAACCAGGAAGTATGCGG - Intergenic
1098905400 12:76156687-76156709 CCTGCAAACCACGCACTCAGAGG + Intergenic
1101031912 12:100668950-100668972 CTTGGAAAGCAGGAAACAAGAGG + Intergenic
1101247180 12:102895093-102895115 CTTTAAAACCAAGTACTAAGTGG + Intronic
1103178446 12:118886073-118886095 GGTGCATACCAGGAACCAAGAGG + Intergenic
1103805141 12:123566662-123566684 CATCCAAAACAGGAAATAAGGGG + Intergenic
1110783659 13:79497298-79497320 CATGCAAACTAGAAAGTAAGGGG - Intronic
1113987593 13:114330888-114330910 GTTGAAAACCAGGTAATAAGTGG + Intergenic
1115363846 14:32533995-32534017 CTTGAAACCCAAGAACTAATTGG - Intronic
1117824750 14:59689621-59689643 CTTACAAACCAGGAAAGATGGGG + Intronic
1117946781 14:61034731-61034753 CCTGCATACCAGGAATTGAGGGG + Intronic
1118109019 14:62694963-62694985 CATGCAAAGGAGAAACTAAGTGG + Intergenic
1118629452 14:67689437-67689459 CTTGCAAAGCATCAAATAAGAGG - Intronic
1120166059 14:81201678-81201700 CATGCAAACAAGGAACCATGAGG + Intronic
1121454875 14:94031827-94031849 TTTGCAAACCAGCAATTAAAGGG + Intronic
1121997964 14:98619950-98619972 ATTGAAAACCAGGAAGTAGGTGG - Intergenic
1122483564 14:102063522-102063544 CTTGTCAACCAGGCAGTAAGAGG + Intergenic
1125991137 15:44109396-44109418 CTTGCAAACCAGAAGATAATAGG - Intronic
1132170826 15:99652401-99652423 GTTGCACAGCAGGAAGTAAGTGG - Intronic
1132828194 16:1915201-1915223 CTTGCAAACCAGGAACTAAGGGG + Intronic
1144315577 17:14057807-14057829 TTTGAAAACCAGGAACTGACAGG - Intergenic
1144998730 17:19288828-19288850 CTTGCAGACCATGCACTCAGTGG + Intronic
1149894695 17:60420856-60420878 CATGGAAAACAGGAACTAAAAGG - Intronic
1154461360 18:14590890-14590912 CTTGCAGGCCAGGAAATAATGGG + Intergenic
1154487436 18:14884644-14884666 CATGAAAACCAGGAAGTAAAAGG + Intergenic
1156142128 18:34126515-34126537 GTAGAAATCCAGGAACTAAGAGG - Intronic
1160173591 18:76574464-76574486 CTAGCAAACTAGGAATGAAGGGG + Intergenic
1165521025 19:36314089-36314111 CCTGCAAACCAGGAAATACATGG + Intergenic
1165623044 19:37264499-37264521 CCTGCAAACCAGGAAATACATGG - Intergenic
926906350 2:17809169-17809191 CATACAAACCAGGCACTCAGTGG - Intergenic
929419375 2:41775437-41775459 CCTGGAAACCAAGAACCAAGAGG + Intergenic
929860641 2:45674428-45674450 CTGTCAAACCAGGTACTAACTGG + Intronic
930062005 2:47297792-47297814 TTTGCAAACCTGGAAATAAAAGG - Intergenic
931573903 2:63699450-63699472 CTTACAAAGAAGGAACTGAGAGG + Intronic
932748299 2:74353616-74353638 CTAACAAGCCAGGAACTAATGGG + Intronic
933848495 2:86346829-86346851 CTTGCAAACCAATAAGAAAGTGG - Intergenic
936065157 2:109325685-109325707 CTTGGAAACCAGGAGATGAGTGG - Intronic
942796674 2:179828992-179829014 CTTCCAAACCAGTAACTCAAAGG + Intronic
943348304 2:186767678-186767700 CTTGAAAACCAGGAAATAATAGG - Intergenic
943980271 2:194540381-194540403 CTTCCAAACCAGGAAAGAATGGG + Intergenic
948322051 2:237078218-237078240 CTTGAAAACAAAGAACTATGAGG - Intergenic
1169345948 20:4828201-4828223 CACACAAACCAGGAAGTAAGAGG - Intergenic
1171169530 20:23003034-23003056 CCTGAAAACCAGGAACTCTGAGG + Intergenic
1171991401 20:31699284-31699306 CTTGCAGAGCAGGAAGGAAGGGG + Intronic
1172039609 20:32034762-32034784 TTTGGACCCCAGGAACTAAGGGG - Intergenic
1172050683 20:32115259-32115281 GTTGTAAAACAGAAACTAAGAGG - Intronic
1173628039 20:44488236-44488258 TTTGCAAACCACTAACTTAGTGG + Intronic
1176793844 21:13354690-13354712 CATGAAAACCAGGAAGTAAAAGG - Intergenic
1181469359 22:23128315-23128337 CTGGCAGGCCAGGAACCAAGAGG - Intronic
1181593191 22:23896943-23896965 CTTGGACTCCAGGAACAAAGGGG + Intronic
1182814664 22:33150219-33150241 GTGGGAAAACAGGAACTAAGGGG - Intergenic
1183826488 22:40391982-40392004 TTTGCAAAACAGGCTCTAAGGGG - Intronic
1184199865 22:42961018-42961040 TTGGCAAGCCAGGATCTAAGTGG + Intronic
950899186 3:16481905-16481927 CTTACAAAACTGGGACTAAGTGG + Intronic
951400129 3:22222567-22222589 CTTGCATAACAGGAACTAGCAGG + Intronic
954870754 3:53765841-53765863 CTGCCAAACCAGGAACTGAGCGG - Intronic
955668050 3:61371030-61371052 CTTGCAAAGCAGAAACTGATTGG - Intergenic
956728393 3:72175620-72175642 CTGGCTAAACAGGAATTAAGGGG - Intergenic
962269317 3:133966543-133966565 CCCACAAACCAGGACCTAAGGGG - Intronic
962909654 3:139836432-139836454 CTTGCAAACCAGGACACATGAGG + Intergenic
974499903 4:62685648-62685670 CTTGCAAACCAGGATAGAGGGGG + Intergenic
974901324 4:68002001-68002023 CTTCAAAACCAGGAACTACCTGG + Intergenic
976456864 4:85257800-85257822 CTTGCATACCTGGATCTTAGAGG + Intergenic
976477084 4:85496712-85496734 GGTGCAAACCATGAACTATGGGG - Intronic
977334476 4:95679131-95679153 CTGGCTAACCAAGAACCAAGAGG - Intergenic
980851119 4:138382938-138382960 CTTGAAAAGCTGGAACTAAAGGG - Intergenic
984051754 4:174873022-174873044 CTTGCAATCCAAGAACTGAATGG - Intronic
986708948 5:10473640-10473662 CTTGCAAACCAAGTCCAAAGGGG + Intergenic
986973590 5:13368197-13368219 CATGTAAACCAGGAAAGAAGTGG + Intergenic
987863802 5:23515926-23515948 CTTTGAAATCAGGAACTATGAGG + Intronic
988268340 5:28981678-28981700 CTTGAAAACCAAGAACAGAGTGG - Intergenic
989045317 5:37268380-37268402 CCTGCATACCAGGTACTAGGAGG + Intergenic
992073695 5:73172165-73172187 CTTGAAGACCAGGAACTGTGTGG + Intergenic
992110359 5:73486972-73486994 CTTCCAAACTAGAAACTAAATGG - Intergenic
995996976 5:118312142-118312164 CTTCCAAACCATCAACTGAGGGG + Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
999001902 5:147932787-147932809 ATAGCAAACCAAGAACTAAAAGG - Intergenic
1001003611 5:168030481-168030503 CCTGCAAATCAGAAACTCAGGGG - Intronic
1002362744 5:178686226-178686248 CTTGGAAAGCAGGAGCTGAGAGG - Intergenic
1003409878 6:5852700-5852722 GTTGTAAAACAGGAATTAAGTGG + Intergenic
1006928547 6:37673318-37673340 CTTGCATACCAGGATCTGGGAGG - Intronic
1007201055 6:40109473-40109495 CATGCAATCCAGGAATTAAGAGG - Intergenic
1010416225 6:75614859-75614881 CTTGCAAACCAGGAATAGAAAGG - Intronic
1011284186 6:85706247-85706269 CCTTCAAGCCAGGAACAAAGTGG - Intergenic
1012053090 6:94368723-94368745 CTAGCAAACCAAGACCTGAGTGG + Intergenic
1012753090 6:103187637-103187659 CTTGAGTACCATGAACTAAGGGG + Intergenic
1013795918 6:113888648-113888670 CTTGCAATCTAGGAGCTCAGAGG + Intergenic
1019223748 6:170494560-170494582 CTTGCATACCAGGAAAGAAAGGG + Intergenic
1020071238 7:5228295-5228317 CTTGCAAACCAGTGACATAGAGG + Intronic
1020682079 7:11249500-11249522 TTTGCAGACCAGGAACTCAAAGG + Intergenic
1026529026 7:71181341-71181363 CTTTCAAAAGAGGAACTGAGAGG + Intronic
1028378644 7:90174629-90174651 CTAACAAACCACAAACTAAGTGG - Intronic
1028918720 7:96287901-96287923 CTTGCAGAAAAGTAACTAAGTGG - Intronic
1029789783 7:102830122-102830144 CTTGCAGCCCAGAAGCTAAGGGG - Intronic
1031193903 7:118588584-118588606 CTTCCAAACCAAGGCCTAAGAGG - Intergenic
1033172415 7:139095758-139095780 CTTGTGAACCATGAACTTAGGGG - Intronic
1033594211 7:142843408-142843430 CTTTCAAACCAGCTGCTAAGAGG + Intergenic
1036708253 8:11060568-11060590 CCTGCATACAAGGGACTAAGAGG + Intronic
1043918433 8:85952119-85952141 CTTGGAGAGCAGGAACTCAGAGG + Intergenic
1044792436 8:95861841-95861863 CTTGGAGACCAGGAGCTGAGGGG - Intergenic
1055942427 9:81663244-81663266 CTGGCAAACCTGGAACTATTTGG + Intronic
1056578908 9:87876316-87876338 CTTCAAAGCCAGGATCTAAGGGG + Intergenic
1056997224 9:91474117-91474139 CTAGCAAACTAGGGACAAAGGGG - Intergenic
1186867219 X:13732678-13732700 CTGGGAAACTAGAAACTAAGGGG + Intronic
1190072918 X:47293518-47293540 CTTGCAACCCAGGAACCAATGGG - Intergenic
1191146276 X:57168647-57168669 TTTGCAAACCTGAAACTATGAGG + Intergenic
1192206428 X:69099782-69099804 CTTGGCAACCAGAAAGTAAGTGG - Intergenic
1193829121 X:86266172-86266194 CTAGCAAATCAGAAACTTAGGGG - Intronic
1194556320 X:95364795-95364817 CTTGAAAACCAGAAACAAATAGG + Intergenic
1197802420 X:130365533-130365555 CATGTAAAGCTGGAACTAAGAGG - Exonic
1200934412 Y:8725647-8725669 CTTTCATACCAGGAACCAAATGG - Intergenic
1201626287 Y:16018269-16018291 CTTTCAACACAGGAATTAAGTGG + Intergenic