ID: 1132834802

View in Genome Browser
Species Human (GRCh38)
Location 16:1947375-1947397
Sequence TTTCATCTGCAGGACATGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132834798_1132834802 2 Left 1132834798 16:1947350-1947372 CCTTCTTCTGCCGGAAGGGCAGC 0: 1
1: 0
2: 3
3: 10
4: 145
Right 1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG 0: 1
1: 0
2: 2
3: 25
4: 242
1132834794_1132834802 14 Left 1132834794 16:1947338-1947360 CCATGATGTGGGCCTTCTTCTGC 0: 1
1: 0
2: 4
3: 24
4: 190
Right 1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG 0: 1
1: 0
2: 2
3: 25
4: 242
1132834799_1132834802 -8 Left 1132834799 16:1947360-1947382 CCGGAAGGGCAGCAGTTTCATCT 0: 1
1: 0
2: 0
3: 15
4: 257
Right 1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG 0: 1
1: 0
2: 2
3: 25
4: 242
1132834791_1132834802 30 Left 1132834791 16:1947322-1947344 CCGTTCAGCTGGATCTCCATGAT 0: 1
1: 0
2: 1
3: 18
4: 201
Right 1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG 0: 1
1: 0
2: 2
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132834802 Original CRISPR TTTCATCTGCAGGACATGGC CGG Exonic
900132246 1:1092093-1092115 CTTCATCTGCAGGACTGGGCCGG - Exonic
900316445 1:2059569-2059591 TGTCTTCTCCCGGACATGGCAGG - Exonic
901007114 1:6177423-6177445 TTTCAGGTGCTGGGCATGGCAGG + Intronic
902195129 1:14792679-14792701 TTTAAGGTCCAGGACATGGCTGG + Intronic
902406021 1:16184090-16184112 TTTCAACAGCATGACATGGTGGG + Intergenic
905896312 1:41547994-41548016 TTCCATCTGGAGGAACTGGCAGG - Intronic
908573329 1:65433006-65433028 TTTCATCTGAAAGACAATGCTGG + Exonic
908785278 1:67729314-67729336 TTTCAGTTCCAGGACCTGGCAGG - Intronic
910436638 1:87212116-87212138 CTTCCCTTGCAGGACATGGCTGG + Intergenic
912454829 1:109790428-109790450 TTTAATCTTCAGGACAAGGTAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
914628611 1:149487320-149487342 ATTTATTTGCAGGACATCGCTGG + Intergenic
921971512 1:221154125-221154147 TTTCATCTGAGGGATCTGGCTGG + Intergenic
922384873 1:225072919-225072941 ATGCACCTGCAGGACATGGCTGG + Intronic
923758737 1:236819646-236819668 TTTCATTTGCAGGACATCAGGGG - Intronic
1062944562 10:1450671-1450693 TTTATTCTGAAGGTCATGGCAGG + Intronic
1063245003 10:4208685-4208707 TGCCATCTCCAGGACTTGGCAGG + Intergenic
1063287768 10:4709071-4709093 CTTTCTCTGCAGGACATGGCAGG + Intergenic
1065509572 10:26464731-26464753 TTTCATCTGTAAAACAGGGCTGG - Intronic
1066506410 10:36049230-36049252 TTTCATATGTAGGACATCTCTGG - Intergenic
1069843151 10:71352571-71352593 TTGCATCCCCAGGACATAGCAGG - Intronic
1071496298 10:86169774-86169796 TTCCTCCTGCAGGCCATGGCAGG - Intronic
1074536279 10:114330404-114330426 TTTCCTCTGTAGGGCATGGCTGG - Intronic
1074733270 10:116400196-116400218 TGTCCTCTGAAGGACCTGGCTGG + Intergenic
1074884094 10:117681351-117681373 TTGAATCTGCAGCACATGGTAGG - Intergenic
1075877650 10:125821877-125821899 TTTAATATCCATGACATGGCTGG + Intronic
1076033183 10:127176309-127176331 TTTCATCTCCAGGGCCAGGCAGG + Exonic
1076166240 10:128284925-128284947 CTCCATCTTCAGGACAAGGCAGG - Intergenic
1077842885 11:5994161-5994183 CTCCATCTGCAGGGCATAGCAGG + Intergenic
1078199496 11:9167419-9167441 TTTCAAGTAGAGGACATGGCAGG - Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1080738522 11:35041369-35041391 TTACATCTGCAAGTCATGGTAGG + Intergenic
1083877339 11:65531230-65531252 TTTCATCTGAAAGACTTGTCAGG + Intronic
1084436130 11:69141546-69141568 TTTGATCTGCAGGACCTGGCAGG + Intergenic
1084944750 11:72632581-72632603 TTTCCTCTGCCGGACATGACTGG - Intronic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086034732 11:82402814-82402836 TTTTATGTTCAGCACATGGCTGG - Intergenic
1086684919 11:89721432-89721454 TTTTATATACAGGACATAGCTGG - Intergenic
1089440479 11:118512014-118512036 TCTCATTTGCAGGTAATGGCTGG + Exonic
1089903604 11:122013580-122013602 GTTAATCTGCAGAAGATGGCAGG - Intergenic
1089924217 11:122240276-122240298 TTTCCTATTCAGGACAGGGCTGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090404014 11:126466501-126466523 CTGCACCTGCAGGACAGGGCGGG + Intronic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091027360 11:132153793-132153815 TCTCCTCTGCTGGACAGGGCAGG - Intronic
1091316075 11:134614996-134615018 GTCCATTTGCAGGGCATGGCAGG + Intergenic
1094156982 12:27347531-27347553 ATTGATCTGCAGGACATTGTAGG + Intronic
1094478795 12:30863603-30863625 TTTCATCTGCAGGAAAATGAAGG - Intergenic
1102782110 12:115574283-115574305 CTTCATCTGCATAACAGGGCTGG - Intergenic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105832064 13:24171476-24171498 TGTCATCTGCAGGACACTGTAGG - Intronic
1106072453 13:26425684-26425706 TTTCCACTACAGGACAAGGCTGG - Intergenic
1108255385 13:48604745-48604767 TGTCATCTGCACAACATGGTTGG - Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1116035451 14:39621808-39621830 TTGCATCTTCAGCATATGGCAGG - Intergenic
1118351094 14:64972653-64972675 CTGCATCTGCAGGATCTGGCCGG + Intronic
1118697942 14:68403201-68403223 TTTCATCTGCAGGGACTGGAGGG + Intronic
1119686404 14:76635629-76635651 CTTCATCTGCAGGACATCAAGGG + Intergenic
1122292814 14:100688588-100688610 TTGCCTCTGCAGGACTTGGGTGG + Intergenic
1122795980 14:104206457-104206479 TTTCATCTGGAGGACAGGCAGGG - Intergenic
1124803477 15:32857981-32858003 TTTCATCTGTTGACCATGGCTGG + Intronic
1125015667 15:34931847-34931869 TTTCTTCTGCATGACATAACAGG + Intronic
1125564589 15:40666864-40666886 TTTAATCCCCAGGAAATGGCTGG + Intergenic
1131445158 15:92492757-92492779 TTCCATCTGCAGGATGAGGCTGG + Intronic
1131706507 15:95001915-95001937 TTTCATCTGAAGAGCTTGGCAGG - Intergenic
1132110144 15:99096858-99096880 TTTCATCCGCAGGTCTGGGCCGG + Intergenic
1132240873 15:100256270-100256292 TTGGATCTGCATGACAGGGCTGG + Intronic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG + Exonic
1135467795 16:22702087-22702109 TGTAAGCAGCAGGACATGGCTGG + Intergenic
1138475254 16:57266804-57266826 GTTTATCTGCAGGACCTGTCTGG - Intronic
1140265132 16:73414003-73414025 TTTTAACTGCAGGACTTGTCAGG - Intergenic
1141448531 16:84080519-84080541 TCTCCTCTGCAGGACACTGCTGG + Intronic
1141715369 16:85723950-85723972 TACCAGCTGCTGGACATGGCCGG - Intronic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1143550366 17:7626991-7627013 TTTCATCTACAGTACATGGAAGG - Exonic
1143780085 17:9224758-9224780 TTTCTGCTGCAAGACAAGGCTGG + Intronic
1143906057 17:10210111-10210133 CCTCATCTGCAGGACAGGGATGG + Intergenic
1146656757 17:34639066-34639088 TTCCCTCTGCAGCACAGGGCAGG + Exonic
1147862892 17:43533904-43533926 TTCCTGCTGCAGGACAGGGCCGG + Exonic
1148026270 17:44589858-44589880 TGTCTTCTGCGGGAGATGGCGGG - Intergenic
1150227379 17:63531328-63531350 TTTCATCTGCAGGAGAGAGATGG + Intronic
1151362455 17:73596775-73596797 TGTCATCTGGAGGCCATGGAGGG - Intronic
1151664296 17:75536571-75536593 TTCCACCAGCAGGACAGGGCTGG + Intronic
1153517672 18:5919425-5919447 TTTCATCTGCAGAATATTGAAGG - Intergenic
1153665595 18:7365227-7365249 ACTCATCAGCAGGACATGGGTGG - Intergenic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1156818227 18:41338351-41338373 TGTCATCAGCAGGACCTGGGTGG + Intergenic
1158183481 18:54744758-54744780 TTTCATGTTCAGGACATCACAGG - Intronic
1158562651 18:58528233-58528255 TATTATCTTAAGGACATGGCTGG + Intronic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161169769 19:2806993-2807015 GTTCATCTCCAGGACATAGTCGG - Exonic
1161618408 19:5285432-5285454 TTTCATCTGCAGGCCTTCCCGGG + Intronic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1163889795 19:20000598-20000620 TTTCATACCCAGGTCATGGCTGG + Intronic
1165318758 19:35073657-35073679 GGGCATCTGCAGGGCATGGCTGG - Intergenic
1167167091 19:47805711-47805733 CTTCATCTACAGGACATGCTGGG + Intronic
1167174725 19:47858016-47858038 CTTCATCTACAGGACATGCTGGG - Intergenic
925715267 2:6779249-6779271 TTTCATTTGCAAGAAATGCCAGG + Intergenic
926096424 2:10083755-10083777 CTTCATCTGCAGTAGATGCCTGG - Intergenic
927662461 2:25004609-25004631 TTTAAAGTGCAGGACTTGGCTGG + Intergenic
928372599 2:30751888-30751910 ATGCATCTGCAGCACATAGCAGG + Intronic
928495040 2:31822889-31822911 CTCCATCTGCAGGGCATAGCGGG + Intergenic
928616420 2:33044160-33044182 ATACATGTGCAGAACATGGCAGG + Intronic
929583535 2:43099700-43099722 TTTCCTCTGCTGGACCTTGCAGG + Intergenic
929819262 2:45260271-45260293 TTTCCTCTGCAGGGTATGGATGG - Intergenic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
931544206 2:63363225-63363247 TTCCATCTGCAAGATATGGAGGG - Intronic
931593913 2:63919183-63919205 TTTCATGTGGAAGAGATGGCTGG - Intronic
931791454 2:65667433-65667455 CTCCATCTGCAGGGCATAGCGGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
936153187 2:110032749-110032771 CCTCACCTGCAGGACATGGCGGG + Intergenic
936191494 2:110338666-110338688 CCTCACCTGCAGGACATGGCGGG - Intergenic
937420835 2:121753941-121753963 TTTAATTTGCAGGCCCTGGCTGG - Intronic
937477456 2:122228064-122228086 TTTAATCTGCAGGACAACCCTGG - Intergenic
937861813 2:126717274-126717296 TTTCATCAGTAGGACTTGGTAGG + Intergenic
939936353 2:148298238-148298260 TTACATCTGCAATACATAGCTGG + Intronic
941231007 2:162912714-162912736 TTTCATCTCCAGCAAAGGGCAGG - Intergenic
942583054 2:177442429-177442451 TCTCATCTGCAGGACACATCAGG - Exonic
945300108 2:208208145-208208167 TTTCATTTGCAGGACATAAAGGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
946214005 2:218169348-218169370 TTGCATCTGGAGGACAAGGGTGG + Intergenic
947669421 2:231926891-231926913 TTTCACCTGCCGGTCAGGGCGGG + Intergenic
947738926 2:232476093-232476115 ATTCAGCAGCAGGACAGGGCAGG - Intergenic
949073650 2:242041383-242041405 GCTCCTCTGCAGCACATGGCAGG - Intergenic
1172300440 20:33845961-33845983 TTGCCTCTGCAGGACCGGGCAGG + Intronic
1174008334 20:47428280-47428302 TTCCCTCTGCAGGACACAGCAGG + Intergenic
1174349634 20:49957726-49957748 TTCCATCTGCAGGAAATAGCGGG - Intergenic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1174521132 20:51131635-51131657 TTTCATTTGCAGGACATCAAGGG + Intergenic
1175082495 20:56432836-56432858 GTTTATCTTCTGGACATGGCTGG + Intronic
1176389745 21:6157352-6157374 TTTCAGCTGCTGGTCATGGTGGG + Intergenic
1176412461 21:6456486-6456508 ATTCATCTGCAGAACAGAGCTGG - Intergenic
1179045914 21:37844910-37844932 CCTCATCTGGAGGTCATGGCTGG + Intronic
1179272176 21:39860037-39860059 CATCATCTGCAGGACAGGACTGG - Intergenic
1179687955 21:43064808-43064830 ATTCATCTGCAGAACAGAGCTGG - Intronic
1179733722 21:43380886-43380908 TTTCAGCTGCTGGTCATGGTGGG - Intergenic
1181435707 22:22909579-22909601 GTTCATCTTCACGAGATGGCAGG - Intergenic
1182278465 22:29205116-29205138 TTTCATCTGGGGTACATGGATGG - Intergenic
1182907969 22:33955074-33955096 TTTCATCTGTATAACATGGGAGG - Intergenic
1183214142 22:36468220-36468242 TTGCAGCTGCAGGCCAGGGCTGG + Intronic
1184889145 22:47368878-47368900 TTTCAGCTGCAGGAGCAGGCCGG - Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
955574102 3:60340451-60340473 TTGCATCTGAAGGGCATGGATGG - Intronic
956093871 3:65695770-65695792 TTCCAGCTGCAGGCCATGTCGGG + Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
956871992 3:73427539-73427561 TTCCTTCTGCATGCCATGGCAGG + Intronic
957113237 3:75992818-75992840 TTCCATCAGCATGACATGGATGG + Intronic
959577701 3:107952132-107952154 GTTCATTTGCACTACATGGCAGG - Intergenic
959594740 3:108117505-108117527 TTTCATCCTCACGACAGGGCTGG - Intergenic
959963227 3:112324639-112324661 ATTTATCTGCAGGACATGTAAGG + Intergenic
963089602 3:141470910-141470932 CTCCATCTGCAGGGCATAGCAGG + Intergenic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
964370318 3:155993564-155993586 TTTAAGGTGCAGGTCATGGCAGG + Intergenic
964483314 3:157162948-157162970 CTCCATCTGCAGGGCGTGGCAGG + Intergenic
965180219 3:165393280-165393302 TTTCCTCTGCAGGAGATTGGAGG + Intergenic
967133253 3:186492141-186492163 TGTCTGCTCCAGGACATGGCTGG - Intergenic
968824838 4:2887579-2887601 TTGCACCTGCAGAACCTGGCAGG + Intronic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
970628165 4:17912681-17912703 CTCCATCTGCAGGGCATAGCAGG - Intronic
970665921 4:18336546-18336568 CTTCATCAGCAGCATATGGCTGG - Intergenic
973849960 4:54951650-54951672 TTCCATCTACAGAACATGGGAGG + Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
976612635 4:87045775-87045797 TTTCATCTGCAGGAGTCAGCAGG - Intronic
981331935 4:143520348-143520370 TGTCATCTGTAGGACATTACTGG + Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
984544119 4:181078706-181078728 GCTCATCTGCAGGACATGTGAGG + Intergenic
986561877 5:9068586-9068608 TATCATCTGCTGGACAGAGCAGG + Intronic
987261105 5:16204223-16204245 TTTCCTCTTCAGTACCTGGCAGG + Intergenic
987628822 5:20440808-20440830 TTTTGTCTGCAAGACATGGCAGG - Intronic
988606178 5:32680244-32680266 TTTTTTCTGCAGTCCATGGCTGG - Intergenic
988949781 5:36244568-36244590 TTTCATCTGTAGCACCTAGCAGG - Intergenic
991157761 5:63458935-63458957 ATGCAACTGTAGGACATGGCTGG - Intergenic
991564478 5:67990721-67990743 TGTCATCTGCTGGACAGGGCAGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993091362 5:83430558-83430580 TTTCATCTCCAGGACAGGCCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
994118112 5:96083773-96083795 TTTCATCTGCAGCAGCTGACAGG - Intergenic
1000008489 5:157209851-157209873 GTTCAATAGCAGGACATGGCTGG + Intronic
1001380987 5:171306596-171306618 CTTCATCTGTATGACAGGGCTGG + Exonic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004135583 6:12962850-12962872 TTGATTCTGCAGAACATGGCAGG - Intronic
1004552436 6:16661837-16661859 TTTCATCTGAAGGATAGGGTGGG - Intronic
1005423931 6:25681489-25681511 TTTCCTCTTAAGCACATGGCAGG + Intronic
1005761159 6:28969416-28969438 CTCCATCTGCAGGACATAGCGGG + Intergenic
1006650226 6:35545203-35545225 TTTCACCCGCAGGGCAGGGCAGG + Intergenic
1007016868 6:38477404-38477426 TCTCATCTACAGGACATGCCAGG + Intronic
1010009455 6:71033446-71033468 ATTCATCTGGAGAACATGCCTGG + Intergenic
1010494990 6:76523237-76523259 ATTCAGCTGCAGGACATGGATGG - Intergenic
1010946908 6:81985542-81985564 TTTCACCTGAAGGAAATGGGTGG + Intergenic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1013410293 6:109877550-109877572 TTACATCCGGAGGGCATGGCTGG + Intergenic
1013667281 6:112361722-112361744 TTCCATCTGCAGGGCATAGCGGG + Intergenic
1014009186 6:116457607-116457629 TTCCATCTGCAGGGCATAGCAGG + Intergenic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1016062514 6:139645503-139645525 GTTCATCTGAAGGACATCTCAGG + Intergenic
1016451810 6:144190645-144190667 TTTCTTCTTCAGGACATGTTTGG - Intergenic
1017039468 6:150296144-150296166 TTTCAGCAGCAAGACAGGGCAGG - Intergenic
1017751803 6:157495592-157495614 TTTCATCAGGAGAAGATGGCAGG + Intronic
1017826673 6:158086838-158086860 CGTCATCTGGAGGACATGGCGGG - Exonic
1017890147 6:158631139-158631161 TCTCATCTACAAGACAGGGCTGG - Intronic
1018844774 6:167547940-167547962 TTCCATCTGCAGCAGATGGTAGG + Intergenic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1019222816 6:170487853-170487875 TTCCATCTTCACCACATGGCTGG + Intergenic
1019584198 7:1787881-1787903 TTTCCTCTACAGCACCTGGCGGG + Intergenic
1019743796 7:2688515-2688537 TTCCCTCTGCAGGACCTGCCGGG - Intronic
1023085859 7:36569345-36569367 TCTCCTCTGCAGGCCATGGGTGG + Intronic
1023344543 7:39258023-39258045 TTGCATCTGTAGGAAATGGGGGG - Intronic
1026494852 7:70893269-70893291 TTTTATCTCCAAGACATGCCAGG - Intergenic
1026634729 7:72071354-72071376 TTTCAGCTGCAGGGCAGGGTTGG - Intronic
1026661719 7:72308640-72308662 GTTCATCAGAAGGACATGGGAGG - Intronic
1027602795 7:80260138-80260160 TTTCATCAGAAGGACATCGGAGG + Intergenic
1028157914 7:87452670-87452692 TTTCTACTGCAGGACGTGACAGG - Intronic
1029607128 7:101605901-101605923 TTTCACAGCCAGGACATGGCTGG - Intergenic
1032678548 7:134157276-134157298 TGTCATCTGCAGCAAATGGGTGG - Intronic
1032739008 7:134720297-134720319 TTTCCTCTGCAGGAAATAGAAGG - Intergenic
1033038337 7:137895812-137895834 TTTCATATGCATGGCATGGCAGG - Intronic
1035084769 7:156248593-156248615 TTCCATCTGGAGGGCAGGGCAGG - Intergenic
1035604332 8:919761-919783 TTTCCTCTGCAGGACACAGAAGG + Intergenic
1036699465 8:11002449-11002471 CTTCATCTCCAGGAGAAGGCAGG + Intronic
1038252094 8:25914401-25914423 CTTCATCTCCAGGCCAAGGCTGG - Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041773936 8:61503499-61503521 TTTCTGCTGCAGGACCTGGGAGG - Exonic
1042472975 8:69212329-69212351 TTTCATCTGCATGAGAAGGATGG + Intergenic
1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG + Intergenic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1043491451 8:80753186-80753208 TTTGATCTGCACGTCTTGGCTGG + Intronic
1044730572 8:95225725-95225747 TTTCAGCTGAAGGACAAGCCTGG + Intergenic
1047460490 8:125059340-125059362 TTTCATCTACAGCAAATGTCAGG + Intronic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048390223 8:133956065-133956087 GTTCACCTAGAGGACATGGCAGG + Intergenic
1050398203 9:5222591-5222613 ATGCACCTGCAGGAGATGGCTGG - Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1052612941 9:30799747-30799769 TTCCATCTGCAGGGCGTAGCGGG + Intergenic
1055476437 9:76667708-76667730 GCTAATCTGCAGGACATGGGAGG + Intronic
1057781999 9:98057409-98057431 TTTCATATACAGGGAATGGCGGG - Intronic
1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1061462668 9:130752761-130752783 TTTCATATGTTGGCCATGGCTGG - Intronic
1062011301 9:134268294-134268316 TTCCTTCTGCAGGTCATGGAAGG + Intergenic
1186293834 X:8127396-8127418 TTTCATCTGGAGGACTGAGCAGG + Intergenic
1186372047 X:8956799-8956821 TTTCAACTGCAGGCAATTGCAGG - Intergenic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1189699014 X:43696867-43696889 TTGCATATGCAGCACGTGGCAGG + Intronic
1189928698 X:45984346-45984368 CTCCATCTGCAGGGCATAGCGGG - Intergenic
1190191717 X:48282128-48282150 TTTGATGTGCAGAACATGGCTGG + Intergenic
1190746162 X:53322962-53322984 CTTCATCTGCAGGACATTAAGGG - Intergenic
1190843665 X:54170472-54170494 TTTCATCTGCAGAAATGGGCTGG - Intronic
1192866333 X:75136826-75136848 TTTCATCTTCTGCATATGGCTGG - Intronic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193568153 X:83105903-83105925 TTTTATCAGTAGGTCATGGCTGG - Intergenic
1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1194647480 X:96475066-96475088 TTTCATCTGAAGGGCTTGCCAGG - Intergenic
1195919251 X:109966316-109966338 TTCCCTTTGCAGGGCATGGCAGG - Intergenic
1196026572 X:111047549-111047571 TCTCATCTGCAGGGCTTTGCTGG - Intronic
1198136957 X:133762806-133762828 TTTCATTTGCAGGACATCAAGGG - Intronic
1199330139 X:146549912-146549934 TTTCATAGGCTGTACATGGCTGG + Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1200821564 Y:7589296-7589318 TTTCCACTGTAGGACATGGGTGG - Intergenic
1202160311 Y:21927557-21927579 TGTCATCTACAGGAGATGGTGGG - Intergenic
1202231045 Y:22658821-22658843 TGTCATCTACAGGAGATGGTGGG + Intergenic
1202238740 Y:22743458-22743480 TTTCCACTGTAGGACATGGGTGG + Intergenic
1202312113 Y:23537344-23537366 TGTCATCTACAGGAGATGGTGGG - Intergenic
1202558690 Y:26133250-26133272 TGTCATCTACAGGAGATGGTGGG + Intergenic