ID: 1132838356

View in Genome Browser
Species Human (GRCh38)
Location 16:1965946-1965968
Sequence ACCTGCCGCCCCAGAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132838356_1132838364 7 Left 1132838356 16:1965946-1965968 CCCCCTGCTCTGGGGCGGCAGGT No data
Right 1132838364 16:1965976-1965998 GAGTTTAGTTGTCACTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132838356 Original CRISPR ACCTGCCGCCCCAGAGCAGG GGG (reversed) Intergenic