ID: 1132839811

View in Genome Browser
Species Human (GRCh38)
Location 16:1973536-1973558
Sequence CAGTGGAGAAGGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1707
Summary {0: 1, 1: 1, 2: 9, 3: 177, 4: 1519}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132839802_1132839811 10 Left 1132839802 16:1973503-1973525 CCAGAGACTGTGATGGGCTGGAC 0: 1
1: 0
2: 3
3: 22
4: 175
Right 1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG 0: 1
1: 1
2: 9
3: 177
4: 1519
1132839798_1132839811 23 Left 1132839798 16:1973490-1973512 CCAGAGTGGCTGGCCAGAGACTG 0: 1
1: 0
2: 1
3: 29
4: 255
Right 1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG 0: 1
1: 1
2: 9
3: 177
4: 1519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132839811 Original CRISPR CAGTGGAGAAGGAAGGAGAA GGG Intronic
900323388 1:2095822-2095844 AAGAGGAGAAGGGAGGGGAAGGG - Intronic
900326786 1:2112129-2112151 CAGAGGTGAAGGAAGGAGAGGGG - Intronic
900394094 1:2446099-2446121 CAGTGGACAGGGAAGCAGGACGG - Intronic
900471915 1:2859278-2859300 CAGGGAGGAAGGAAGGAGGAAGG + Intergenic
900540628 1:3200928-3200950 AAGAGGAGCAGGAAGGAGGAAGG + Intronic
900666577 1:3819606-3819628 GACTGGAGATGGAAGGAGAAAGG + Intronic
900849967 1:5135034-5135056 CAGTAGATAAAGACGGAGAAAGG - Intergenic
901222927 1:7594148-7594170 AAGGAAAGAAGGAAGGAGAAAGG + Intronic
901419751 1:9142993-9143015 GAGGGAAGAAGGAAGGAGAGAGG - Intergenic
902130520 1:14256455-14256477 GAAAGGAGTAGGAAGGAGAAAGG + Intergenic
902160896 1:14529653-14529675 TAGAGGAGAAGGAAAGAGAAAGG + Intergenic
902326721 1:15705671-15705693 CAGTGTAGAGGACAGGAGAAGGG - Intronic
902688966 1:18097722-18097744 CAGGGAAGAAGAAAGGAGAAGGG - Intergenic
902699825 1:18164275-18164297 AAGGGGAGAGGGAAGGAGCAAGG - Intronic
902774724 1:18667373-18667395 AAGGAGAGAAGGAAGGAGAAAGG + Intronic
902985072 1:20149976-20149998 GGGTGGAGAAGGAGGCAGAAGGG + Exonic
903006359 1:20301448-20301470 CACTGGAGAAGGAAGAGGAAAGG + Intronic
903019511 1:20384266-20384288 CAGAAGGGAAGGCAGGAGAAAGG - Intergenic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903331732 1:22600124-22600146 AAGGAGAGAAGGAAGGAGGAGGG + Intronic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903377412 1:22875612-22875634 AAGTGAGGAAGGAAGGAGGAAGG - Intronic
903383437 1:22912020-22912042 GGGTGGAGAAGGATGGAGAATGG + Intronic
903604531 1:24566048-24566070 CAGTCATGGAGGAAGGAGAAGGG - Intronic
903681076 1:25097524-25097546 GATTGGAGATGGAAGAAGAAAGG + Intergenic
903755434 1:25657327-25657349 CTGGGGAGAAGGAAGGGCAAGGG + Intronic
903797446 1:25940396-25940418 CAGTGCAGAAGGGAGAGGAAGGG + Intergenic
903850351 1:26301926-26301948 CAGTGGAGAAGGATGGGGAAGGG + Intronic
904193063 1:28762660-28762682 CAGTGCAGTAGTAAGTAGAAAGG + Intronic
904274637 1:29372327-29372349 CAGTTGTGATGGAAGGAGACTGG + Intergenic
904412475 1:30332802-30332824 GAGGGGAGAAGAAAAGAGAAAGG - Intergenic
904774170 1:32896547-32896569 CAGAGGAGCAGGAAGGTGAGAGG - Intronic
904780717 1:32945215-32945237 AAGTAGAGAAGGAAGATGAAAGG + Intronic
904787857 1:32996035-32996057 AAGAGTAGAAGGAAGAAGAAAGG - Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905561843 1:38933524-38933546 GAATGGAGAAGGAAGGAAAAGGG + Intronic
905836541 1:41127797-41127819 CACAGGAGAAGGAAGAAGGAAGG - Intronic
905852781 1:41286546-41286568 CAGTGGGGTGGGGAGGAGAAAGG + Intergenic
905900093 1:41575618-41575640 GAGTGGAGAAGGAAGAAGAGAGG - Exonic
906224005 1:44106147-44106169 GAGTGGTGATGGAAGGAGAGTGG - Intergenic
906462380 1:46044963-46044985 AGGTGGAGAAGGTAGGCGAAAGG - Intronic
906550077 1:46657810-46657832 GAGTGGAAAAAAAAGGAGAAGGG + Intronic
906558511 1:46735376-46735398 GAGTGGAAATGGAAGGACAAGGG + Intergenic
906655971 1:47548573-47548595 AAGCTGTGAAGGAAGGAGAAAGG - Intergenic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
906810312 1:48819983-48820005 CAATGCAGAAGGCAGCAGAATGG - Intronic
907665539 1:56431181-56431203 CAGAAGAGAAGAAAGAAGAAAGG + Intergenic
907809250 1:57852076-57852098 CAGGGGAGAAAGAAGAGGAAGGG - Intronic
907866552 1:58404853-58404875 CAGGGAAGAAGGAAGGAGAGTGG - Intronic
908068849 1:60436351-60436373 CAGGCGAGAAAGAAGGAAAATGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908632241 1:66122018-66122040 CAGTGAGGGAGAAAGGAGAAAGG - Intronic
908725520 1:67171909-67171931 CAATGTAGAAGGTAAGAGAATGG + Intronic
908769667 1:67584731-67584753 CAGAGAAGGAGGGAGGAGAAAGG - Intergenic
909082635 1:71131580-71131602 CAGTCAAGAAGAAAGGAAAAAGG + Intergenic
909364382 1:74802252-74802274 TATTGGAGAAAGAAGGAGAAAGG - Intergenic
909377896 1:74961161-74961183 CTGTGCAGAAGCAGGGAGAAAGG - Intergenic
909382145 1:75011002-75011024 ATGTGGAGAAGTAAGAAGAATGG + Intergenic
909700386 1:78514862-78514884 GAGGGGAGCAAGAAGGAGAAGGG - Intronic
909864326 1:80648073-80648095 TGGTGAAAAAGGAAGGAGAAAGG - Intergenic
910186468 1:84546352-84546374 CAGAGGCTAAGGCAGGAGAATGG + Intergenic
910266136 1:85339836-85339858 CAGTTGAGCTGGAAGGAGGAGGG - Intronic
910278846 1:85476194-85476216 CAGAGGAGAAAGTAGGTGAAGGG - Intronic
910552174 1:88487789-88487811 CAATGAAGAAGGAGGGAGGAAGG + Intergenic
910731844 1:90406263-90406285 CAGTACAGAAGTATGGAGAAGGG - Intergenic
911104181 1:94117256-94117278 CAGTGCAGAAGGAAGAATCATGG - Intronic
911240676 1:95462480-95462502 TAGTAGTGAAGGGAGGAGAATGG - Intergenic
911314275 1:96337502-96337524 CAGAAGAGAAAGAAGGTGAAGGG + Intergenic
911340149 1:96626336-96626358 GAGTGGAGAAGTAAAAAGAATGG - Intergenic
911398096 1:97337442-97337464 CAGGGCAGAAGGATGGAGAGTGG - Intronic
911513057 1:98831640-98831662 CAGAGGAGGAGGGAGGAGTAGGG - Intergenic
911812762 1:102304617-102304639 CAGAGGAGAAGGAAGAGGAGGGG - Intergenic
911953583 1:104208684-104208706 CAGGGCAGCAGCAAGGAGAAGGG + Intergenic
912214005 1:107586467-107586489 CCTTTGAGGAGGAAGGAGAAAGG + Intronic
912627374 1:111216652-111216674 CAGTGTAAGAGGAAGGATAATGG - Intronic
912686640 1:111773098-111773120 CAGTGGAGGATGGAGGAAAAGGG + Intronic
913248629 1:116892627-116892649 CAGTGGGGAGGAAAGGAGAGAGG - Intergenic
913334879 1:117700329-117700351 CAGTGGAGGAAGAATGAGAGGGG - Intergenic
913364713 1:118024630-118024652 CACTGGGGAAGGAAAGAGCAGGG + Intronic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
914682839 1:149951508-149951530 CAGTGGATAATGAAGTGGAAAGG - Intronic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915029124 1:152861058-152861080 AGGAGGAGAAGGAAGGAGGAGGG - Intergenic
915128953 1:153683975-153683997 CAGAGGAGAAAGAAAGAGAAGGG + Intronic
915144815 1:153790222-153790244 CAATGGAGATGGACAGAGAAGGG + Intergenic
915624607 1:157106971-157106993 CAGTGGAGACAAGAGGAGAAGGG - Intergenic
915636156 1:157188365-157188387 ATGTGGAGAAGGAAGGGCAAGGG - Intergenic
915713109 1:157920121-157920143 CAGCAGAGGATGAAGGAGAATGG - Intergenic
915730783 1:158052679-158052701 CAGAGGATAAGGCAGGAGAATGG + Intronic
916057304 1:161076583-161076605 CAGATGAGTAGGATGGAGAAGGG - Intronic
916126533 1:161576473-161576495 CAGGGGAGAAGGAAGGGTAAAGG - Intergenic
916136452 1:161658313-161658335 CAGGGGAGAAGGAAGGGTAAAGG - Intronic
916197500 1:162238198-162238220 TGGGGGAGAAGGAGGGAGAATGG + Intronic
916214637 1:162384587-162384609 CAGAGCAGAAGCAGGGAGAAGGG + Intronic
916524216 1:165593938-165593960 AAATGGGGCAGGAAGGAGAAAGG - Intergenic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
916964165 1:169918110-169918132 CAGGAGGGAGGGAAGGAGAAAGG - Intergenic
917104756 1:171481087-171481109 CAGAGGCTAAGGCAGGAGAATGG + Intergenic
917659090 1:177160251-177160273 CAGTGGAGAAAACAGAAGAATGG - Intronic
918294136 1:183139455-183139477 GAGTGTAAAAGGAGGGAGAAAGG - Intronic
919417985 1:197335186-197335208 GAGTGAAGGAGGAAGGAGATAGG + Intronic
919420051 1:197358706-197358728 TACTGGAGAAGGAAAGAAAATGG + Intronic
919613151 1:199772025-199772047 AAGGGGAAAAGGAAGGGGAAAGG + Intergenic
919614192 1:199785035-199785057 AAGTGCAGCAGGAAGGAGATTGG - Intergenic
919835410 1:201569822-201569844 CAGAGGAGTGGGAAGGACAAAGG + Intergenic
919849774 1:201664840-201664862 CAGGGGAAAAGGGAGGAGATGGG - Intronic
920040153 1:203090283-203090305 TAGAGGAGCAAGAAGGAGAAGGG + Intergenic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920058159 1:203207708-203207730 CAGGGGAGAAGAAAGAAGGAGGG + Intergenic
920121476 1:203661905-203661927 CAGGTGAGAAGGGTGGAGAAGGG - Intronic
920525312 1:206661773-206661795 CAGTGTAGAAGGGTGGAGAGTGG + Intronic
920701958 1:208224693-208224715 GAGTGAAGAAGGAAGGTGAGAGG + Intronic
920830150 1:209457222-209457244 CAGTGTGGAAAGAAAGAGAAAGG - Intergenic
920989529 1:210923437-210923459 CACTGAGGAAGGATGGAGAAAGG - Intronic
921049171 1:211498964-211498986 GTGTGGAGAATGAAGGAGAGAGG + Intergenic
921255813 1:213338320-213338342 CAGTGGAGCATGAAGCAGACAGG - Intergenic
921326192 1:213988091-213988113 CAGAGGAGGAGAGAGGAGAAGGG - Exonic
921555652 1:216595910-216595932 CAGTGTAGAAGAAAAGACAAGGG + Intronic
921758587 1:218886184-218886206 AAGTTGGGAAGGAAGGACAATGG - Intergenic
921888487 1:220329894-220329916 CTGGGAAGAGGGAAGGAGAAGGG + Intergenic
922331274 1:224578801-224578823 AAGAGGAGAAAGACGGAGAAGGG - Intronic
922552335 1:226505009-226505031 CAGAGGGAAAGGAAGGAGAGAGG + Intergenic
922657076 1:227394777-227394799 CACAAGAGAAGGAAGGAAAAAGG - Intergenic
923193149 1:231640198-231640220 AAGTGGAGGAGGAGGGAGAGAGG - Intronic
923267157 1:232325902-232325924 AAGAGGAGGAGGAAGGAGAAAGG + Intergenic
923332959 1:232942577-232942599 GAGGGAGGAAGGAAGGAGAAAGG + Intergenic
923381737 1:233427346-233427368 CAGTCCAGCAGGAAGGAGAGGGG + Intergenic
923873093 1:238017510-238017532 TGATGGAGGAGGAAGGAGAAGGG - Intergenic
924005131 1:239600709-239600731 GAGGGAAGAAGGAAGGAGGAAGG - Intronic
924015493 1:239716706-239716728 AAGAGGAGAAGGGAGAAGAAGGG + Intronic
924250150 1:242124421-242124443 CTTTGGAGGAAGAAGGAGAAGGG + Intronic
924368682 1:243323500-243323522 CAGTGGAGAGAAAAGGATAAAGG - Intronic
924424085 1:243934163-243934185 GGGAGGGGAAGGAAGGAGAAGGG - Intergenic
924508539 1:244709489-244709511 CAGTGGAGGAGAAAGGGGAAGGG - Intergenic
1063253008 10:4294743-4294765 GAGAGGAGAAGAAAGGAGAAGGG + Intergenic
1063692096 10:8296788-8296810 GAGGGGGGAAGGAAGGGGAAGGG - Intergenic
1063756482 10:9016000-9016022 CAATAGAGAAGAAAGGAAAATGG + Intergenic
1063759703 10:9058874-9058896 AAGGGAAGAAGGAAAGAGAAGGG - Intergenic
1064280989 10:13951309-13951331 TAGTAGGGAAGGAAGGAGAGAGG + Intronic
1064283751 10:13973744-13973766 AAGGGAAGAAGGAAGGAGGAAGG + Intronic
1064322382 10:14317708-14317730 GAGGGGAGAGGGAAGGAGAAAGG + Intronic
1064369284 10:14737281-14737303 GAGTGGAGAGGGGAGAAGAAGGG + Intronic
1064452222 10:15452958-15452980 CATTGGTGGAGGAAGAAGAATGG + Intergenic
1064460332 10:15529001-15529023 CAGGGAGGAAGGAAGGGGAAGGG - Intronic
1064686339 10:17866274-17866296 AAGGGAAGAAGGAAGGAAAAAGG + Intronic
1064715670 10:18174225-18174247 GAGGGGAGAAGGAAGGGGAAGGG - Intronic
1064754802 10:18564186-18564208 CAGTGGAGAATGAAATGGAATGG - Intronic
1064755778 10:18570849-18570871 CAGTGGAGAATGGAAGAGAATGG - Intronic
1064926875 10:20579161-20579183 AAGTGGAGATGGAAGCAGAATGG - Intergenic
1065113703 10:22464187-22464209 AAGGGAGGAAGGAAGGAGAAAGG + Intergenic
1065193754 10:23240634-23240656 CTGTAGAGAAGGCAAGAGAATGG + Intergenic
1065234489 10:23635201-23635223 GAGAGGAGAGGGGAGGAGAAGGG - Intergenic
1065350500 10:24791468-24791490 AAGTGGAGGAGGAAGGAAATGGG + Intergenic
1065639825 10:27770409-27770431 AAGGAGGGAAGGAAGGAGAAAGG - Intergenic
1065761576 10:28987780-28987802 AAGAGGAGAAGGAAGGAGAAAGG - Intergenic
1065778387 10:29143593-29143615 CAGGGGATCTGGAAGGAGAATGG - Intergenic
1065811504 10:29447723-29447745 GAGAGGGGAAGGAGGGAGAATGG - Intergenic
1065838465 10:29680363-29680385 CAGTTGAGAAGGAAGAGGGAAGG + Intronic
1065960188 10:30727767-30727789 GAGAGAGGAAGGAAGGAGAATGG + Intergenic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1066501580 10:36000304-36000326 CAGTCAACAAGGATGGAGAAAGG - Intergenic
1067133040 10:43583576-43583598 CAGAAGAGAAAGCAGGAGAATGG + Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067542899 10:47169043-47169065 TTGAGGAGAAGGAAGGGGAAGGG - Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1068086637 10:52381696-52381718 CAGTGGAGAAAGAAGGACAGAGG + Intergenic
1068718178 10:60211351-60211373 CACAGAAAAAGGAAGGAGAATGG + Intronic
1068756962 10:60666763-60666785 TTCTGGAGAAGGAAGGAAAAAGG + Intronic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1068948602 10:62755104-62755126 CAGGAGAGAAGGAAGGAGGGAGG + Intergenic
1069095588 10:64255641-64255663 AAATGGAGAAGAGAGGAGAATGG - Intergenic
1069140902 10:64824016-64824038 TAGAGGAGTAGGAAGAAGAATGG - Intergenic
1069180022 10:65347312-65347334 CAGAGGAGGAGGAAGAAGAAAGG + Intergenic
1069206718 10:65698602-65698624 GCATGGAGAAGGATGGAGAAGGG - Intergenic
1069344740 10:67455473-67455495 CAGGAGAGTAGGAAGGGGAAGGG + Intronic
1069431020 10:68333699-68333721 CAGTACAAAAGGGAGGAGAAAGG + Intronic
1069546197 10:69330628-69330650 CAGGGAAGAAGGGAGGGGAAAGG - Intronic
1069685162 10:70313218-70313240 GAGTGCAGAAGGAAGGAGGAGGG - Intronic
1069721092 10:70549793-70549815 CATTGGAGAAGGAAGGTGGCTGG + Intronic
1069911140 10:71760666-71760688 CAGAGCAGATGGAAGGAGAGTGG + Intronic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1070782378 10:79145205-79145227 CAGTGGAGAAAGACACAGAAAGG - Intronic
1070849787 10:79554110-79554132 CAGTTAAGGAGGGAGGAGAAAGG - Intergenic
1070976417 10:80609334-80609356 CAGAGGGGAAGGAAAGAGGAAGG - Intronic
1071114410 10:82200724-82200746 CAGAGGATAAAGAAAGAGAAAGG - Intronic
1071153938 10:82668086-82668108 AAGAGGAGAAGAAAAGAGAAAGG - Intronic
1071254008 10:83850482-83850504 CAGAGGAAAAGGAAGGAGCGAGG - Intergenic
1071388924 10:85150372-85150394 AAGAGGAGGAGGAAGGAGTAAGG - Intergenic
1071451486 10:85795655-85795677 AAGTGGAGGAGAAAGGAGACAGG + Intronic
1071526572 10:86363002-86363024 CAAGGCAGAGGGAAGGAGAAGGG + Intronic
1071618214 10:87095081-87095103 CAGTGGGGAAGGGAGGGGAGGGG + Intronic
1071731366 10:88252129-88252151 GAGTAAAGAAGGAAGGAAAAAGG - Intergenic
1072254057 10:93603657-93603679 CAGTGGAAAAGTGGGGAGAATGG - Intronic
1072301675 10:94067885-94067907 AGGTGGAGAAGGGAGGAGTATGG + Intronic
1072327176 10:94310268-94310290 TAGTGGTGAGGGCAGGAGAAGGG - Intronic
1072645458 10:97251093-97251115 AAGGGGAAAAGGAAGGGGAAGGG + Intronic
1073268450 10:102242076-102242098 AAGTGGCAGAGGAAGGAGAATGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073339079 10:102731576-102731598 GAGTGCAGAAGGAAGGTCAAAGG + Intronic
1073388455 10:103149387-103149409 CATTTGAGAATGAAGGTGAAGGG - Intronic
1073490513 10:103850223-103850245 CAGAGGGGAAGGGAAGAGAAGGG - Intronic
1073597737 10:104817443-104817465 GAGAGGAGGAAGAAGGAGAAGGG - Intronic
1073651961 10:105370482-105370504 AAGTGGAGAAGGAACAAAAAAGG - Intergenic
1073717196 10:106121149-106121171 CAGTAGAGCAGGAGAGAGAAAGG + Intergenic
1073877408 10:107940890-107940912 CAGTAAAGAATGAGGGAGAAGGG + Intergenic
1074078738 10:110151579-110151601 AAGTGGAAGAGGAAGGAGACAGG - Intergenic
1074135287 10:110620222-110620244 CAGTGGAGGAGGTGGGGGAAGGG + Intergenic
1074278742 10:112029956-112029978 CAGTGAGGAAAGAAAGAGAATGG - Intergenic
1074600859 10:114911919-114911941 CTGTTGAGTAGGAAGTAGAAAGG - Intergenic
1074827164 10:117222941-117222963 CTGTTGAGAAGGAAGGAGGGAGG - Intergenic
1074984058 10:118641882-118641904 CAGTGGGGAGGGAAAGAGAAGGG - Intergenic
1075010729 10:118867591-118867613 AAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1075050107 10:119177315-119177337 CCTAGGAGAAGGAAGCAGAAGGG - Intronic
1075070849 10:119319116-119319138 CAGGGCAGGAGGAAGGAGAGTGG - Intronic
1075262369 10:120974337-120974359 CAGGGAGGAAGTAAGGAGAATGG - Intergenic
1075410325 10:122223019-122223041 GAGAGGAGGAGGAAGGAGACAGG - Intronic
1075478349 10:122756247-122756269 CTTGAGAGAAGGAAGGAGAAGGG + Intergenic
1075563030 10:123482143-123482165 CAGATAAGAAGGAAGGGGAAAGG - Intergenic
1075710335 10:124527301-124527323 AAGTGAAGAAGGAAGGAAAGGGG + Intronic
1075724818 10:124605838-124605860 CAGTGGAGGGGGAGGGGGAAGGG + Intronic
1075800182 10:125148936-125148958 CCGTGGAGGAGCGAGGAGAATGG + Intronic
1075945829 10:126432352-126432374 AAATGTAGAAGGAAGGAGAAAGG - Intronic
1076066909 10:127456025-127456047 CAAGGGGGATGGAAGGAGAAAGG - Intergenic
1076186408 10:128453040-128453062 CAGTGGTGATGGAAAAAGAATGG + Intergenic
1076558724 10:131347070-131347092 GAGGGGAGAAGGAAGAAGAAAGG - Intergenic
1076854305 10:133108420-133108442 CCGTGGAGAAGGAAGCAGGGAGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077787796 11:5403289-5403311 CACTGGAGAAGGGAGGAAGAAGG + Exonic
1077803333 11:5563987-5564009 GAGTGAAGAAGAAAGGAGAGTGG - Intronic
1077888908 11:6405009-6405031 GGGTGGGGAAGGGAGGAGAAAGG + Intronic
1077996722 11:7459018-7459040 CAGTGTAGAAGCAAGGAACATGG + Intronic
1078110789 11:8390093-8390115 CATCAGAGAAGGAAGGAAAATGG - Intergenic
1078255224 11:9653127-9653149 CAGTGGAGAATTAAGAAGAAAGG - Intergenic
1078378599 11:10818701-10818723 CAGTGGAGAAAGAAGAGGAGGGG - Intronic
1078436572 11:11330483-11330505 CCGTGGAGAAGGCAGGAGGGAGG + Intronic
1078807953 11:14725504-14725526 AAGGGGAGAAGGAGGGGGAAGGG - Intronic
1079104182 11:17559816-17559838 AAGGGAAGAAGGAAGGAGGAAGG + Intronic
1079176880 11:18150463-18150485 CAGTCATGAAGGAAGGTGAAAGG + Intronic
1079436436 11:20457252-20457274 TGGAAGAGAAGGAAGGAGAAAGG - Intronic
1079694831 11:23468353-23468375 CAGTTATCAAGGAAGGAGAATGG + Intergenic
1080047330 11:27822458-27822480 AAGGAGAGAGGGAAGGAGAAAGG - Intergenic
1080137998 11:28880541-28880563 CAGTGGATAGGGTTGGAGAAAGG - Intergenic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1080885785 11:36366874-36366896 AAGGGGAGAAAGAAGGAGAGAGG - Intronic
1080930339 11:36803569-36803591 AAGTAGAAAAGGAAGCAGAAGGG - Intergenic
1081014081 11:37854583-37854605 AAATAAAGAAGGAAGGAGAAAGG + Intergenic
1081073357 11:38638037-38638059 GAGGGGAGAGGGAAGAAGAAAGG - Intergenic
1081246927 11:40778624-40778646 CGGTAGAGGAGGAAGGAAAAAGG + Intronic
1081307627 11:41533040-41533062 AAGTAGAGAAGGCAGGAGTAGGG - Intergenic
1081618654 11:44605437-44605459 CAGTGAAGAGGGAGGGAGAGAGG - Intronic
1081842560 11:46213620-46213642 CAGCCCAGATGGAAGGAGAAGGG - Intergenic
1082724863 11:56722261-56722283 GAGTTTAGAAGGATGGAGAATGG + Intergenic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083142523 11:60733703-60733725 AAGTGGAGGAAGAAGGAGCATGG + Intronic
1083207635 11:61161974-61161996 CAGGGGGGAAGGGAGGAGATGGG - Intergenic
1083358995 11:62092247-62092269 AATTGGAGAAGGAAAGAAAATGG + Intergenic
1083537200 11:63480387-63480409 GATTGGAGAAGGAAAGAGGAGGG + Intronic
1083555491 11:63622939-63622961 CTGGGGAGAAGGAAGGACCAGGG - Intergenic
1083743119 11:64721628-64721650 GAAGGGAGAGGGAAGGAGAAGGG - Intronic
1083743333 11:64722500-64722522 AAGTGGAGAGGGAAGGAAAGGGG - Intronic
1083777627 11:64902037-64902059 CAGAGGAGAAGGAAGATGAAAGG - Exonic
1084001615 11:66298278-66298300 TATTGGGGAAGGGAGGAGAATGG - Intergenic
1084235324 11:67784526-67784548 CAGAGGCTGAGGAAGGAGAATGG + Intergenic
1084245738 11:67855859-67855881 TAATGGAGAAGAAAGGGGAATGG + Intergenic
1084332905 11:68440060-68440082 CATTAAAGAAGGAAGCAGAAGGG - Intronic
1084826949 11:71738719-71738741 TAATGGAGAAGAAAGGGGAATGG - Intergenic
1084956791 11:72695864-72695886 CACTGGAGAGGGGAGGAGGAGGG + Exonic
1085185156 11:74569829-74569851 CACAGGAGAAGGAGGTAGAAGGG - Intronic
1085326571 11:75610985-75611007 AAGTGGAGAAGTGAGGAGGAGGG - Intronic
1085363801 11:75918272-75918294 CAGAGGCTAAGGCAGGAGAATGG + Intronic
1085487411 11:76877763-76877785 CAGAGGAAAAGGAAGAAGATGGG - Intronic
1085899635 11:80683584-80683606 CAATGGAGATGGAATAAGAATGG + Intergenic
1086170647 11:83832604-83832626 GAGTGGGGAGGGAAGGAAAAGGG + Intronic
1086173764 11:83865541-83865563 CTGTAGAGAAGGGAGGGGAAAGG + Intronic
1086473431 11:87142709-87142731 AAGGGGTGAAGGAGGGAGAAGGG - Intronic
1087221876 11:95555094-95555116 CTGTGAAGAAGGAAGTAAAATGG - Intergenic
1087276821 11:96169343-96169365 CAGAGCAGGAGGAAAGAGAATGG - Intronic
1087332302 11:96795958-96795980 CAGTAGAGAAGCAAGGGTAAAGG - Intergenic
1087433217 11:98080021-98080043 CAGAGCAGGAGGAAGGAGCAGGG - Intergenic
1087520114 11:99222316-99222338 AAGTAGGGAAGGAAGGATAAAGG + Intronic
1088026627 11:105192725-105192747 CAGTGAAGAGTGAAAGAGAAAGG - Intergenic
1088275615 11:108082254-108082276 GAGAGAAGAAGGAAGGGGAAGGG - Intronic
1088394041 11:109347824-109347846 AAGGAGGGAAGGAAGGAGAAAGG - Intergenic
1088650078 11:111949774-111949796 CAGAGGTGATGGAAGGAGGAAGG - Intronic
1088979858 11:114852342-114852364 CACTGCTGGAGGAAGGAGAAAGG + Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089290268 11:117433397-117433419 GAGGGGAGAAGGGAGGAGAAAGG + Intronic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1089498863 11:118921550-118921572 CATTGGAGGAGGAACGGGAACGG + Intronic
1089567369 11:119378815-119378837 TAGAGGAGAAGGAAGGAGACCGG - Intronic
1089666158 11:120021284-120021306 CAGTGGAAAAGGAACCAGAGAGG + Intergenic
1089782674 11:120884557-120884579 CAGGGGTGGAGGAAGGAGAGAGG - Intronic
1090284241 11:125485341-125485363 CAGTGGAGGAGGGTGGAGACTGG + Intronic
1090464974 11:126925619-126925641 CAGTGGAGAATGAAGCTGGACGG - Intronic
1090644804 11:128758751-128758773 GAGTGGAGAAGGGATGAGGAAGG + Intronic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1091075180 11:132608857-132608879 CAGTGGAGCAGGAGGAAGCAAGG - Intronic
1091375509 12:22488-22510 CAGGGGAGAAGGAAGGATGGAGG + Intergenic
1091510777 12:1123286-1123308 CAGTGGAGAATAGAGAAGAATGG + Intronic
1091682992 12:2540197-2540219 CTGGGGAGAGGGAAGGAGAGTGG + Intronic
1091699521 12:2650779-2650801 AAGGGGAGAGGGAAGGTGAAGGG - Intronic
1091934171 12:4422349-4422371 GGGTGGAGAAGGATGGAGAAGGG + Intergenic
1091957772 12:4661972-4661994 CAGTGGTGGTGGAAGTAGAAAGG + Intronic
1092146241 12:6216610-6216632 AAGTGGGGAAGGAAGGCTAAAGG - Intronic
1092163267 12:6327718-6327740 CAGGGGAGGAGGAAGAAGAGGGG + Exonic
1092253490 12:6914409-6914431 GAGTGGGGAAGGGAGGAGGATGG - Intronic
1092392838 12:8096515-8096537 TAGTGGAGAAGGAAGTTGCAAGG - Exonic
1092482105 12:8869016-8869038 CTGTGGAAAAGGTAGGAAAAGGG - Intronic
1092532272 12:9354328-9354350 CACTGGACAAGGGAGGGGAAGGG + Intergenic
1092846426 12:12589454-12589476 CTGGGTAGAAGGAAGGACAAAGG + Intergenic
1093102641 12:15046375-15046397 AAGGAAAGAAGGAAGGAGAAGGG - Intergenic
1093267444 12:17020301-17020323 CAGGGAGGAAGGAGGGAGAATGG - Intergenic
1093272623 12:17082843-17082865 CACTGGACAAGGGAGGGGAAGGG + Intergenic
1093734592 12:22606239-22606261 AAGGAGAGAAGGAAGGAGGAAGG - Intergenic
1093764018 12:22942128-22942150 CAGAGCAGGAGGAAGGAGTAGGG - Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094156086 12:27338221-27338243 AAGTGGATAAAGCAGGAGAAGGG + Intronic
1094303064 12:28987874-28987896 CGGTGGAGAAAGAGAGAGAATGG - Intergenic
1095162988 12:38938236-38938258 CACTGGACAAGGGAGGAGAAGGG + Intergenic
1095411171 12:41924841-41924863 CTGTTCAGAAGAAAGGAGAAAGG + Intergenic
1095516443 12:43011403-43011425 CAGTGGAGAAGAATAGGGAAGGG + Intergenic
1095766488 12:45901273-45901295 CAGAGGATGAGGCAGGAGAATGG - Intronic
1096297678 12:50397641-50397663 CAGTGGGGAAGGAAGGAACCAGG - Intronic
1096464688 12:51841783-51841805 CAGAGGAGTGGGGAGGAGAAAGG + Intergenic
1096596822 12:52701177-52701199 GAGAGGAGCAGGGAGGAGAAAGG - Intronic
1096628802 12:52912241-52912263 CAGTGGGGAAGGCAGCAGAGGGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096747894 12:53740127-53740149 CAGTGGAGGTGGAGGGAGAGCGG - Intergenic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096869693 12:54585552-54585574 CAGTGGGGAGGGAAGGCAAATGG + Intronic
1096878230 12:54646934-54646956 CACTGGAGAAGGACAGAGCATGG - Intronic
1096881836 12:54679485-54679507 CATGGGAGAAGGCAGAAGAATGG - Intergenic
1097083389 12:56449477-56449499 TGGTGAAGAAGGAAGGAAAAGGG + Intergenic
1097270024 12:57768329-57768351 CAGTGGGGAATGAGGGAGTAAGG - Intronic
1097486264 12:60205657-60205679 CAGGAGAGAAGGCAAGAGAATGG - Intergenic
1097575912 12:61392093-61392115 GAATGGAGAAGGATAGAGAAAGG + Intergenic
1097587379 12:61530868-61530890 GAGAGGAGAAGGAGAGAGAAGGG - Intergenic
1098050699 12:66449474-66449496 CAGCTGAGATGGAATGAGAATGG - Intronic
1098082209 12:66799545-66799567 GAGGGGAAAAGGAAGGAGAGAGG - Intronic
1098460770 12:70730846-70730868 GAGAGCAGAAGGAAGGAGGAAGG + Intronic
1098460799 12:70731050-70731072 CAGAGAGGAAGGAAGGAGGAAGG + Intronic
1098671708 12:73238313-73238335 GACTGGAGAAGGTAGGGGAAAGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099096943 12:78386148-78386170 CTGTGGAGAAGTCAGTAGAATGG - Intergenic
1099323624 12:81182823-81182845 AAGTGGAAAGGGAAAGAGAATGG - Intronic
1099491135 12:83289749-83289771 GAGTGAAGAAGGAAGGACATGGG + Intergenic
1099740160 12:86624646-86624668 CAGTGGAGGAAGAAGGGGAAGGG + Intronic
1099876219 12:88409301-88409323 GAGTATAGAAAGAAGGAGAATGG + Intergenic
1099933185 12:89097293-89097315 GAGTAGGGAAGGAAGTAGAAAGG + Intergenic
1099990238 12:89713745-89713767 CAGAGCAGGAGGAAGGAGAGAGG + Intergenic
1100256250 12:92886418-92886440 GAGAGGAGAAGGGAAGAGAAAGG + Intronic
1100386520 12:94109215-94109237 GCGTGGAGGAGGAGGGAGAAGGG + Intergenic
1100679535 12:96903715-96903737 AAGAGGAGAAAGGAGGAGAAGGG - Intergenic
1100932427 12:99625229-99625251 CACTGGGGAGGGAAGGAGAGAGG + Intronic
1100975125 12:100114420-100114442 CAGTTGAGAAGAATGGAAAATGG - Intronic
1101010626 12:100445701-100445723 CAGAGGAAAAGAAAAGAGAAAGG + Intergenic
1101063591 12:100996692-100996714 CAGTGGGGCAGGGAGAAGAATGG + Intronic
1101064527 12:101005885-101005907 TAGGGGAAAAGAAAGGAGAAAGG - Intronic
1101345038 12:103878953-103878975 CAGGGGAGAAGGAAGCAGCAAGG - Intergenic
1101686633 12:107030189-107030211 CAATGAAGAAGGAACAAGAATGG + Intronic
1101877806 12:108607099-108607121 GAGGAGGGAAGGAAGGAGAAGGG - Intergenic
1101884379 12:108648871-108648893 CCGTGGGTAAGGAAGAAGAAAGG + Intronic
1101945347 12:109132063-109132085 CAGTGGAAAAGGTATGAGCAAGG + Intronic
1102099399 12:110266842-110266864 CAGTGGGGAGGGAAGGTAAAGGG - Intergenic
1102259881 12:111437359-111437381 CAGGGGAGGAGGAAAGAGAAGGG - Intronic
1102434564 12:112910882-112910904 CAGTGGAGAGGGCAGGAGGGAGG + Intronic
1102538825 12:113603217-113603239 GAAAGGAGAAGGAAGGACAAAGG - Intergenic
1102976086 12:117207966-117207988 AAGGGGAGAAGAGAGGAGAAGGG - Intergenic
1103164308 12:118757109-118757131 AAGGGGAGAAGGAAGGAGGGAGG + Intergenic
1103829195 12:123764765-123764787 TAGTGGAGAAGGGACGGGAATGG - Intronic
1103896649 12:124277794-124277816 AGGAGGAGAAGGAAGGAGAGGGG - Intronic
1104092680 12:125528990-125529012 AGGAGAAGAAGGAAGGAGAAAGG - Intronic
1104171797 12:126289120-126289142 CAATACAGAAGGAATGAGAAAGG - Intergenic
1104301397 12:127568343-127568365 GAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1104409120 12:128543524-128543546 CAGTAGGGAAGTGAGGAGAAAGG - Intronic
1104540533 12:129660380-129660402 CAGCAGAGGAGGCAGGAGAAAGG - Intronic
1105059563 12:133136282-133136304 AAGTGGAGAAGGAAGAGAAAGGG - Intronic
1105320229 13:19313128-19313150 CAAAGGAAAAGGATGGAGAAAGG - Intergenic
1105443177 13:20432045-20432067 GAGGGAAGAAGGAGGGAGAAAGG + Intronic
1105579741 13:21684079-21684101 AGGTGGAGAAGGCAAGAGAAAGG - Intronic
1105605567 13:21923849-21923871 CAGGGGACAAGGAAGTAGAGAGG - Intergenic
1105870846 13:24505155-24505177 CAGAGGAGAAAGAAAGAGAGAGG + Intronic
1106121770 13:26865666-26865688 CACTGGAGCAGGAGGGAGCAAGG - Intergenic
1106362672 13:29046855-29046877 AAGTGGAGAGGAAAGGGGAAGGG - Intronic
1107183356 13:37487718-37487740 AAGTGGAAGATGAAGGAGAAAGG + Intergenic
1107250694 13:38357847-38357869 CTGAGGAGAAGGAAGAGGAAGGG + Intronic
1107413153 13:40176290-40176312 CAGTGGAGAGGCAGGGAGAAAGG - Intergenic
1107432390 13:40351783-40351805 CAATGGAGTAGGAAGGAGGCAGG - Intergenic
1107520090 13:41171653-41171675 CAGAGGATTAGGAAGGAAAAAGG - Intergenic
1107576132 13:41724714-41724736 CAATGGGGAAGGAATGAGACTGG + Intronic
1107609733 13:42101128-42101150 CATTGCAGAAGGAAGGAGACAGG - Intronic
1107643167 13:42465391-42465413 GAGTGGAGAAGGAGGAAGAGGGG + Intergenic
1107819499 13:44273453-44273475 CAGTGGTGAAGAAATGAGGATGG - Intergenic
1108761499 13:53571462-53571484 AACTGGAGAAGGAAGAAGAGAGG - Intergenic
1108784597 13:53880807-53880829 AAGTTGAAAAGGAAGGAGTAGGG - Intergenic
1108900403 13:55397591-55397613 AAGTAGACAAGGAAAGAGAATGG - Intergenic
1108928915 13:55790020-55790042 AAATGGAGAAAGAAAGAGAAAGG - Intergenic
1109448986 13:62483784-62483806 GAGTGGAGAAAGAGGAAGAAGGG - Intergenic
1109665721 13:65533333-65533355 AAGGAGGGAAGGAAGGAGAAAGG - Intergenic
1109834593 13:67840772-67840794 CAGTGGAGAACTAAGGCTAAAGG + Intergenic
1110259259 13:73467044-73467066 CAGTGGAGAAGGTAGCAGGCTGG + Intergenic
1110351324 13:74511567-74511589 CAGTGGAGAGGATAGGAGCAGGG - Intergenic
1110533590 13:76625810-76625832 AAGAAGAGAAGGAGGGAGAAAGG - Intergenic
1110868021 13:80420037-80420059 TATGGGAGAAGGGAGGAGAAGGG - Intergenic
1110894266 13:80729434-80729456 CAGTGAGGAAGGGATGAGAAAGG + Intergenic
1111216672 13:85152091-85152113 GAAGGAAGAAGGAAGGAGAAAGG - Intergenic
1111331593 13:86765430-86765452 AGGTGGGGAGGGAAGGAGAAAGG + Intergenic
1111501513 13:89127606-89127628 CATGGCAGCAGGAAGGAGAAAGG + Intergenic
1112015186 13:95325604-95325626 GAAGGGAGAAGGAAGGAGGAAGG + Intergenic
1112167452 13:96934878-96934900 ATGTAGAGAAGGAAGCAGAATGG + Intergenic
1112597723 13:100824054-100824076 AAGTGGTGATGGAAAGAGAATGG - Intergenic
1112873610 13:104006799-104006821 GACTGGAGAAGGAAGAATAACGG + Intergenic
1112915142 13:104539210-104539232 CAGAGCAGAAGGAAAGAGAGTGG + Intergenic
1113144746 13:107196148-107196170 GAGTGGAGAAGGTGGAAGAAGGG + Intronic
1113149987 13:107252481-107252503 GAGAGGAGAAGGAAGGAGGAGGG + Intronic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113600141 13:111562871-111562893 CTGTGGAGAAGTTAGGAGAAGGG + Intergenic
1114010367 14:18359769-18359791 CACTGGATAAGGGAGGGGAAAGG - Intergenic
1114127287 14:19743703-19743725 CAGAGGAGCAGGAAGGGGAGGGG - Intronic
1114168928 14:20251218-20251240 CACTGGAGAAGAAAGGTCAAGGG + Intergenic
1114204639 14:20557390-20557412 AAGGAGAGAGGGAAGGAGAAAGG + Intronic
1114308249 14:21442709-21442731 GAGAGGAGAAGGGAGGAGAGGGG + Intronic
1114378662 14:22177112-22177134 CAGTGGGGAAGGCAGGGGCAGGG - Intergenic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114634650 14:24180575-24180597 GGGTGGAGAGGGAGGGAGAAAGG + Intronic
1115275608 14:31605849-31605871 GAGGAGACAAGGAAGGAGAAGGG - Intronic
1115275619 14:31605896-31605918 GAGGAGAGAAGGAAGGAGAAGGG - Intronic
1115511588 14:34142667-34142689 CAGAGGCTAAGGCAGGAGAATGG + Intronic
1115524660 14:34267702-34267724 AGGTGGTGAAGGATGGAGAATGG - Intronic
1116305438 14:43248042-43248064 AAGTAGGGAAGGAGGGAGAAAGG - Intergenic
1116929708 14:50677867-50677889 TAGTAGAGAAGGAAGAGGAACGG + Intergenic
1117286546 14:54291258-54291280 GAGTGGAGGAAGAAAGAGAAGGG + Intergenic
1117545444 14:56791212-56791234 CAGTGGAGAATTAAGGAAAGGGG - Intergenic
1117669977 14:58096682-58096704 GAGGGGAGAAGGGAGGAAAAGGG + Intronic
1117875338 14:60246119-60246141 CAGTGGAAAAGGATGGTGAGGGG + Intronic
1117877761 14:60273414-60273436 GAGTAGAGAATGTAGGAGAAGGG + Intronic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118240037 14:64047172-64047194 CAGTGGAGAGGGAAGCTGGAGGG + Intronic
1118270376 14:64338041-64338063 CACTGGAGAAGGAATAAGATGGG - Intronic
1118840508 14:69506519-69506541 AAGTGGAAAAGAAATGAGAAAGG + Intronic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1118971968 14:70644365-70644387 CACTGGAGAAGGCAGCAGAGGGG - Intronic
1119162111 14:72461254-72461276 CAGTGGAGAGGGTGGGAGGATGG + Intronic
1119389525 14:74281555-74281577 CAGTTGAGAAGGAAGCAGAGTGG - Intergenic
1119443777 14:74647309-74647331 CAATGGCAGAGGAAGGAGAAGGG - Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119545186 14:75466845-75466867 ATTTGGAGAAGGAAGGAGATAGG - Intronic
1119875812 14:78058232-78058254 GAGGTGATAAGGAAGGAGAAAGG - Intergenic
1119931448 14:78551632-78551654 CAGGAAAGAAGGAAGGAGAAAGG - Intronic
1119963591 14:78887793-78887815 CATTGGAGAAGGAAGTGGCATGG + Intronic
1119996833 14:79262445-79262467 AAGAGGAGGAGGAAGGAGGAAGG + Intronic
1120112612 14:80575505-80575527 CAGGGGGGAAGGTAAGAGAAAGG + Intronic
1120143589 14:80955514-80955536 CTGTGGAGGAGGCTGGAGAAGGG - Exonic
1120401837 14:84042105-84042127 CTTTGGAGAAGGAAGGAGAGGGG + Intergenic
1120440352 14:84529112-84529134 AAGAGGAGGAGGAAGAAGAAAGG - Intergenic
1120583910 14:86287345-86287367 AAGGGAAGAAGGAAAGAGAAGGG + Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120895417 14:89527054-89527076 GAGAGGAGGAGGAAGGGGAAGGG + Intronic
1121018979 14:90567401-90567423 TAGTGGAGAGCGAAAGAGAAAGG + Intronic
1121059302 14:90889862-90889884 CAGTACAGAAAGAAGGAGCAAGG - Intronic
1121068267 14:90990875-90990897 GAGGGGAGAGGGTAGGAGAAGGG + Intronic
1121492416 14:94369846-94369868 CCCTGGGGAAGGCAGGAGAAGGG + Intergenic
1121542923 14:94741977-94741999 GAGAGGAAAATGAAGGAGAAAGG - Intergenic
1121601324 14:95205884-95205906 AAGTTAAGAAGGAAGGACAATGG + Intronic
1121685496 14:95832262-95832284 GAGAGGAGAAGGGAGGAGACCGG - Intergenic
1121777039 14:96598032-96598054 GAGGGGAGGAGGGAGGAGAAGGG - Intergenic
1121941746 14:98077340-98077362 CAGCAGAGAAGGAATGAGATGGG - Intergenic
1122047330 14:99033624-99033646 CACTTGAGAAGGTAAGAGAATGG + Intergenic
1122170397 14:99869436-99869458 CAATGGAGAGGGAAAGAGATGGG - Intronic
1122293733 14:100693606-100693628 CCATGGAGAGGGAAGGAGGAAGG - Intergenic
1122373411 14:101242186-101242208 CAGAGGAGAGGGGAGGGGAAGGG + Intergenic
1122436361 14:101703361-101703383 CAGTGTAGAAGGACAAAGAATGG + Intergenic
1122879453 14:104683495-104683517 GAGGGGAGAGTGAAGGAGAAGGG + Intergenic
1123570743 15:21605342-21605364 CAGAGGAGCAGGAAGGGGAGGGG - Intergenic
1123606856 15:22040695-22040717 CAGAGGAGCAGGAAGGGGAGGGG - Intergenic
1123655030 15:22508307-22508329 CAGTGCAGAGGGATGGAAAAAGG + Intergenic
1123695421 15:22875720-22875742 CACAGGAGATGGAAGGAGTAGGG + Intronic
1123736391 15:23188242-23188264 GAGAGGAGAAGGAAGGGGAGGGG - Intergenic
1123954205 15:25316984-25317006 CAGTGGAGAAAACAGGACAAAGG - Intergenic
1124287097 15:28411219-28411241 GAGAGGAGAAGGAAGGGGAGGGG - Intergenic
1124601221 15:31134101-31134123 GTGTTGAGAAGGAAGGGGAATGG + Intronic
1124805729 15:32880519-32880541 CAGTGGAGAAGGAAGGTGAATGG - Intronic
1124905088 15:33860827-33860849 CAGTGGAGGAGGCAGCAGAGTGG - Intronic
1124919442 15:34011613-34011635 CAGAGGGGAAGGGAGGAGAGAGG + Intronic
1125007373 15:34832941-34832963 AAGAGGATAAGGGAGGAGAAGGG + Intergenic
1125141918 15:36418409-36418431 AAGTAGAGAAGGCAGGAGAGAGG + Intergenic
1125331891 15:38590584-38590606 CAGAGAAGATGGAAGGAGAGAGG - Intergenic
1125542447 15:40477771-40477793 CTGTGGAGGATAAAGGAGAAGGG + Intergenic
1125982087 15:44011662-44011684 CAAAGGAGGAGGAAAGAGAAGGG + Intronic
1126157492 15:45578915-45578937 CAGAGAAAAAGGGAGGAGAAGGG - Intergenic
1126951241 15:53884199-53884221 CTGTGGAGCAGGAAGACGAAGGG + Intergenic
1126967333 15:54069867-54069889 CTGTGGCCAAGGAAAGAGAAAGG - Intronic
1127186368 15:56484967-56484989 CATGGCAGCAGGAAGGAGAAGGG - Intergenic
1127360395 15:58240136-58240158 CAGTTGAGAAGGAGCCAGAAAGG - Intronic
1127695319 15:61441220-61441242 CAGAGCAGGAGGTAGGAGAAGGG - Intergenic
1127853858 15:62938850-62938872 CAATGGAGATGGCAGGTGAAAGG - Intergenic
1128304178 15:66587096-66587118 AAGGGGAGAAGGAAGAGGAAGGG - Intronic
1128371274 15:67041208-67041230 AGGTAGAGAAGGAAGGAAAAGGG + Intergenic
1128371281 15:67041237-67041259 AGGTAGAGAAGGAAGGAAAAGGG + Intergenic
1128371288 15:67041266-67041288 AGGTAGAGAAGGAAGGAAAAGGG + Intergenic
1128371295 15:67041295-67041317 AGGTAGAGAAGGAAGGAAAAGGG + Intergenic
1128466124 15:67913852-67913874 CAGGGGTTAAGGAAAGAGAATGG + Intergenic
1128705119 15:69832593-69832615 AAGTGGAAGAGGAAGGGGAAAGG + Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128796913 15:70472808-70472830 CAATGTAGAGGGAAGGAGGAAGG + Intergenic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1129019416 15:72502924-72502946 CACAGGAGAAGGAAGGTAAAAGG - Intronic
1129234832 15:74217805-74217827 CAGGTGAGAAGGAAATAGAAGGG + Intergenic
1129501919 15:76047621-76047643 TAGAGGAGAGGGAAGGATAAAGG + Intronic
1129625983 15:77200125-77200147 CCGAGGAGGAGGAAGAAGAAGGG - Intronic
1129748113 15:78039075-78039097 TTCTGGAGAAGGAAGCAGAAAGG - Intronic
1129879176 15:78995930-78995952 GAGTGAAGGAGGAAGGGGAAAGG - Intronic
1130202481 15:81845099-81845121 AAGTGGGGAAGGAAAGAGATTGG + Intergenic
1130212154 15:81934431-81934453 CAGAGGCTAAGGCAGGAGAATGG - Intergenic
1130252329 15:82307627-82307649 CAGGGTAGAAGGAAGCAGAGGGG + Intergenic
1130383434 15:83391636-83391658 TAGGTGAGAAGGAAGGAGACAGG - Intergenic
1130668403 15:85889146-85889168 CAGGGGAGAAGGTGGAAGAAGGG + Intergenic
1130749959 15:86701300-86701322 CATTGGAGAGGGGAGGTGAAGGG + Intronic
1131267335 15:90924489-90924511 CAGTGGAGTAGGAAGGACTGGGG + Intergenic
1131531196 15:93193557-93193579 CAGAGCAGAAGGAAGAAGAAAGG - Intergenic
1131723298 15:95195319-95195341 CAGTTGTTAAAGAAGGAGAAGGG + Intergenic
1131876311 15:96810217-96810239 CAGTTGAGAAGGGATGAAAAAGG - Intergenic
1131968435 15:97869605-97869627 CAGTGGCGAAGGTAGGGGAGTGG - Intergenic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132299548 15:100767521-100767543 CAGAGAAGGAGGAAAGAGAAGGG + Intergenic
1202979096 15_KI270727v1_random:332465-332487 CAGAGGAGCAGGAAGGGGAGGGG - Intergenic
1132481238 16:167182-167204 CATGGGGGAAGGAAGGGGAAAGG - Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132715445 16:1287942-1287964 CCGTAGAGGAGGAAGGAGAGGGG + Intergenic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1133112101 16:3554185-3554207 CCTTGGAGGAGGAGGGAGAAGGG + Intronic
1133496897 16:6327100-6327122 AAGTGGAGAAGGAACGACAGTGG - Intronic
1133819780 16:9226191-9226213 AAGGAAAGAAGGAAGGAGAAGGG - Intergenic
1133907626 16:10036543-10036565 CAGAGGATGAGGCAGGAGAATGG - Intronic
1133915842 16:10108876-10108898 CAGAGGAGAAGGCAAGAGAAAGG + Intronic
1133966994 16:10538668-10538690 CAGTGGAGAAGGGAGGCCTAGGG + Intronic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134110986 16:11515563-11515585 AAGAGGAGAAGGGAGGGGAAGGG + Intronic
1134210847 16:12275294-12275316 CTGGGGAGAGGGAAGAAGAATGG + Intronic
1134213195 16:12295204-12295226 AAGTGGAGAAGCAAGGACATGGG - Intronic
1134375318 16:13666756-13666778 CAGTGGAGGAGGAAAGAGAGGGG + Intergenic
1134390362 16:13814320-13814342 TAGTGGTCAAGGAAGGGGAAGGG + Intergenic
1134451884 16:14368720-14368742 CAGGGGAGAAGGAATGGGAAGGG - Intergenic
1134692043 16:16197516-16197538 TAGAGGAGAAGAAGGGAGAAGGG + Intronic
1134867293 16:17619867-17619889 GAGTAGAGAAGGAAGGAAAGGGG - Intergenic
1135044040 16:19140151-19140173 CTGGGGAGAAGAAAGAAGAAAGG - Intronic
1135107259 16:19661033-19661055 AAATGGAGAGTGAAGGAGAAAGG - Intronic
1135149061 16:19989473-19989495 AAAGAGAGAAGGAAGGAGAAAGG - Intergenic
1135724998 16:24847353-24847375 AAGGAAAGAAGGAAGGAGAAAGG - Intronic
1135794841 16:25431959-25431981 AAGGAAAGAAGGAAGGAGAAAGG - Intergenic
1135914151 16:26589547-26589569 CAGTGCAGAAGGACAGATAAAGG - Intergenic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136480789 16:30540326-30540348 CAGAGGCTGAGGAAGGAGAATGG + Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1137017730 16:35393683-35393705 CAGGGGCCCAGGAAGGAGAAAGG + Intergenic
1137416166 16:48282703-48282725 CAGAGGAGAGGGAGAGAGAAAGG - Intronic
1137803370 16:51281799-51281821 CTTTGCTGAAGGAAGGAGAAAGG + Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138049724 16:53764142-53764164 TAGCTGAAAAGGAAGGAGAAAGG - Intronic
1138150895 16:54655793-54655815 AAGTGGAGAAGGAAGGAGAGGGG + Intergenic
1138197544 16:55062701-55062723 ATGTGGAGATGGAAGGGGAAAGG + Intergenic
1138322186 16:56125118-56125140 AAAGGGAGAAGGAAGGACAAAGG - Intergenic
1138657191 16:58498298-58498320 CAGGGCAGCAGGAAGTAGAATGG - Intronic
1139358784 16:66383631-66383653 CAGTGGAGACTCAAAGAGAAGGG - Intronic
1139431970 16:66915565-66915587 CAGTGGAGTAGGGAGGAACAAGG + Intronic
1139946361 16:70645052-70645074 AGGAAGAGAAGGAAGGAGAAAGG + Intronic
1140205917 16:72933319-72933341 CAGAGGAGTAGGAAGGTGGAGGG + Intronic
1140225181 16:73071214-73071236 CAGTGGAGCAGGAAATTGAATGG - Intergenic
1140268316 16:73439884-73439906 CAGTGGGGCAGGAAGGGGAGAGG + Intergenic
1140466213 16:75185192-75185214 CAGAGAAGATGAAAGGAGAATGG + Intergenic
1140509052 16:75494456-75494478 CTGTGAAAAAGGGAGGAGAAAGG + Intronic
1140953962 16:79845311-79845333 CAGTGCAGCAGGAAGGAGGTCGG + Intergenic
1141153120 16:81578505-81578527 TTTTGGAGAAGGAAGGAGAGAGG - Intronic
1141319743 16:82996233-82996255 CAGTTGAGAAGTAATGAAAATGG + Intronic
1141388565 16:83645646-83645668 GATTGGAGAAGGATGGGGAAGGG - Intronic
1141762712 16:86039097-86039119 GAGTGGGGAAGGAAGGGGACTGG + Intergenic
1141799726 16:86298573-86298595 CATTGCAGAAAGAGGGAGAAAGG + Intergenic
1141815044 16:86404094-86404116 CAGTGGAGCAGGCAGGAGTCAGG + Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142362586 16:89634540-89634562 GAAAGGAGAAGGAAGGGGAAAGG - Intronic
1142362595 16:89634573-89634595 GAAAGGAGAAGGAAGGGGAAAGG - Intronic
1142362604 16:89634606-89634628 GAAAGGAGAAGGAAGGGGAAAGG - Intronic
1142362625 16:89634669-89634691 GAAAGGAGAAGGAAGGGGAAAGG - Intronic
1142362644 16:89634732-89634754 GAAAGGAGAAGGAAGGGGAAAGG - Intronic
1142362667 16:89634813-89634835 GAAAGGAGAAGGAAGGGGAAAGG - Intronic
1142362768 16:89635180-89635202 GAAAGGAGAAGGAAGGGGAAAGG - Intronic
1142362773 16:89635197-89635219 GAAAGGAGAAGGAAGGGGAAAGG - Intronic
1142424219 16:89992462-89992484 CCGAGGGGAAGGGAGGAGAAAGG - Intergenic
1142478718 17:204949-204971 CAGTCGGGAAGGAGGGAGCAGGG + Intergenic
1142600255 17:1050406-1050428 CAGAGGAGCAGGGAGCAGAAAGG + Intronic
1142690957 17:1605849-1605871 CAGTGCTGAAGGGAGGGGAAGGG + Intronic
1142775898 17:2138711-2138733 CAGTGGACAGGGAGGGAGAGAGG - Intronic
1142889256 17:2932361-2932383 CAGTGGAGGAGGAGGGAGACTGG + Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143118512 17:4593646-4593668 CAGTGGAGGAGAAAGGAGGATGG - Intronic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143296126 17:5873318-5873340 CAGAGGTGAAGGAAGAAGAGAGG - Intronic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143397078 17:6609229-6609251 CAGGGGAGAAGGGAGAAGATAGG - Intronic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1143586028 17:7850932-7850954 CAGAGGAGTAGGAAGGGAAAGGG + Intronic
1143961243 17:10722453-10722475 GAGTACAGAAGGCAGGAGAAGGG - Intronic
1144050725 17:11495300-11495322 AAGGTGAGAAGGAAGGAGAGAGG - Intronic
1144127534 17:12217205-12217227 CAAAGGGGAAGGAAGCAGAAAGG - Intergenic
1144235648 17:13258019-13258041 CAGTGGAGGGGGAAGGGGAAGGG - Intergenic
1144333196 17:14243205-14243227 GAGGGGAGAAGAAAGGAGGAGGG + Intergenic
1144753832 17:17667840-17667862 GAGGGCAGCAGGAAGGAGAAGGG + Intergenic
1144764832 17:17726615-17726637 CAGTGGTGAATGAATGAAAAGGG + Intronic
1144844482 17:18209341-18209363 CAGTGGAGAAGGGAAGGGAAAGG - Exonic
1145079922 17:19886339-19886361 AAGGAAAGAAGGAAGGAGAAGGG - Intergenic
1145105148 17:20109216-20109238 CAGTGGAGTAGGATGGAGCAGGG + Intronic
1145259260 17:21345072-21345094 CAATGGAGAGGGAGGCAGAATGG - Intergenic
1145317356 17:21742876-21742898 CAATGGAGAGGGAGGCAGAATGG + Intergenic
1145872474 17:28286420-28286442 GAGAGGAGAGGGAATGAGAATGG - Intergenic
1146178138 17:30679670-30679692 CAGAGGAGCAGGAAGGAGGGGGG + Intergenic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1146401717 17:32504921-32504943 CAGTGGAGAAGGAGCGGGAGCGG - Intronic
1146403758 17:32519937-32519959 TAGTTAAGAAGGGAGGAGAAAGG + Intronic
1146507035 17:33414404-33414426 CAGGGGAGAAGGAAGTAGAGGGG + Intronic
1146570079 17:33944895-33944917 CAGGGGTGAGGGAAGCAGAAAGG - Intronic
1146582672 17:34052950-34052972 GAGGGTGGAAGGAAGGAGAAGGG - Intronic
1146661157 17:34665972-34665994 CAGTGAGGAAGAAAGGAGAGAGG + Intergenic
1146846535 17:36184617-36184639 ATGTGGAGAAAGAAGCAGAATGG - Intronic
1146916759 17:36682905-36682927 CAGTTGGGAGGGAAGGAGGAAGG - Intergenic
1147189568 17:38730674-38730696 CAGTGGAAAGGGAAGGACACGGG - Intronic
1147703698 17:42411843-42411865 CAGTGGGGATGGGAGGGGAATGG - Intronic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148574882 17:48703153-48703175 CAGGGGAGAAGAAAAGAGTAAGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148737042 17:49870813-49870835 AAGGGGAGAGGGAAGGAAAAAGG - Intergenic
1148758263 17:49985959-49985981 GAATGGAGGGGGAAGGAGAAGGG - Intergenic
1148794409 17:50190215-50190237 CAGGGGAGAAGGGTGGAGACGGG - Intronic
1148849046 17:50545628-50545650 CAGTGGAGAATGAACTGGAAAGG - Intronic
1149071660 17:52550675-52550697 CAGGGCAGCAGGAAAGAGAACGG - Intergenic
1149276644 17:55047428-55047450 CAATGGAGAAGTAATGAGATTGG - Intronic
1149291331 17:55220487-55220509 CAGTGGAAAAGTAAAGAGGAAGG - Intergenic
1149294452 17:55249334-55249356 GAGTGGGGAAGGAATGAGGAAGG - Intergenic
1149387521 17:56156629-56156651 AGGTGGAAAAGGAAGGAGTAAGG + Intronic
1149479959 17:56995400-56995422 AAGAGGGGAAGGAAGGAGAACGG - Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1149849886 17:60028014-60028036 CCATGGAGAAGGAAGCAGAAAGG - Intergenic
1149860282 17:60118510-60118532 CCATGGAGAAGGAAGCAGAAAGG + Intergenic
1149869985 17:60172352-60172374 AAGTGGAGGAGGAAGAAAAAAGG - Intergenic
1149930594 17:60750843-60750865 CAGTGGATAAGGAACAAGAAGGG - Intronic
1149965226 17:61155871-61155893 GAGTGGAGAGGGAAGAAGGAGGG - Intronic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150264137 17:63820937-63820959 CGCTAGAGAGGGAAGGAGAAAGG + Exonic
1150592036 17:66571796-66571818 GAGTGGAGAAGGTAGAAAAATGG + Intronic
1150611323 17:66735746-66735768 CTTTGGAGAAGGCTGGAGAAAGG + Intronic
1151071296 17:71215723-71215745 CCGTGAAGAAGGAGAGAGAAAGG + Intergenic
1151133649 17:71924390-71924412 GAGAGAGGAAGGAAGGAGAAGGG + Intergenic
1151226111 17:72649391-72649413 CAGTAGGAGAGGAAGGAGAAAGG + Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151416891 17:73972487-73972509 CAGTTGAGAAGGAAAGAGGAGGG + Intergenic
1151450215 17:74194211-74194233 CAGGGGTGGAGGGAGGAGAAGGG - Intergenic
1151454557 17:74218213-74218235 CAAGGGAGGAGGAAGGAGGAGGG - Intronic
1151829438 17:76540918-76540940 CAGAGGAGGAGGAGGGGGAAGGG - Intronic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1153431625 18:5023556-5023578 CAGTGGAGAAGGTAATTGAAGGG + Intergenic
1153950982 18:10057487-10057509 TAGGGGACAGGGAAGGAGAATGG + Intergenic
1154088644 18:11334924-11334946 CAATGGAGAAGGAATAAGTAAGG - Intergenic
1155015084 18:21828408-21828430 AACTTGAGAAGGAAGGACAAGGG + Intronic
1155069568 18:22302420-22302442 CAGTGAGCAAGAAAGGAGAAAGG + Intergenic
1155351264 18:24909579-24909601 CAATGGACTAGGAAAGAGAATGG - Intergenic
1155766283 18:29637262-29637284 CAGATCAGAAGGAAGGTGAATGG - Intergenic
1155912135 18:31516216-31516238 CAATGGAGAAGGAAGATAAAAGG + Intronic
1156436604 18:37137297-37137319 CAGAAGAGAAGGAATGAGAGTGG - Intronic
1156446255 18:37239314-37239336 CAGAGGAGATGGAAGGATTAGGG - Intergenic
1156476739 18:37410254-37410276 GAGCAGAGAAGGAAGGAGACAGG - Intronic
1156720105 18:40059566-40059588 CAGAGAAGAAGGAATGATAAAGG - Intergenic
1156753753 18:40494830-40494852 CAAAAGAGAAGGAAGGAAAAAGG + Intergenic
1156808329 18:41215135-41215157 GAGTGGACAAGGAAGCTGAACGG - Intergenic
1156961297 18:43034901-43034923 CAGAGGAGGAGGAAGGTGAGAGG - Intronic
1157339159 18:46764009-46764031 CAATGGAGAACGAATGTGAATGG + Intergenic
1157385547 18:47257092-47257114 GAGAGGAGAAAAAAGGAGAAGGG + Intergenic
1157385932 18:47260200-47260222 CAGTGGAGAAGGGAAGAGGGAGG - Intergenic
1157393292 18:47321153-47321175 CAGTGTAGAAGGGAGTACAAGGG - Intergenic
1157449368 18:47773739-47773761 CATTGGAGAGGGAGGGAGCAGGG + Intergenic
1157544010 18:48535262-48535284 CAGTGCAGAAGGAAGGAAGTTGG - Intergenic
1157980473 18:52373994-52374016 CAGAGGCTGAGGAAGGAGAATGG - Intronic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1158041534 18:53100619-53100641 AGGTGGGGAAGAAAGGAGAAAGG + Intronic
1158332761 18:56380844-56380866 CACTGAAGCAGGAAGTAGAATGG + Intergenic
1158577984 18:58656316-58656338 CAGTGAGGAAGGAAGGAGGTAGG - Intergenic
1158684961 18:59605179-59605201 AAATGGAGAAGGAAGGAGTCTGG + Intronic
1159019461 18:63131482-63131504 CAGTGGGGCAGGAAGGAGTCAGG + Intronic
1159058749 18:63492732-63492754 CAGAGGAGAATGAAGGAGCAGGG - Intronic
1160119671 18:76118749-76118771 AAGAACAGAAGGAAGGAGAAGGG - Intergenic
1160139442 18:76307937-76307959 GAATCGGGAAGGAAGGAGAAAGG - Intergenic
1160200339 18:76790598-76790620 AAGAAAAGAAGGAAGGAGAAAGG + Intergenic
1160307990 18:77759029-77759051 CAGTGGAGAAGGAAGACCATAGG + Intergenic
1160425495 18:78776237-78776259 ATGTGGAGGAGGAAGGAGACTGG + Intergenic
1161022366 19:2016077-2016099 GAGGGGAGAAGGGAGGTGAATGG + Intronic
1161225948 19:3146041-3146063 CAGAGGAGAAGGCCGGAGCACGG - Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161756665 19:6138771-6138793 GAGGGAAGAAGGAAGTAGAAAGG + Intronic
1161803538 19:6429480-6429502 GAGGGGAGGAGGAGGGAGAAAGG + Intronic
1161803545 19:6429508-6429530 GAGGAGAGGAGGAAGGAGAAAGG + Intronic
1162363950 19:10236588-10236610 CAGTGGAGGAGGAAGGAAACAGG + Intergenic
1162424775 19:10588005-10588027 CAGAGGAGAAAGAAGGTGAATGG - Intergenic
1162470282 19:10869050-10869072 CAGAGAGGAAGGCAGGAGAAGGG + Intronic
1162617465 19:11813924-11813946 CCGTGCAGAAGGAAGGAGCAGGG + Intergenic
1162777252 19:12987372-12987394 GAGGGGAGAGGGAAGGAGAAGGG + Intergenic
1162829493 19:13275652-13275674 CCATGGAGGAAGAAGGAGAAGGG - Intronic
1162836800 19:13325053-13325075 AAGAGGAGGAGGAAGGGGAAGGG - Intronic
1163204904 19:15795212-15795234 CAGAGAAGAAGGAAGGGGGAGGG - Intergenic
1163442691 19:17329633-17329655 CAGGAGAGAAGGATGGAGGAGGG + Intronic
1163499364 19:17666708-17666730 AAGGGGTGGAGGAAGGAGAAAGG + Intronic
1163618732 19:18344953-18344975 GAGAGGAGAACCAAGGAGAAGGG - Intronic
1163671960 19:18634713-18634735 GAGAGGAGAGGGGAGGAGAATGG - Intergenic
1163685106 19:18708176-18708198 CAGGGAAGGAGGAAGGAGAGAGG + Intronic
1164425998 19:28142463-28142485 AAGGGGAGAGGGAGGGAGAACGG + Intergenic
1164453749 19:28389611-28389633 GAAGGGAGAAGGAAGGGGAAAGG + Intergenic
1164567675 19:29339519-29339541 AGGAGGAGGAGGAAGGAGAAGGG + Intergenic
1164592175 19:29513080-29513102 GAGATGAGAAGGAAGGAGAGGGG + Intergenic
1164592266 19:29513401-29513423 GAGATGAGAAGGAAGAAGAAGGG + Intergenic
1164680427 19:30130827-30130849 AAAGGGAGAAGGAAGGAGGAGGG - Intergenic
1164745202 19:30606947-30606969 GAGTGGAGAAGGGAGGGGAAAGG + Intronic
1164858259 19:31542153-31542175 CAGTGAGAAAGGGAGGAGAAGGG + Intergenic
1165136962 19:33675612-33675634 CAGTGGGGCAGGAAGGAGGCTGG - Intronic
1165213461 19:34253490-34253512 GTGTGGAGAAGGAAGGACTACGG - Intergenic
1165259514 19:34599783-34599805 AAATGGAGAAGGAAGAAGAGAGG - Intronic
1165379473 19:35468164-35468186 GGATGGAGAAGGAAGGAGAAGGG + Intergenic
1165663497 19:37604410-37604432 CAGAGGCTAAGGCAGGAGAATGG - Intronic
1165674046 19:37706207-37706229 GAGAGGAGAAGAGAGGAGAAAGG + Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1166274922 19:41746681-41746703 CACAGGAGAAAGAAGGAAAATGG + Intronic
1166655405 19:44607630-44607652 AAGTGGAGAGGAAAGGGGAAGGG - Intergenic
1167427918 19:49439022-49439044 CAGGGGACAAGGACAGAGAAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168140497 19:54383543-54383565 TTGTGGAGCTGGAAGGAGAAAGG + Intergenic
1168253145 19:55152293-55152315 AAGAAGAGAAGGAAGGAGACAGG - Intronic
1168312866 19:55470007-55470029 GAGAGGAGAGGAAAGGAGAAGGG + Intergenic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
1168501906 19:56899956-56899978 AAGGGAAGGAGGAAGGAGAAGGG + Intergenic
1168543510 19:57231686-57231708 GAGAGGGGAGGGAAGGAGAAGGG - Intronic
924972506 2:141836-141858 CGCTGGAGAAGGAGGAAGAAAGG + Intergenic
925172027 2:1755756-1755778 TATTGGAAAAGGAAGGAGAAAGG - Intergenic
925500555 2:4499512-4499534 AAGTGGAGGAGGCAGGAGAAAGG + Intergenic
926053040 2:9756929-9756951 CTGTGGAGAAGGAATGGGAGCGG + Intergenic
926188176 2:10707962-10707984 CAGTGCAGAAGGGAGGAAATCGG - Intergenic
926292040 2:11539006-11539028 GAGAAGAGAAGGGAGGAGAAGGG - Intronic
926455854 2:13068034-13068056 CATTAGAGAAGAAAGGACAAAGG - Intergenic
926459276 2:13108985-13109007 CAGGGGAAAAGGTGGGAGAAGGG + Intergenic
926772316 2:16389404-16389426 AAGAGGAGGAGGAAGGAAAAGGG - Intergenic
926965233 2:18402349-18402371 CAGTGGTGGAGAAAAGAGAAAGG - Intergenic
927702146 2:25275544-25275566 CTGTGGAGAGGGAAGAACAAAGG + Intronic
927826860 2:26315394-26315416 AAGAAAAGAAGGAAGGAGAAGGG + Intronic
928105805 2:28469998-28470020 AAGAGGAGGAGGAGGGAGAAGGG + Intronic
928250810 2:29677221-29677243 GAGGGGAGAAGGAAGGAAGAAGG - Intronic
928357164 2:30628578-30628600 CAGTGGAGCAGAAGAGAGAAGGG + Intronic
928411933 2:31061006-31061028 CAATGAAAAAGGAAAGAGAAGGG - Intronic
928648437 2:33379616-33379638 CAGAGGGGAAGGAAAGAGGAGGG + Intronic
928773894 2:34735649-34735671 CAAAGAAGAAGGAAGAAGAAAGG + Intergenic
928813106 2:35253641-35253663 AAGGGGAGCTGGAAGGAGAATGG - Intergenic
929052402 2:37849211-37849233 AAGTGGGGGAAGAAGGAGAAGGG - Intergenic
929561154 2:42957500-42957522 CAGGGGCCAAGGTAGGAGAAGGG - Intergenic
929607865 2:43247145-43247167 CAGTGGAGAAGCTGGGAGGAGGG + Intronic
929757929 2:44783268-44783290 CAGAGGCTAAGGCAGGAGAATGG + Intergenic
929864627 2:45707840-45707862 CAGTTGGGAACTAAGGAGAAGGG - Intronic
929918544 2:46155783-46155805 GTGGGGAGAAGGATGGAGAAAGG - Intronic
930380434 2:50621252-50621274 TTGTGGAGAAGGGGGGAGAAAGG + Intronic
930428236 2:51239057-51239079 AAGTAGAGAGGGAAGGAGGAAGG - Intergenic
930770054 2:55121696-55121718 CAGGGAAGGAGGAAGGAAAATGG + Intergenic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931044385 2:58334002-58334024 CAATGGAAAAGAAAGGAGGAGGG - Intergenic
931196198 2:60054225-60054247 CACTGCAGAGAGAAGGAGAAAGG - Intergenic
931286209 2:60834086-60834108 CAGTGGAGAGGGTATGAGAATGG + Intergenic
931495666 2:62804529-62804551 CAGTGGAGAAGAAATCACAAAGG + Intronic
931615455 2:64151931-64151953 AAGAGGTGAAGGAAAGAGAAAGG + Intergenic
931664992 2:64604041-64604063 GAGAGGAGAGGGAGGGAGAAGGG - Intergenic
931707572 2:64960035-64960057 CAGTGGGGAAGCAGGGGGAAAGG - Intergenic
931732332 2:65164359-65164381 AAGTGGAGAAGAAAAGAGGAGGG + Intergenic
931992796 2:67807891-67807913 AAGTGGAGGAGGAGGAAGAAGGG - Intergenic
932084551 2:68746651-68746673 AAATGGAGATGGAGGGAGAAGGG + Intronic
932087256 2:68773500-68773522 AAGTGGGGAAGGCAGGAGGAAGG + Intronic
932136173 2:69230948-69230970 GAGTGGGGAAGGTAGGAGGAGGG - Intronic
932206825 2:69890588-69890610 CAGTGGAGAAGGCAGTAAAAGGG - Intergenic
932325779 2:70860637-70860659 CAGTGGAGCAGCATGGAGCAGGG + Intergenic
932449480 2:71800407-71800429 CAGTGGAAAAGGAAGAGAAAAGG - Intergenic
933121407 2:78542285-78542307 CAGTGGAGGTGGCAGGGGAATGG - Intergenic
933166891 2:79086530-79086552 CAGTGGAGAAGGAAGGTGTGAGG + Intronic
933807906 2:86013308-86013330 CACAGGAGGAGGAAAGAGAAGGG + Intergenic
933842514 2:86298782-86298804 AATTGCAGCAGGAAGGAGAATGG + Intronic
934041268 2:88129421-88129443 TTGAGGAGAAGGAAGGAAAAAGG - Intergenic
934298628 2:91763157-91763179 AAGTGGAGAAGGAGAGTGAAAGG - Intergenic
934704659 2:96468531-96468553 GTGGGGAGAAGGAAGGGGAATGG - Intergenic
935248157 2:101237264-101237286 GAAGGAAGAAGGAAGGAGAAAGG + Intronic
935274527 2:101464552-101464574 AAATGGAGAAGGGAGGGGAAGGG - Intronic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
935558646 2:104538198-104538220 AAGTGGGGAGGGAAGAAGAAGGG + Intergenic
935879269 2:107544762-107544784 GAGGGGAGATGGAAGGAGACTGG + Intergenic
935879297 2:107544958-107544980 GAGTGGAGATGGAAGGAGACTGG + Intergenic
936472781 2:112813659-112813681 GAGTGGAGAAGTGAAGAGAATGG + Intergenic
936516740 2:113185825-113185847 CAGGGCAGGAGGCAGGAGAACGG - Intronic
936877932 2:117214754-117214776 CAGTGGCCTAGGCAGGAGAATGG - Intergenic
937139668 2:119588998-119589020 AAGAGGAGAATGAAGGAGAGAGG + Intronic
937671512 2:124542440-124542462 CAGGAGAGAAGTAAGGAAAATGG + Intronic
937783040 2:125861192-125861214 CAGTGGAGAAGGAAAAAAACTGG - Intergenic
938516114 2:132009431-132009453 AAGTGAGGAAGGAAGGAGGAAGG - Intergenic
938526555 2:132139556-132139578 CACTGGATAAGGGAGGGGAAAGG + Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938577873 2:132620689-132620711 CACTGGTGAAGGAGAGAGAAGGG - Intronic
938751517 2:134335515-134335537 GAGGGGAGGAGGAAAGAGAAAGG - Intronic
938945325 2:136207179-136207201 CATTGCAGGAGGAAGGAGCAAGG + Intergenic
939401023 2:141694115-141694137 GAGAGGAGGAGGGAGGAGAAAGG - Intronic
939517074 2:143182343-143182365 CAGAGGAGAGGGAAAGAGACAGG + Intronic
939525689 2:143290960-143290982 CAGAAGAGAAGGAAGAAGACAGG + Intronic
939995362 2:148914841-148914863 CAGTGGAGTGGAGAGGAGAATGG + Intronic
940125203 2:150315068-150315090 CAGAGGATGAGGCAGGAGAATGG - Intergenic
940418745 2:153454118-153454140 TAGTAGGGAAGGATGGAGAAGGG + Intergenic
940428740 2:153562012-153562034 GAGAGGAGAGGGAGGGAGAATGG - Intergenic
940504237 2:154532526-154532548 GAATGTAGAAGGAAGAAGAATGG + Intergenic
940572593 2:155458229-155458251 AAGGGAAGAAGGAAGAAGAATGG - Intergenic
940617434 2:156067123-156067145 CAGGGGAGAGGAAAGGAGCAGGG + Intergenic
940723698 2:157309965-157309987 CAGGAGGGAGGGAAGGAGAAAGG + Intronic
940848661 2:158667477-158667499 CAGGGGAGAAGGAGGGGAAATGG + Intronic
940890873 2:159034205-159034227 CAAGGGAGAAGGCAGGAGGAGGG - Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941187608 2:162336525-162336547 GAGAGGAGATGGGAGGAGAAAGG - Intronic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941338602 2:164276735-164276757 AAGAGGGGAGGGAAGGAGAAAGG + Intergenic
941505708 2:166341743-166341765 CAGTACAGAAGAAAGGAAAAAGG + Intronic
942154057 2:173108472-173108494 CAGAGGACAAGGAAGGGGACAGG - Intronic
942415384 2:175753201-175753223 AAGAGGAGAAAGAAGAAGAAGGG - Intergenic
942438108 2:176002640-176002662 GAGTTGAGAAGGATGGAGATGGG + Intronic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
942692578 2:178601967-178601989 CAGTGGAAAAAAGAGGAGAATGG + Intronic
942989264 2:182179634-182179656 AAGGGAAGAAGGAAGGAGAGAGG - Intronic
943729094 2:191282807-191282829 AAGTAGGGAAGGAAGGAGGAGGG + Intronic
943806217 2:192130280-192130302 CAGAGGAGAAGGAGGAGGAAGGG - Intronic
944141702 2:196463952-196463974 CATAGGTGGAGGAAGGAGAATGG - Intronic
944330148 2:198456075-198456097 GAGCAGAGAAGGATGGAGAAGGG + Intronic
944560859 2:200936187-200936209 CAAGGAAGAGGGAAGGAGAACGG - Intronic
945014726 2:205503066-205503088 GAGAGGAGAAGGGAGGAAAAAGG - Intronic
945104397 2:206295821-206295843 TAGTGGAGTAGCAAGCAGAATGG - Intronic
945109895 2:206352453-206352475 GAGAGGAGGAGGAAGGGGAAGGG - Intergenic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
945256811 2:207810049-207810071 ATGTGGAGCAGGAATGAGAATGG + Intergenic
945259733 2:207832342-207832364 GGGAGGAAAAGGAAGGAGAAAGG + Intronic
945792357 2:214320630-214320652 CAGTGCAGTAGGAAGGAGAAGGG + Intronic
946010498 2:216560155-216560177 GAAGGGAGAAGGAAGGGGAAGGG - Intronic
946102693 2:217340019-217340041 CAGTAGGGAAGAAAGGACAAGGG + Intronic
946130614 2:217603828-217603850 GAGTGAAGAAGGGTGGAGAATGG + Intronic
946142871 2:217706546-217706568 GAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142879 2:217706564-217706586 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142891 2:217706594-217706616 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142899 2:217706612-217706634 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142907 2:217706630-217706652 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946142915 2:217706648-217706670 AAGGGGAGGAGGAAGGGGAAGGG + Intronic
946292758 2:218757779-218757801 CAGCTGAGAAGGAAGTAGAAAGG - Intergenic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
946843227 2:223837724-223837746 AGGAGGAGAAGGGAGGAGAAAGG - Intronic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947418275 2:229920885-229920907 CTATGGAGAAGGAAGGAGAGGGG + Intronic
947942414 2:234069743-234069765 CGGGGGAGAAGGAGAGAGAATGG + Intronic
947998723 2:234549709-234549731 AAGGAGAGAAGGAGGGAGAAAGG - Intergenic
948367946 2:237470652-237470674 GAGAGGAGAAGAGAGGAGAAAGG + Intergenic
948757068 2:240166091-240166113 CAAGGCAGCAGGAAGGAGAAGGG - Intergenic
1168849722 20:968152-968174 CAGGGCAGAAGGAGGGGGAAAGG + Intronic
1168920585 20:1532171-1532193 CCATGGAGAAACAAGGAGAATGG - Intergenic
1168956956 20:1841148-1841170 CGGGGGAGCAGGATGGAGAAGGG - Intergenic
1168973755 20:1948867-1948889 AGGAAGAGAAGGAAGGAGAATGG + Intergenic
1169721211 20:8678697-8678719 AAGTTTAGAAGGAAGGAGTAGGG - Intronic
1169873765 20:10274131-10274153 TATTTGAGAAGGAAGGAGGAAGG + Intronic
1170022324 20:11850160-11850182 AAGGAAAGAAGGAAGGAGAAAGG - Intergenic
1170182491 20:13547991-13548013 GAGAGAAGAAGGAAGGAGACAGG + Intronic
1170369438 20:15632778-15632800 GAGGAGGGAAGGAAGGAGAACGG - Intronic
1170476260 20:16717869-16717891 CAGGCAGGAAGGAAGGAGAATGG - Intergenic
1170804152 20:19615464-19615486 CAATGGTGACGGAAGGTGAAGGG + Intronic
1171118881 20:22550941-22550963 CAGTGGGGAGGGAAGGTGAAGGG - Intergenic
1171228737 20:23464884-23464906 CAGTAGAGGAGGCAGCAGAAGGG - Intergenic
1171415718 20:24979306-24979328 CAGAGAAGATGGAAGGAGCAAGG + Intronic
1171907198 20:30908814-30908836 TAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1172038690 20:32028773-32028795 TAGTAGAGGAAGAAGGAGAAGGG + Intronic
1172074292 20:32282210-32282232 CAGTGGAGATGGTAAGAGGACGG + Intronic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172183534 20:33017957-33017979 CAAGTTAGAAGGAAGGAGAAGGG - Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1173001995 20:39111497-39111519 CAGTGGAGCAGGAGGAAGAAGGG + Intergenic
1173150812 20:40565313-40565335 TAGGGGAGAGGGAGGGAGAATGG + Intergenic
1173186309 20:40843215-40843237 AAGGTGAGAAGGAAGGAGGAAGG - Intergenic
1173454721 20:43192666-43192688 CAGTGCTGAAGGAAGGAGGCAGG + Intergenic
1173571415 20:44079166-44079188 CAGGGGAGGAGGAAGGAGCTTGG - Intergenic
1173847381 20:46196719-46196741 CAGTGAAGATGGCAGTAGAATGG + Intronic
1173940622 20:46908035-46908057 CAGTGGAGGAGAATGGTGAATGG - Intronic
1174022421 20:47541442-47541464 GAGAGGGGAAGGGAGGAGAAAGG - Intronic
1174161746 20:48555959-48555981 CAGAGGAGAAGGAACCAAAATGG - Intergenic
1174634368 20:51986337-51986359 CAGAGGCTAAGGCAGGAGAATGG + Intergenic
1174687029 20:52465809-52465831 CAGTGAAGAAGGGTGGAGAGAGG + Intergenic
1174763575 20:53230362-53230384 GAAAGGAGAAGGAAGGAGAGAGG - Intronic
1175050155 20:56147912-56147934 CAGTGGGGACGGAAGGGGGACGG - Intergenic
1175127542 20:56763672-56763694 TAGGGAAGAAGGAAGGAAAAGGG + Intergenic
1175287215 20:57844934-57844956 CAGCCCAGAAGGAAGGAGAGAGG - Intergenic
1175452060 20:59077759-59077781 GAGAGGAGGAGGAAGGAGAAAGG + Intergenic
1175538366 20:59731450-59731472 AAGAGGATGAGGAAGGAGAAAGG - Intronic
1175604993 20:60305350-60305372 CAGAGGCCAAGGCAGGAGAATGG + Intergenic
1175645548 20:60667559-60667581 CAGTGGAGTAGGGAGGGGAGAGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175658426 20:60792089-60792111 GAGAGGAGAAGGAAGGGGAGGGG - Intergenic
1175784404 20:61703517-61703539 TAGTGGGGAAGGAAGGAGTGAGG + Intronic
1176195863 20:63836122-63836144 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176195932 20:63836312-63836334 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176282742 20:64323896-64323918 GAGAAGAGAAGGAAGGAAAAAGG + Intergenic
1176693774 21:9949312-9949334 CAGAGGAGGAAAAAGGAGAAAGG + Intergenic
1176742565 21:10617396-10617418 AAGAGGAGAAGGAAGGAAAAAGG + Intergenic
1176936814 21:14876864-14876886 CAAAGAAGAAGGAAGAAGAAGGG - Intergenic
1176957627 21:15124331-15124353 CAGGGAAGAAGGAGGGGGAAGGG + Intergenic
1176970853 21:15263874-15263896 CAGGAGAGAAGCAATGAGAAGGG - Intergenic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1178438257 21:32578312-32578334 CAGTGCAGAAGCAGGGAGCACGG + Intronic
1178568909 21:33716399-33716421 GAGTGAAGAAGGAAGGAGGTAGG - Intronic
1179084811 21:38207411-38207433 GAAGGGAGAAGGGAGGAGAAGGG - Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179116705 21:38499843-38499865 GAGGGAGGAAGGAAGGAGAAAGG + Intronic
1179142676 21:38740831-38740853 AAGGAGAGAAGGAAGGAAAATGG - Intergenic
1179198978 21:39196685-39196707 CAGCAGAGAAGGAAGTAAAAAGG - Exonic
1179583990 21:42363476-42363498 CATTGGAGAAGGAAGCTGGATGG - Intronic
1179708259 21:43194821-43194843 CAGAGAGGAAGAAAGGAGAACGG + Intergenic
1180104258 21:45607589-45607611 GAGGGGAGAAGGGAGGTGAAAGG + Intergenic
1180517065 22:16154382-16154404 CACTGGATAAGGGAGGGGAAAGG - Intergenic
1180594056 22:16962261-16962283 TAGTTGAGAAGGAAGGTTAAAGG - Exonic
1180627963 22:17207289-17207311 CCCTGGAGAGGGAAGAAGAATGG + Exonic
1180729280 22:17969535-17969557 CAGGGAAGAAGGAAGAAGGAAGG - Intronic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181521109 22:23449281-23449303 GGATGGAGAAGGAGGGAGAAGGG - Intergenic
1181853982 22:25769325-25769347 CTCTGGAGAAGGATGCAGAAAGG + Exonic
1181856952 22:25788712-25788734 AGGAGGAGAAGGAAGGAGGAGGG - Intronic
1181918187 22:26297728-26297750 GAGAAGAGAAGGAAGGAGAAAGG - Intronic
1182059689 22:27388136-27388158 CATAAGAGAAAGAAGGAGAAAGG + Intergenic
1182404665 22:30115788-30115810 AAGTGGAGAATGAAGAAGGAGGG + Intronic
1182482993 22:30621868-30621890 CAGAGGAGAAGGGAGGAGAGCGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183114067 22:35676047-35676069 CACTGGACAAGGGAGGGGAAGGG + Intergenic
1183312650 22:37119209-37119231 CGGTAGAGAGGGAGGGAGAAAGG - Intergenic
1183371574 22:37435532-37435554 CAGAGGAGAAGGCTGGAGCAGGG + Intergenic
1183403968 22:37620852-37620874 CCGTGGAGGAGGAAGGGGAAAGG - Exonic
1183469321 22:37997228-37997250 AAGTGGAAAAGAAGGGAGAAAGG - Intronic
1183693712 22:39406735-39406757 CAGAGGCGGAGGCAGGAGAATGG - Intronic
1183762150 22:39831386-39831408 CTGTTAAGCAGGAAGGAGAAAGG + Intronic
1184460391 22:44634511-44634533 CCATGGAGAGGGAAGGAGAGAGG + Intergenic
1184730096 22:46367093-46367115 CAGTGGAAAAGGAGGACGAAGGG + Exonic
1185089426 22:48757401-48757423 AGGAGGAGGAGGAAGGAGAAGGG + Intronic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
949723008 3:7012544-7012566 CAGGGGAGAAGGATGGGGGAAGG - Intronic
949797160 3:7863837-7863859 CATTGGAGAAGGAAGATGGAGGG + Intergenic
949807671 3:7973659-7973681 CAGGGGAGAGGGGAGGAGAGAGG + Intergenic
949847659 3:8388460-8388482 AAATGGTGAAGAAAGGAGAAAGG - Intergenic
949855523 3:8457720-8457742 CAGAGGCTGAGGAAGGAGAATGG + Intergenic
950283890 3:11729822-11729844 AAGGAGGGAAGGAAGGAGAAAGG + Intergenic
950335216 3:12187816-12187838 CACTGGAGAAGGGAGGAAAGAGG + Intronic
950342861 3:12263016-12263038 CAGAGGAGAGAGAAGGACAAAGG + Intergenic
950448317 3:13051187-13051209 CAGAGGTGAAGGATGGAGGAGGG - Intronic
950575502 3:13829898-13829920 TGTTGGAGAAGGCAGGAGAAAGG - Intronic
950692790 3:14673583-14673605 CTGTGGAGTAGAAAGGAGAAGGG + Intergenic
950836858 3:15928603-15928625 GAGAAGAGAAGGCAGGAGAATGG + Intergenic
951033993 3:17913069-17913091 CAGTGAAGAAGGGAGTAGTATGG + Intronic
951502146 3:23400801-23400823 AAGGAGGGAAGGAAGGAGAAAGG - Intronic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
951677306 3:25256706-25256728 CAGTGGAGCAGAAAAGATAAAGG + Intronic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
951995045 3:28718168-28718190 AAAGGAAGAAGGAAGGAGAAAGG - Intergenic
952736335 3:36695142-36695164 GAGTGAAAAAGGAAGGAGAAAGG - Intergenic
952785781 3:37153571-37153593 TAGTTGAGAAGGAAAGAAAATGG - Intronic
953139353 3:40213099-40213121 GAGTGGAGAAAGAATTAGAAGGG - Intronic
953273899 3:41475990-41476012 CAGGAGAGAAGGAGGGAAAAAGG + Intronic
953274233 3:41479204-41479226 CAGGGGAGGAAAAAGGAGAAGGG - Intronic
953295349 3:41710339-41710361 CATTGGAGATTCAAGGAGAAAGG + Intronic
953335551 3:42091174-42091196 AAGGGGAGTAGCAAGGAGAACGG - Exonic
953396144 3:42572057-42572079 AGGTGGAGAAGGAAGAAGACTGG + Intronic
953439265 3:42904156-42904178 GAGAGAGGAAGGAAGGAGAAGGG - Intronic
953557338 3:43956913-43956935 CAGAGAAGAATGAAGGAGCAGGG + Intergenic
953869656 3:46615391-46615413 GTGTGGAAAATGAAGGAGAAGGG - Intronic
954082861 3:48222624-48222646 CAGTGAAGAAGGATGCAGAAGGG + Intergenic
954139404 3:48597088-48597110 CTGTTGAGAAGGTAGGAGTAAGG + Intergenic
954366787 3:50150696-50150718 CAGTGCAGAAGGATGAAGAAGGG + Intergenic
954588139 3:51754623-51754645 CAGAGGAGAAGAAAGGAAAGAGG + Intergenic
954685573 3:52368423-52368445 CAATGGACAAGGATGGAGGAGGG - Intronic
954995035 3:54873353-54873375 AAGTGAAGAAGGAAGAGGAAGGG - Intronic
955071806 3:55577952-55577974 CACTGGAGAGGGAGAGAGAAAGG + Intronic
955112359 3:55961315-55961337 CAGTGATGAAGGAAGGGGCAGGG - Intronic
955398614 3:58575076-58575098 CAGTGGAGAGGCAAGTGGAAGGG - Intronic
955789537 3:62574078-62574100 CAGTGGGGATGGAATGAGATGGG - Intronic
955931990 3:64066603-64066625 GAATGGAGAAGGAAGGACAAAGG + Intergenic
955972120 3:64445806-64445828 GAGTGGAGATGGAAGGATGAGGG + Intergenic
956014499 3:64867385-64867407 TAGTGGAGAAGGAAAGAAGAGGG + Intergenic
956181951 3:66525351-66525373 GGGAGGAGGAGGAAGGAGAAAGG - Intergenic
956251493 3:67239003-67239025 CAGTACAGAAGGATGGAGAATGG - Intergenic
956551030 3:70460317-70460339 AAGTGGGGAAGGAAGGGTAAGGG - Intergenic
956863698 3:73349132-73349154 CAGTGAAGAAAGAAGTAGGATGG + Intergenic
956882862 3:73528818-73528840 GAGTGGAGGAAGAAGGGGAATGG + Intronic
957397210 3:79657468-79657490 AATTGGAGAAAAAAGGAGAAAGG + Intronic
957587027 3:82146001-82146023 CAGAAGAGAAGGATAGAGAAAGG + Intergenic
957760209 3:84546523-84546545 CAATTAAGAAGGAAGAAGAAGGG - Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957931617 3:86885716-86885738 CCGATGAGAAGAAAGGAGAATGG + Intergenic
958491151 3:94775557-94775579 CACTGGAGGATGAAAGAGAAGGG - Intergenic
958675293 3:97262037-97262059 AAGTAGAGAAGCAAGAAGAATGG - Intronic
958764072 3:98343662-98343684 CAGAGGAGAAGTTAGGAGATAGG + Intergenic
959210622 3:103375168-103375190 CACTGGAGTAGGAAGAAAAACGG - Intergenic
959215467 3:103445857-103445879 CAGAGGCTGAGGAAGGAGAACGG + Intergenic
959344952 3:105182298-105182320 CAGAGGATGAGGCAGGAGAATGG - Intergenic
959395715 3:105835406-105835428 CAGTTTAGTAGGAAGGAGAAGGG + Intronic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
959860731 3:111212072-111212094 GAATGGGGAAGGAATGAGAAAGG - Intronic
959993661 3:112656841-112656863 GAGTGGAGAGGGAGGGAGAAAGG - Intergenic
960270932 3:115673782-115673804 CAGTGGAGGAGGGAGAAGGATGG + Intronic
960597245 3:119417424-119417446 CAGTAGAGAGGAAAGGAGAAAGG - Exonic
960708453 3:120504353-120504375 GAGTGGAGAAGGGTGGAGCAAGG - Intergenic
960810666 3:121624474-121624496 GGGTGGAGAAGGATGGAGAATGG - Intronic
960856064 3:122103321-122103343 CAGCGGTGAAGCAAGGACAAAGG + Intronic
961052228 3:123756610-123756632 CAGAGGAGAATGCAGGGGAAAGG - Intronic
961221689 3:125206025-125206047 CAGCTGAGGAGGAAGGAAAAGGG - Intronic
961231717 3:125318783-125318805 CAACGGAGCAGGAAAGAGAAAGG + Intronic
961340155 3:126212398-126212420 AAGTAAAGAAGGAAGGAGGAAGG + Intergenic
961554287 3:127687563-127687585 AAGTGGTGAGGGAATGAGAATGG - Intergenic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
962023427 3:131524267-131524289 CACTGAAGAAGAAAGGATAATGG + Intergenic
962028359 3:131572593-131572615 GAGTGGAGAAGGATGGAAAGTGG + Intronic
962745698 3:138396088-138396110 CAGTGGAGAAGGGGAGGGAAGGG + Intronic
962953907 3:140246853-140246875 CAGTGCAGTAGGAAGGATATGGG + Intronic
963245865 3:143061822-143061844 CAATGGTGAAGGAAGAGGAAAGG + Intergenic
963646734 3:147924048-147924070 CAGAGGAAAAGTAAGGAGTATGG - Intergenic
963716971 3:148813843-148813865 AAGTGGAGAAGGAAGAAGACTGG + Intronic
963796477 3:149635610-149635632 GGGAGGAGGAGGAAGGAGAAAGG + Intronic
963819114 3:149868597-149868619 GAAAGGAGAGGGAAGGAGAAGGG - Intronic
963931797 3:151011127-151011149 AAGTGGAGAAGGTGGGAGGAGGG + Intergenic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
964113744 3:153113743-153113765 AAGAGGAGATGGAAAGAGAAAGG - Intergenic
964306784 3:155349813-155349835 GAATGGAGAGGGATGGAGAAAGG + Intergenic
964553013 3:157905831-157905853 AAGGGGAGCAGGAAGAAGAAAGG + Intergenic
964626922 3:158768521-158768543 CGGCAGAGAAGGAAAGAGAATGG + Intronic
964760133 3:160127609-160127631 TAGTGGGGAAGACAGGAGAATGG + Intergenic
965165652 3:165192787-165192809 CAGTAGAGGAGGGAGGAGAAGGG + Intronic
965341931 3:167502187-167502209 CAGTGGTGGTGGAAGGTGAAGGG - Intronic
965545007 3:169906544-169906566 TAGTGAAGAAGGAAGAACAAGGG + Intergenic
965920386 3:173906278-173906300 CAGTGGGACAGGGAGGAGAAAGG - Intronic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966437829 3:179908336-179908358 CAGTGGAGGAGAAAGTAGGAAGG + Intronic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966621348 3:181967662-181967684 CAGTGCTATAGGAAGGAGAAAGG + Intergenic
966624861 3:182004979-182005001 GAGTGGAGAAGAAAAGGGAAGGG + Intergenic
966850945 3:184164731-184164753 CAGGGGTGAAGGAGGGAGAGAGG - Intronic
966873269 3:184306237-184306259 CAGATCAGAATGAAGGAGAAAGG - Intronic
966888263 3:184388564-184388586 CTGTTGAGAGGGAAAGAGAAAGG - Intronic
966895915 3:184444948-184444970 GTCTGGAGAAGGAAAGAGAAGGG - Intronic
967228686 3:187317622-187317644 CCGGGGTGTAGGAAGGAGAAAGG - Intergenic
967277141 3:187787222-187787244 AAGTGGAGACTGAAGGAAAATGG - Intergenic
967300680 3:188009187-188009209 CCCAGGAGAAGGAGGGAGAAGGG + Intergenic
967378091 3:188827908-188827930 CAGAGAGGAAGGTAGGAGAATGG - Intronic
967432157 3:189398463-189398485 GGGTGGAGAATGACGGAGAATGG - Intergenic
967458249 3:189715115-189715137 GAGAGGAGAAGGGAGGAGAAAGG - Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967703728 3:192624458-192624480 GAGAAGAGGAGGAAGGAGAAGGG + Intronic
967878076 3:194280228-194280250 AAATGGAGTTGGAAGGAGAAAGG + Intergenic
967892855 3:194375434-194375456 AAGAGGAGAAGAAAGGAGAGAGG + Intergenic
967980743 3:195063642-195063664 CTGTGGAGAATGCGGGAGAAGGG + Intergenic
968005197 3:195237962-195237984 CAGTGGGGAAGGTAGGAGGTAGG - Intronic
968298145 3:197593055-197593077 CAGAGGGCAGGGAAGGAGAAGGG + Intergenic
968448048 4:662335-662357 CAGGGCAGAAGGATGGAGGAGGG + Intronic
968914449 4:3491187-3491209 CAGGGGGGAAGGAATGAGCAGGG - Intronic
969212248 4:5696656-5696678 CGGCTGAGAGGGAAGGAGAAAGG + Intronic
969233914 4:5851818-5851840 AGGAGGAGAAAGAAGGAGAAGGG + Intronic
969292339 4:6248044-6248066 CAGTGGGGAAAAAAGGCGAAGGG - Intergenic
969693163 4:8718396-8718418 CAGAGGAGAGGGAAGCTGAATGG + Intergenic
969748916 4:9095521-9095543 TAAGGGAGAAGAAAGGAGAATGG - Intergenic
969947714 4:10801504-10801526 CAGTCTAGAAGGATGGGGAAAGG - Intergenic
969965631 4:10992403-10992425 CAGTGGGGAATGAAGGAGGAAGG + Intergenic
970513231 4:16801455-16801477 CAGAGGAGAAGGAAATTGAAGGG + Intronic
970658722 4:18260709-18260731 CAGTAGAGAAAGCAGCAGAAAGG - Intergenic
970689966 4:18611588-18611610 GAGGGAGGAAGGAAGGAGAAAGG + Intergenic
970690130 4:18612048-18612070 GAGGGAGGAAGGAAGGAGAAAGG + Intergenic
970690216 4:18612286-18612308 GAGGGAGGAAGGAAGGAGAAAGG + Intergenic
971144238 4:23959682-23959704 CTATGAAGATGGAAGGAGAAAGG + Intergenic
971150314 4:24024438-24024460 CAGTGAAGGTGGAAGGAGATGGG - Intergenic
971266329 4:25099153-25099175 AAGAGGAGAAAGAAGGAAAAGGG + Intergenic
971381906 4:26106880-26106902 GGGTGGAGAAGGAAACAGAAGGG + Intergenic
972044201 4:34642739-34642761 GAGTGGAGAAGTATGGAGAGAGG + Intergenic
972299332 4:37770439-37770461 CAGGGGAGAAGGGAGGAGAGAGG - Intergenic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972444989 4:39135465-39135487 CATTGCAGAAGGAAGGGGAGAGG - Intergenic
972574930 4:40342987-40343009 CATTGGAGATGGAACGAGGAAGG + Intronic
972664324 4:41149477-41149499 GGGGGGAGAAAGAAGGAGAAGGG + Intronic
972664872 4:41155547-41155569 AAATAAAGAAGGAAGGAGAAAGG + Intronic
972765667 4:42151225-42151247 AAATGGAGGAAGAAGGAGAAAGG + Intronic
973128169 4:46614902-46614924 CAGAGAAGAAGGAAAGAGACAGG - Intergenic
973277113 4:48321743-48321765 TAATGTACAAGGAAGGAGAAAGG - Intergenic
973739090 4:53901911-53901933 GAGGAAAGAAGGAAGGAGAAGGG + Intronic
973745798 4:53962356-53962378 AAGGGGAGAAGGATGGAGAAAGG + Intronic
974339372 4:60594510-60594532 CAGGAAACAAGGAAGGAGAAGGG - Intergenic
974351697 4:60755843-60755865 CAGTGGGGGAGGAAGGAGGTGGG + Intergenic
974454863 4:62115926-62115948 CAGTGTTGATGAAAGGAGAAAGG + Intergenic
974508779 4:62809743-62809765 CAGAGGCTAAGGCAGGAGAATGG - Intergenic
974557886 4:63475440-63475462 CAGTGATGCAGGAGGGAGAAAGG - Intergenic
974642804 4:64653685-64653707 CAGAGGCCAAGGCAGGAGAATGG + Intergenic
974675223 4:65079791-65079813 CGGTGGCTAAGGCAGGAGAATGG - Intergenic
974699284 4:65418720-65418742 CAATGGGGAGGGATGGAGAAAGG - Intronic
974858897 4:67495939-67495961 CAGCAGAGATTGAAGGAGAAGGG - Intronic
975283680 4:72592734-72592756 AAGTAGAGAAATAAGGAGAAGGG - Intergenic
975344028 4:73273707-73273729 CAGAGGCTAAGGCAGGAGAATGG - Intergenic
975359210 4:73447311-73447333 CAGGAAAGAAGGAAGGGGAAAGG - Intronic
975504451 4:75122856-75122878 AAGAGGAGGAGGAAGGAGGAAGG + Intergenic
975510639 4:75190944-75190966 CTGTGGTGAAGGAAGAAGAGAGG - Intergenic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
975756994 4:77580793-77580815 GAGAGGGGAGGGAAGGAGAAGGG - Intronic
975859749 4:78664041-78664063 CAGAGCAGAAGCAAGGAGAGGGG - Intergenic
976018965 4:80596082-80596104 GATTGGAGAAGGAGGGAGAGAGG + Intronic
976319405 4:83695922-83695944 GAGAGAAGAGGGAAGGAGAAAGG - Intergenic
976350720 4:84056896-84056918 GAGTAGAGAAGGGAGGAGAGGGG - Intergenic
976563624 4:86529432-86529454 CAGTGGAGAAGGCATGAGTGGGG - Intronic
976759601 4:88533982-88534004 CAGTGGAGAAGAAGGAGGAATGG - Intronic
976767984 4:88618444-88618466 GGGTAGAGAAGAAAGGAGAAAGG - Intronic
976826976 4:89271756-89271778 CAGTAGAGAAAGAAAGACAAGGG + Intronic
977066551 4:92323700-92323722 CAGAGAAGAAGAAAGGAGGAAGG - Intronic
977083202 4:92560157-92560179 ATGTGGAGAAGAAAGGAGAGGGG + Intronic
977086847 4:92610545-92610567 AAGTGGAAAAGGAGGGGGAAGGG - Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977545352 4:98370476-98370498 GACTGGAGAAAAAAGGAGAAAGG - Intronic
977577000 4:98685376-98685398 CAGTAGAGTAGGAAGGAGCCGGG - Intergenic
977872753 4:102112650-102112672 CAGGGGAGAAGGAAGGATAAAGG + Intergenic
978033291 4:103963050-103963072 TACTGGAGAAGGAAAGACAAAGG - Intergenic
978190293 4:105903394-105903416 CAGGGGAGATGGAAGGGCAAGGG + Intronic
978268546 4:106859013-106859035 AAGAGGAGGAGGAAGGGGAAAGG + Intergenic
978462314 4:108969738-108969760 CAGTGGAGAGGTAAGCAGAACGG - Intronic
978555727 4:109978543-109978565 CATAGGAAAAGAAAGGAGAATGG + Intronic
978738594 4:112112495-112112517 AAATGGAGAAAAAAGGAGAAGGG + Intergenic
978863183 4:113475904-113475926 CAGTGAAGTGGGAAGAAGAAAGG + Intronic
979046042 4:115866484-115866506 GAGTGAGGAAGGAAGGAGGAAGG + Intergenic
979198555 4:117949427-117949449 CAGTGGAGTAGGTGGGTGAAGGG + Intergenic
979207328 4:118054639-118054661 CTTTAGAGATGGAAGGAGAAAGG - Exonic
979305527 4:119138682-119138704 AAGGAGAGAAGGCAGGAGAAGGG - Intronic
979346321 4:119591811-119591833 AAGATGAGAAGGAAGGAGAATGG + Intronic
979480758 4:121214228-121214250 AAGTGCAGAAGGAAGGATGAGGG - Intronic
981086436 4:140689381-140689403 AAGCGGGGAAGGAAGGAGGAAGG - Intronic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981166165 4:141560250-141560272 CAGTGGAAAAGGCAGAAGAGGGG + Intergenic
981288974 4:143051947-143051969 AAGCGGGGAAGGAGGGAGAAAGG + Intergenic
981290057 4:143064368-143064390 TTGTGGAGAAGGAAGCAGACGGG - Intergenic
981499536 4:145435286-145435308 AGCTGGAGAAGGGAGGAGAAGGG - Intergenic
981637311 4:146895445-146895467 AAGTGAAGAATGAAGGAGAGAGG - Intronic
981694454 4:147546156-147546178 GTGTGGAGAAGGGGGGAGAAAGG - Intergenic
981866677 4:149429242-149429264 CAGTGCATAAGGAAAGACAACGG + Intergenic
982149367 4:152435493-152435515 CAGTGTAGAAAGATTGAGAAAGG - Intronic
982229341 4:153194165-153194187 GAGTGAAGAAGGAAAGAGAGAGG + Intronic
982346622 4:154367294-154367316 CAGGGTGGAAGGAGGGAGAACGG + Intronic
982376523 4:154696874-154696896 CAATGGAGAAGCAATGAAAAGGG + Intronic
982521223 4:156418589-156418611 CAGAGGAGAAGGAGGAAGACAGG - Intergenic
982591204 4:157314040-157314062 TAAAGGAGAAGGAAGAAGAAGGG + Intronic
983111418 4:163754895-163754917 GAGGGGAGAAGGAAGCAGAAAGG + Intronic
983640303 4:169938980-169939002 CAGTGGCTGAGGCAGGAGAATGG + Intergenic
983934003 4:173486360-173486382 CAGTGGTGAAGGATGCAAAATGG - Intergenic
984070324 4:175103359-175103381 AAGAGGAGGAGGAGGGAGAAGGG + Intergenic
984531727 4:180924243-180924265 CACTGGGAAAGGAAGGAGAGAGG - Intergenic
984559954 4:181256563-181256585 GAGTGGAGAAGGGTGGGGAAAGG - Intergenic
984683473 4:182638789-182638811 CAGTGGAGGAGAAAACAGAAAGG - Intronic
984738327 4:183133085-183133107 AAGGGAAGAAGGAAGGAAAAAGG - Intronic
984782007 4:183534431-183534453 AAATGGAGAAGGAAGAACAAAGG - Intergenic
985168475 4:187123222-187123244 CTGAGGAGGAGGAAGGAGAGGGG - Intergenic
985333169 4:188863389-188863411 CTGAGGAGGAGGAAGAAGAAGGG - Intergenic
985971022 5:3378548-3378570 AAGGGGAGGAGGGAGGAGAATGG - Intergenic
986253347 5:6081379-6081401 GAGAGGAGAAGGAAAGAGACAGG - Intergenic
986262382 5:6159787-6159809 AAGTGGAGAAGGCAGGAGATAGG + Intergenic
986265157 5:6184517-6184539 GATTGGAGAAGGAAGAAGAAGGG - Intergenic
986266003 5:6190965-6190987 GAGTGGAGAAGGGTAGAGAATGG - Intergenic
986383538 5:7208970-7208992 CAGTAGACAGGAAAGGAGAATGG + Intergenic
986468439 5:8050284-8050306 AAGTAAGGAAGGAAGGAGAAGGG + Intergenic
986613877 5:9597109-9597131 CAGAGGAGGAGGAAGGGGAAGGG - Intergenic
986621384 5:9679199-9679221 CAGGGGGAAAGGAAGGATAATGG + Intronic
986636479 5:9827154-9827176 GACTGGAGGAGGAAGGAGGAAGG - Intergenic
987050333 5:14143323-14143345 CAATGGGGAAGGAAGGAGGGGGG - Intergenic
987123363 5:14788676-14788698 TGGTGGAGAAGGCAGTAGAAAGG + Intronic
987415344 5:17655917-17655939 TAGTGGAGCAGGAAGTACAATGG - Intergenic
987455562 5:18141253-18141275 CAGTGGGGTAGGGAGGAGAATGG - Intergenic
987468353 5:18299320-18299342 TAGTGGAGCAGGAGGAAGAAAGG + Intergenic
987622087 5:20347479-20347501 CAGTGGAGAAGAACAGAGAGAGG + Intronic
987726659 5:21709403-21709425 CTGAGGAGAAGGAAAGAGATGGG - Intergenic
987750419 5:22031708-22031730 CAGAGGAGAAGGAGAGAGACAGG + Intronic
987824286 5:23008387-23008409 CAGTGGTGAACAAAAGAGAAAGG + Intergenic
988127182 5:27055375-27055397 CACTCAAGAAGGAAGGTGAAGGG - Intronic
988217865 5:28300276-28300298 CAGAGGCTAAGGCAGGAGAATGG - Intergenic
988550999 5:32200657-32200679 GGGAGGAGAAGGAAGGGGAAGGG + Intergenic
989094701 5:37771196-37771218 AAGTGCAGAAGGCAGGAGAAGGG + Intergenic
989225646 5:39025130-39025152 AGGAGGAGAAGGAGGGAGAAAGG - Intronic
989410137 5:41110846-41110868 AAGAGGAGAAGGAAGAGGAAGGG - Intergenic
989455447 5:41638297-41638319 AAGGGGAGAAGGAAGAATAAAGG - Intergenic
989493965 5:42089831-42089853 CATTGAAGAAGGATGGAGATAGG - Intergenic
989503841 5:42202566-42202588 CAGTGAAGATAGAAGGTGAAAGG + Intergenic
990123419 5:52484306-52484328 GAGACCAGAAGGAAGGAGAAAGG + Intergenic
990273460 5:54170930-54170952 GAGCTGAGAAGGAAGGAGAAGGG - Intronic
990275522 5:54191957-54191979 GAGTGGGGGAGGAAGGAGGAAGG - Intronic
990528536 5:56651983-56652005 GAGTAGAGAAGGAGGGAGAAGGG + Intergenic
990531665 5:56679989-56680011 CTGTGGAGGAGGAAGAAGAGTGG - Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
991167527 5:63581714-63581736 AAGAGGAGAAGGAAGGAGCAGGG + Intergenic
991254719 5:64601446-64601468 CAGTGGAGAAGAAAGGAAGGTGG + Intronic
991468537 5:66941879-66941901 CCATGGAGAAGGAAAGAGATGGG + Intronic
991643507 5:68777516-68777538 GAGGGGAGGAGGAGGGAGAAAGG - Intergenic
991951957 5:71955012-71955034 TAGAGAAGAAGGAAGGAGAAAGG + Intergenic
992047456 5:72908529-72908551 CATAGGAGAAGGAAGCAGCATGG + Intronic
992104352 5:73437405-73437427 CAGTGGAGAAGGCTGGAGGGCGG + Intergenic
992120622 5:73588301-73588323 GATTAGAGAAGGAAGAAGAAGGG - Intergenic
992497896 5:77310902-77310924 GAAAGGAGAAGAAAGGAGAAAGG + Intronic
992535864 5:77702720-77702742 CATTGGGGAAGGAAGGATGAAGG + Intronic
992656581 5:78916328-78916350 CAGTCCAGAAGAAAGGAGACTGG + Intronic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
992986890 5:82239551-82239573 TAGTGGTGAAGGAGGGAGAGAGG + Intronic
994377395 5:99030582-99030604 AAGAGGAGAAGGAAGGGGAAGGG - Intergenic
994553891 5:101272057-101272079 CAGGTGGAAAGGAAGGAGAAAGG + Intergenic
995476507 5:112553670-112553692 CAGGAAAGAAGGAAGGAGAGGGG + Intergenic
995702008 5:114946837-114946859 CAGTAGAGGAGAAAGGAAAATGG + Intergenic
995725413 5:115177140-115177162 CACTGGGGAAGGAATGAGATTGG + Intronic
996268437 5:121572595-121572617 AACTGGAAAAGGAAGGGGAATGG - Intergenic
996286187 5:121795767-121795789 CAGTGGGGGAGGCAGTAGAAAGG + Intergenic
996339367 5:122419041-122419063 CAGGGGTCAAGGAAGGAGAAGGG + Intronic
996404335 5:123090784-123090806 CGTTGGAGAAGGAAAGAGAACGG + Intronic
996578353 5:125001170-125001192 CAGAGGAGACGGGAGGAGAGGGG - Intergenic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
997076061 5:130678964-130678986 GAGAGAGGAAGGAAGGAGAAAGG + Intergenic
997300577 5:132800896-132800918 GATTGGAGAAGGAAGAAGAGAGG + Intronic
997453126 5:133999446-133999468 CAGGGTGGAAGGGAGGAGAATGG - Intronic
997646597 5:135486260-135486282 CGGTGGAGAAGGAAATTGAAGGG + Intergenic
997804627 5:136905018-136905040 AAGAAGAGAAGGAAGGAGAAAGG - Intergenic
997839619 5:137227201-137227223 CAGTGGAGAAGGATGCTTAATGG + Intronic
997845160 5:137279279-137279301 CAGAGGAGAAGTAACAAGAAAGG + Intronic
998140531 5:139697314-139697336 AAGCGGAGAAGGAAGGAGGCCGG + Intergenic
998174123 5:139890963-139890985 CAGTTCATAAGAAAGGAGAAGGG - Intronic
998227196 5:140336156-140336178 TAGAGGAGAAGGATGGAGGATGG - Intronic
998261924 5:140638291-140638313 AAGTGGAGAGGAAAGGGGAAGGG + Intergenic
998470880 5:142382820-142382842 GAGTGGAGGAGGTAGGAAAAGGG - Intergenic
998713832 5:144857770-144857792 CAGAGAAGAAGAAAGAAGAAAGG - Intergenic
998917704 5:147033829-147033851 CAGTGGACAAGAAAGGACAGAGG - Intronic
999090472 5:148931777-148931799 CAAGGGGGAAGGAAGGAGAAAGG - Intronic
999236860 5:150103801-150103823 GAGTGGAGATGGGAGTAGAAAGG + Intronic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
1000136846 5:158361403-158361425 GAGAGGGGAAGGAAGGAGAAAGG - Intergenic
1000223033 5:159232561-159232583 CAGTGGAGTACCAAGGAGTAGGG + Intergenic
1000283048 5:159798857-159798879 CTTGGGAGAAGGAGGGAGAAGGG - Intergenic
1000391367 5:160726656-160726678 AAGGGGAGGAGGAAGGAGTAGGG + Intronic
1001164682 5:169353023-169353045 AAGAGGAGAAGGAAGGATAGAGG - Intergenic
1001254150 5:170170936-170170958 GAGAGGAGAGGGAGGGAGAATGG - Intergenic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001546139 5:172571470-172571492 AAGGGGAGAAGGAAAGAGACGGG - Intergenic
1001571691 5:172734234-172734256 CAGGAGAGAAGGAAGGAAAAAGG - Intergenic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1001992925 5:176133009-176133031 CAGGGCAGCAGGTAGGAGAAAGG + Intergenic
1002018060 5:176341576-176341598 CAGTGGAGAAGGCAGTGGATGGG + Intronic
1002322102 5:178382415-178382437 CAGAGGAGGAGGAGGGCGAAGGG - Intronic
1002637433 5:180615300-180615322 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637470 5:180615447-180615469 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637485 5:180615506-180615528 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637497 5:180615550-180615572 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637520 5:180615639-180615661 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637531 5:180615683-180615705 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637545 5:180615740-180615762 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637558 5:180615785-180615807 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637569 5:180615829-180615851 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637580 5:180615873-180615895 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637593 5:180615918-180615940 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637606 5:180615963-180615985 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637617 5:180616007-180616029 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637628 5:180616051-180616073 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637639 5:180616095-180616117 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002637650 5:180616139-180616161 AAGTGGAGAAGGGAGGTGACCGG - Intronic
1002811908 6:639261-639283 CAGTGGCAAGGGCAGGAGAAGGG - Intronic
1002896455 6:1382935-1382957 CAGGGGAGCAGGAAGGGGAGTGG + Intergenic
1003010970 6:2427300-2427322 CACTGGAGAAGGGAAGGGAAGGG + Intergenic
1003181181 6:3793207-3793229 CTGTGGAGAAGTTAGGAGATTGG - Intergenic
1003656474 6:8015405-8015427 AAGAGGAGTAGGAAGGAAAATGG - Exonic
1003674244 6:8188453-8188475 CAGAGGAGTGGGAAGGAGAATGG + Intergenic
1003774953 6:9349929-9349951 CAGGAGAGAAGGATGGAGAGTGG - Intergenic
1003921993 6:10841087-10841109 GAGTGGAGAAAGAAAGAGTAGGG + Intronic
1004104180 6:12649574-12649596 CAGAGGAGAAAGAAAGAGACAGG - Intergenic
1005060703 6:21774514-21774536 AAGTGGGGAATGAGGGAGAAAGG - Intergenic
1005527683 6:26667270-26667292 CAGTCAAGAAAGAAGGAAAATGG - Intergenic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1005543111 6:26834408-26834430 CAGTCAAGAAAGAAGGAAAATGG + Intergenic
1005688365 6:28277615-28277637 CACTGGGGAAGGAAGGGGTAAGG - Exonic
1005709871 6:28493354-28493376 CAGTGGAGACACAAGTAGAAAGG - Intergenic
1005853906 6:29845770-29845792 CCCTGGACAAGGAAGGGGAAGGG - Intergenic
1005925758 6:30444221-30444243 CAGTGGAGCAGGAGGAGGAAGGG - Intergenic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1006146732 6:31963892-31963914 TCCTGGAGAAGGAAGGGGAAGGG - Exonic
1006149548 6:31979272-31979294 AAGAGGAGGAGGAAGAAGAAGGG + Intronic
1006429486 6:33986187-33986209 CAAGGCAGAAGGAAGGTGAAAGG - Intergenic
1007035931 6:38673907-38673929 CAGGGTGGCAGGAAGGAGAAAGG + Intergenic
1007130303 6:39466233-39466255 AAGGAGAGAAGGAAGGAGGAAGG - Intronic
1007391373 6:41551403-41551425 CAGGAGAGAAGGAAGGTGCAGGG - Intronic
1007476131 6:42121354-42121376 GAGTTGAGAAGGAGGAAGAAAGG + Intronic
1007504289 6:42323031-42323053 CAATGGAGAGGGCAGGATAATGG - Intronic
1007567384 6:42862765-42862787 AAGAGGAGAAGGAAGTAGATGGG - Intronic
1007734653 6:43972987-43973009 CAGTGGAAATGGAAAGGGAAAGG + Intergenic
1007832282 6:44647649-44647671 GGGTGGAGAAGGAAGGAGTGGGG - Intergenic
1007874399 6:45079404-45079426 GGGAGGAGAAGGAAGAAGAAGGG + Intronic
1008065614 6:47044672-47044694 CAGTGCAAAAGGAAGCAGCATGG + Intergenic
1008380936 6:50839216-50839238 CAGGGGAGAAGGGAGGAAACTGG + Intronic
1008395414 6:51000884-51000906 AAGTGGAGAAGGAGGGACAAAGG - Intergenic
1008419975 6:51287132-51287154 AAGAGAGGAAGGAAGGAGAAAGG + Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008494720 6:52121497-52121519 CATGGGAGAAGGAAGCAGAACGG - Intergenic
1008624920 6:53306189-53306211 CCGTGGAAAGGGGAGGAGAAAGG + Intronic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009013929 6:57876578-57876600 CAGTCAAGAAAGAAGGAAAATGG + Intergenic
1009510246 6:64541650-64541672 CAGTGGATTAGGAAGGTGAATGG - Intronic
1009798180 6:68498835-68498857 CAATGGAGGAGGAAGGTGAAGGG - Intergenic
1010111149 6:72234721-72234743 TAGTGGGGAAGAAAGGAGAGAGG - Intronic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010282305 6:74035890-74035912 TTGTGGAGAATGAAGTAGAAGGG + Intergenic
1010561466 6:77356856-77356878 CACTGGAGAAGTATAGAGAAAGG + Intergenic
1010607865 6:77913927-77913949 CAGAGGCTAAGGCAGGAGAATGG + Intronic
1010835395 6:80581482-80581504 CAGTGGAGAACACTGGAGAAAGG - Intergenic
1010985878 6:82423513-82423535 GAGTGGAGCAGGAATGAGAGTGG - Intergenic
1011076279 6:83442761-83442783 CAGTGGAGGTGGAACGAGCAGGG - Intergenic
1011494267 6:87923185-87923207 CAGTGGGGTAGGAAGGAGAGAGG - Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011698315 6:89932896-89932918 CAGTAGAGAAAAAAAGAGAAGGG + Intronic
1012442129 6:99270541-99270563 CAGTGGAGAAGGAGGTAGCCAGG + Intergenic
1012564889 6:100636428-100636450 CTGAGGAGAAGGAAAGAGATGGG - Intronic
1012617556 6:101295291-101295313 CTGTGGTGAAGCAAGAAGAAAGG + Intergenic
1012624687 6:101392240-101392262 CAGTGAAGGAGGAAGCAAAAGGG + Intergenic
1012841670 6:104336084-104336106 CAGGAGGGAAGAAAGGAGAATGG + Intergenic
1013068701 6:106708652-106708674 CAGAGGATGAGGAATGAGAATGG - Intergenic
1013165298 6:107584684-107584706 CAGTGGAAGAGAAAGGAGAGGGG - Intronic
1013348132 6:109282071-109282093 AAGAGGAGAAGCAGGGAGAAGGG - Intergenic
1013380568 6:109565900-109565922 CAATAGAGCAGGAAGTAGAAGGG + Intronic
1013566925 6:111374502-111374524 CAGTGGGTAGGGAAGCAGAAAGG + Exonic
1013666218 6:112351587-112351609 CAGTGAAGTTGGAAAGAGAAGGG - Intergenic
1013922224 6:115419823-115419845 AAGTGGAAAGGGAAGGGGAAGGG + Intergenic
1014214388 6:118738726-118738748 GAGTGGAGGAGGAGGGGGAAAGG - Intergenic
1014677234 6:124382265-124382287 GAGAGGAGAAAAAAGGAGAAAGG + Intronic
1014947558 6:127515948-127515970 CAGAAGAGGAGGATGGAGAAGGG + Exonic
1015170388 6:130245901-130245923 CATAGGAGAAGGTAGGAGGATGG + Intronic
1015196033 6:130525567-130525589 AAGTGGAGTAGGAAGGAAAGAGG + Intergenic
1015528198 6:134193786-134193808 GAGGGGAGAAGGGAGGAGAGGGG + Intronic
1015528207 6:134193808-134193830 GAGGGGAGAAGGGAGGAGAGGGG + Intronic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1015788474 6:136942629-136942651 CAGTGTAGAGGGAAGGAAACAGG - Intergenic
1015850304 6:137565257-137565279 CAGAGGCTGAGGAAGGAGAATGG - Intergenic
1015997891 6:139013633-139013655 AAGGAAAGAAGGAAGGAGAAGGG - Intergenic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1016481341 6:144485017-144485039 CTCTGGAGGAGGCAGGAGAATGG - Intronic
1016551428 6:145284323-145284345 TAGTGCACAAGGAAGGAGAATGG - Intergenic
1016850816 6:148617101-148617123 CAGGGGAGGGGGATGGAGAAAGG - Intergenic
1017014439 6:150088827-150088849 CAGTGGTGGAGGGAGGGGAAGGG + Intergenic
1017104167 6:150872460-150872482 CAGAGGAGAGGGAGAGAGAAGGG + Intronic
1017243727 6:152198687-152198709 CAGAGGAGAAGGAGAGAGATTGG + Intronic
1017272747 6:152528113-152528135 GAGAGGAGAAAGAAAGAGAAAGG - Intronic
1017567364 6:155701722-155701744 GGGTGGAGAAAGGAGGAGAATGG + Intergenic
1017755518 6:157525983-157526005 CAGTGGAGTAGGAAGAAGTTTGG - Intronic
1017787895 6:157771802-157771824 CAGTGGGTGAGGCAGGAGAATGG - Intronic
1018064577 6:160116347-160116369 CAGTGGAAAAGGAAGGATGCAGG + Intergenic
1018087471 6:160316394-160316416 GAAAGGAAAAGGAAGGAGAATGG - Intergenic
1018419564 6:163630353-163630375 CAGTGGGCACTGAAGGAGAAAGG + Intergenic
1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG + Intronic
1018943599 6:168329045-168329067 CAGTGGAGCAGGCAGAACAAGGG - Intergenic
1018966474 6:168494399-168494421 AAGAGGAGAAGGAAGAAGAGAGG - Intronic
1019279360 7:192426-192448 GAGGGGAGGAGGAAGGAGAGCGG + Intergenic
1019428307 7:987547-987569 CAGAGGAGATGGAAGGGGCAAGG - Intronic
1019484890 7:1284916-1284938 CAGGGGACAAGCAGGGAGAAGGG + Intergenic
1019819801 7:3234123-3234145 AAGAGGAGAAGGCAGGAGCAAGG + Intergenic
1019920723 7:4161664-4161686 CCCTGGAGAAGGAAGGAGGCAGG + Intronic
1019969141 7:4526131-4526153 CAGGGGAAGAGGAAGAAGAAAGG + Intergenic
1020129043 7:5549150-5549172 AAGGGAAGAAGGAAGGAGGAAGG + Intronic
1020159181 7:5755142-5755164 AAGGAAAGAAGGAAGGAGAAAGG + Intronic
1020318353 7:6923074-6923096 CAGAGGCTGAGGAAGGAGAATGG + Intergenic
1020459442 7:8412451-8412473 CAATGGAGAAGGATGAAGCAAGG + Intergenic
1021345242 7:19519452-19519474 CAGTAGCAAAGGAAGGTGAAGGG - Intergenic
1021420488 7:20440730-20440752 AAGTGCATAAGGAAGGAGACCGG - Intergenic
1021470774 7:21000240-21000262 CAATGGCGAAGGGAGGAGACCGG - Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1021804089 7:24338016-24338038 CAGTGGGGAAGGATGAAGAGAGG + Intergenic
1021914566 7:25418691-25418713 GCATGAAGAAGGAAGGAGAAGGG + Intergenic
1022967028 7:35483399-35483421 CAGGAAAGAAGGGAGGAGAAAGG - Intergenic
1023062634 7:36343350-36343372 CAGAGGGGAAGGGAGGAGAGAGG + Intronic
1023136518 7:37058452-37058474 CAGTGCAGCAGGAAAGTGAAGGG - Intronic
1023191214 7:37585056-37585078 TAGTGGAGAAGGAAGTTGCAAGG + Intergenic
1023278579 7:38546875-38546897 GTGTGGAGAAGGGTGGAGAATGG - Intronic
1023483761 7:40662493-40662515 CAGTGAACAAGGAGGGAGAGAGG - Intronic
1023775433 7:43601627-43601649 AAGAGGAGAAGGAAAGAAAAGGG - Intronic
1024171384 7:46791232-46791254 AAGAGGAGAGGGAAGGGGAAGGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024597631 7:50953517-50953539 CAGTGGAGAAGAATGGTGCAGGG + Intergenic
1024656834 7:51458181-51458203 CAGGGGAGAAGGGTGGGGAAAGG - Intergenic
1025605771 7:63038942-63038964 CAGTGGAGTAGGAGGAGGAAAGG + Intergenic
1025879347 7:65520008-65520030 AAGAGGAGAAGGAAGGAAAAAGG - Intergenic
1025885146 7:65582909-65582931 AAGAGGAGAAGGAAGGAAAAAGG - Intergenic
1026040642 7:66865603-66865625 AAGGGGAAAAGGAAGGGGAAGGG - Intergenic
1026273652 7:68858106-68858128 AAATGGAGAAGTAAGGAAAAGGG + Intergenic
1026284173 7:68948563-68948585 AAGAAGAGAAGGAAGGAAAAAGG - Intergenic
1026307567 7:69154966-69154988 CAGAGGAGAGGGAAGGGGAGAGG - Intergenic
1026664325 7:72329505-72329527 TAGAGGAGAAGGAAGGAGACTGG - Intronic
1026889786 7:73975080-73975102 CAGTGGCCAAGGAAGGAGACAGG + Intergenic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1027294163 7:76749906-76749928 CAGAGGAGAGGGAGGGAGATGGG - Intergenic
1027555246 7:79656083-79656105 AAGAGGAGAAGTAAGGAAAATGG + Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027645319 7:80790331-80790353 AGGAGGAGGAGGAAGGAGAAGGG + Intronic
1027941781 7:84691479-84691501 GAGTGGAGAAGGAGGGAGAATGG - Intergenic
1028143971 7:87301129-87301151 GAGTGTAGAGGGAAGGAGGAAGG + Intergenic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1028429051 7:90725849-90725871 GGGTGAAGAAGGAAGAAGAAGGG + Intronic
1028441091 7:90861640-90861662 AAGTAAAGAAGGAAGGAAAAGGG + Intronic
1028562560 7:92191836-92191858 CAGTGAAAAAGGACGAAGAAGGG - Intergenic
1028619672 7:92811348-92811370 CAGTGTACAAGGATGGTGAAGGG - Intronic
1028914539 7:96243816-96243838 GAGTAGAGAAGGCAGGGGAAGGG + Intronic
1028975143 7:96904429-96904451 AAAGGGAGAAGGGAGGAGAAGGG + Intergenic
1029013269 7:97285526-97285548 GAGTGGAGAAGGAAAGAAACTGG - Intergenic
1029126205 7:98296775-98296797 CAGTGGAGAGGGAGGCAGAGAGG - Intronic
1029165297 7:98585000-98585022 AAGGAAAGAAGGAAGGAGAAAGG - Intergenic
1029232376 7:99081092-99081114 GAGTGGAGAAGGATGGCGCAGGG + Intronic
1029257105 7:99277150-99277172 CAGTAGGGAAGGAAGGAGGGAGG + Intergenic
1029477161 7:100791974-100791996 CAGCGGAGGAGGAGGGACAAGGG + Exonic
1029551475 7:101239191-101239213 CAGAGGAGGAGGTAGGAGGAAGG + Intergenic
1029662163 7:101969923-101969945 AATTGAAAAAGGAAGGAGAAAGG - Intronic
1030011464 7:105172355-105172377 CAGGGGAGTAGGAAGGAAGAAGG + Intronic
1030162008 7:106518592-106518614 GAGAGGAGAGGGAAGGAGAGGGG - Intergenic
1030633328 7:111919417-111919439 CAGTGGAGAAGGGAAGGGAATGG + Intronic
1030638253 7:111974563-111974585 GAGAGGAGGAGGAAGGAAAAGGG + Intronic
1030960066 7:115907961-115907983 CACAGGAGAATGAAGGAGAAAGG + Intergenic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1031083379 7:117279325-117279347 CTGTGGGGGAGGAAGTAGAAAGG - Intronic
1031437288 7:121748571-121748593 CACTGGAGAAGCAAGAAGAGAGG + Intergenic
1031534418 7:122915876-122915898 GAGGGGAGAATGAATGAGAATGG - Intergenic
1031541022 7:122994574-122994596 CAGTGGAAAAGGATAGAGAAAGG + Intergenic
1031850765 7:126859430-126859452 TAATGGAGAGGGAAAGAGAAAGG + Intronic
1031895080 7:127339009-127339031 GGGTGGTGAAGGAAAGAGAAAGG - Intergenic
1032189031 7:129752265-129752287 CAGTGTAAAAGGAAGGAGTGGGG + Intronic
1032240171 7:130153833-130153855 CTGTGGGGGAGGAAGGAGAGTGG + Intergenic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1032446761 7:131990901-131990923 AAGTGGACAAGGAAGGACAAAGG + Intergenic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1033007615 7:137584545-137584567 GAGTAGAGAGGGAAGGAGAGGGG + Intronic
1033245512 7:139713942-139713964 CAGAGGAGAAGGATGGGCAATGG - Intronic
1033414094 7:141147240-141147262 CAGGAGGGAGGGAAGGAGAAAGG - Intronic
1033619345 7:143048483-143048505 AAATGGAGGAGGAAGAAGAAAGG - Intergenic
1034241313 7:149613274-149613296 CACTGGAGAAGGAAGGATGCTGG - Intergenic
1034281818 7:149859847-149859869 CACTGGAGAAGGAGGGAGAAGGG - Intronic
1034316060 7:150134381-150134403 CAGTGGTGAAAGAGAGAGAAGGG - Intergenic
1034563214 7:151894755-151894777 CAGAGGAGCAGGGAGGAGACAGG - Intergenic
1034563224 7:151894789-151894811 CAGAGGAGCAGGGAGGAGACAGG - Intergenic
1034607355 7:152329609-152329631 AAGAGGAAAAGGAAGTAGAAGGG + Intronic
1034657910 7:152743992-152744014 CAGAGGCTAAGGCAGGAGAATGG - Intergenic
1034657947 7:152744276-152744298 CAGAGGCTAAGGCAGGAGAATGG - Intergenic
1034790828 7:153966400-153966422 CAGTGGTGAAAGAGAGAGAAGGG + Intronic
1035105703 7:156440293-156440315 TAGGGAAGAGGGAAGGAGAACGG + Intergenic
1035168235 7:157003955-157003977 GAGGGGAGGAGGGAGGAGAAGGG + Intronic
1035476146 7:159145183-159145205 CAGGGAAGAGGGGAGGAGAACGG - Intergenic
1035686772 8:1529194-1529216 CAAGGTAGCAGGAAGGAGAAGGG + Intronic
1035836854 8:2764058-2764080 CAGTGGGGAAGGAATGGGTAAGG + Intergenic
1036188626 8:6648730-6648752 CACTGGACAAGGGAGGGGAAGGG + Intergenic
1036648808 8:10629077-10629099 CAGCTGAGCAGGAAAGAGAATGG + Intronic
1036692395 8:10952021-10952043 TAGGGGAGTGGGAAGGAGAAGGG + Intronic
1036921787 8:12863025-12863047 GTGTGAAGAAGGAAGGAGACTGG - Intergenic
1037575264 8:20197139-20197161 GAGGGGAGATGGAAGGAGAGAGG - Intergenic
1037611422 8:20479161-20479183 CAGTCGAGAAGTCAGGAAAATGG + Intergenic
1037693887 8:21207246-21207268 AAGAGGAGAAAGGAGGAGAATGG - Intergenic
1037741995 8:21615636-21615658 CTGTCACGAAGGAAGGAGAAGGG - Intergenic
1037946602 8:22993477-22993499 AAGTGGAGAAGGAGTTAGAAGGG + Intronic
1038216558 8:25567057-25567079 AAGTAGAGAAGGAAGGGGAAAGG + Intergenic
1038278600 8:26142517-26142539 GAGTAGAGAAGGATGGAGAGTGG + Intergenic
1038401219 8:27286397-27286419 CAGTTGGGAAGAAAGGAGAGGGG - Exonic
1038442608 8:27582514-27582536 CAGTAGAGGAGAAAGGAAAAGGG - Intergenic
1038659675 8:29486330-29486352 GAGTGGAGAAGGATGGAGAATGG + Intergenic
1038775310 8:30525354-30525376 CGGAGGAGGAGGAAGGAGAAGGG - Intronic
1038820886 8:30951077-30951099 GAGGGAGGAAGGAAGGAGAAAGG - Intergenic
1038941085 8:32306710-32306732 TAATGGAGAAAGGAGGAGAAAGG + Intronic
1039172957 8:34769498-34769520 GAGAGGAGAAGGGGGGAGAAAGG - Intergenic
1039269090 8:35861187-35861209 GAGTGGTGAAGAAAAGAGAATGG + Intergenic
1039350561 8:36759326-36759348 CATTGCAGGAGGAAGGAGAAAGG - Intergenic
1039391948 8:37188466-37188488 CATTGGAGAATGAAGGAGAGGGG + Intergenic
1039741683 8:40388686-40388708 CAGTGGAGCAGAAAGGAAGAAGG - Intergenic
1039789026 8:40859356-40859378 CAGGGGAGGAGGATGGAAAAAGG - Intronic
1040852403 8:51914583-51914605 AAGTGGAACAGGAAGGGGAAGGG - Intergenic
1041025930 8:53686994-53687016 CACAGGTTAAGGAAGGAGAATGG + Intergenic
1041095263 8:54343228-54343250 AAGAGGAGAAGGAAGCAGAGGGG - Intergenic
1041123718 8:54613129-54613151 GAGTAAAGAAGGAAGGGGAATGG + Intergenic
1041214203 8:55583680-55583702 AAGTGGGGAAGGCAGGAGAGGGG + Intergenic
1041231799 8:55759908-55759930 CAGTGTGGAAGGAAGGGGCAGGG - Intronic
1041552077 8:59114096-59114118 CAGTGGAACAGGAAGAAGTAGGG - Intronic
1041680156 8:60580731-60580753 CAGTTCAGAAGGAATGAGAATGG + Intronic
1041930024 8:63276614-63276636 CAGTGAAGAAGGTAGAATAATGG + Intergenic
1041977474 8:63816647-63816669 CAGGGTGGCAGGAAGGAGAAGGG + Intergenic
1042263339 8:66883052-66883074 CAGCCCAGAAAGAAGGAGAATGG + Intronic
1042572143 8:70177292-70177314 CACTGTAGGAGGCAGGAGAATGG - Intronic
1042673458 8:71289244-71289266 AAGTGGAAAATGAGGGAGAATGG + Intronic
1043352630 8:79378154-79378176 TAGGGGAGAATTAAGGAGAAGGG - Intergenic
1043466198 8:80509730-80509752 CAGTGGAAAAAGAATGAGATGGG - Intronic
1043627649 8:82283193-82283215 CAGTCGAGGGGGAAGGAGAGGGG + Intergenic
1043763304 8:84097268-84097290 AAGAAGAGAAGGAAAGAGAAAGG + Intergenic
1043918685 8:85955259-85955281 GAGTGGAGAAGGAGGGAGGGGGG + Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1044531221 8:93309936-93309958 CATGGGAGAAGGAAGGAGGCAGG - Intergenic
1044545493 8:93454566-93454588 CAGTGGCTGAGGCAGGAGAATGG + Intergenic
1044588419 8:93890078-93890100 CAGGGGAGGAGGAAGGACCAGGG - Intronic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044717557 8:95114233-95114255 CACAAGAGAAGAAAGGAGAAGGG + Intronic
1044779081 8:95724670-95724692 AAGAAGAGAAGGATGGAGAAAGG - Intergenic
1045064912 8:98436200-98436222 CAGAGGAGAAGGAAGAACCATGG - Intronic
1045500172 8:102738697-102738719 CAGTGGAGAAGCAAGAAGGAGGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045737264 8:105310790-105310812 CAGTGGATAAGGAAACAGAATGG + Intronic
1046088571 8:109469458-109469480 GAGAAGAGAGGGAAGGAGAAAGG - Intronic
1046504090 8:115114901-115114923 AAGAAGAGAAAGAAGGAGAATGG - Intergenic
1046586213 8:116151170-116151192 CACTGGAGAAAGAAGTAGACTGG + Intergenic
1046593272 8:116230648-116230670 CACTGGAGAATGAAAAAGAAAGG + Intergenic
1046667424 8:117019589-117019611 CCCTCAAGAAGGAAGGAGAAAGG - Intronic
1046751839 8:117934552-117934574 CAGATGAGAAGGAAGGGAAAGGG - Intronic
1047113669 8:121817886-121817908 AAGTGGAGAGGAAAGGGGAAAGG - Intergenic
1047217968 8:122894224-122894246 CAGTTGAGAAGGGAGGACACTGG + Intronic
1047396770 8:124507333-124507355 CAGCGGACAAGAAATGAGAAAGG + Intronic
1047480396 8:125276646-125276668 GAATAAAGAAGGAAGGAGAAAGG + Intronic
1047488590 8:125355356-125355378 GAAAGGAGAAGGAAGGAGAAAGG + Intronic
1047534405 8:125706311-125706333 GGGTGGAGAAGGAAAGACAAAGG + Intergenic
1047641831 8:126828764-126828786 AAGATGGGAAGGAAGGAGAAGGG - Intergenic
1047679945 8:127244362-127244384 GAGAGGAGAAGGAAGGGGAGGGG + Intergenic
1047706248 8:127502665-127502687 CAGTGGAGAATGGAAGAGAGGGG - Intergenic
1047794558 8:128241190-128241212 GAGTGGAGCAGGAAGGACAGTGG - Intergenic
1047833985 8:128667973-128667995 CTGGGGAGAAGGAAGGGGAGTGG - Intergenic
1048263268 8:132963746-132963768 AAGGAAAGAAGGAAGGAGAAGGG + Intronic
1048288916 8:133164714-133164736 CTGTGGAGAAGGACAGTGAATGG - Intergenic
1048473631 8:134724293-134724315 CATAGCAGAAGGAAGGACAATGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048816500 8:138339447-138339469 CAGGGAAGAAGAGAGGAGAATGG - Intronic
1048950491 8:139492728-139492750 CAGTGGTGAAGGAAGAATAGGGG - Intergenic
1049181680 8:141226189-141226211 CAGAGGGGAAAGATGGAGAAAGG - Intronic
1049311819 8:141937496-141937518 AACGGGAAAAGGAAGGAGAAAGG - Intergenic
1049346258 8:142140586-142140608 CTCTGAAGAAGGGAGGAGAAGGG + Intergenic
1049474885 8:142792482-142792504 AAGTGTAGATGGAAGGAGGATGG - Intergenic
1049519277 8:143080024-143080046 GAGGGGAGAAGGGAGGAGAAGGG - Intergenic
1049816678 8:144606349-144606371 CCGAGGAGAAGGAAGAGGAAGGG - Intergenic
1049937818 9:516543-516565 CAGTGGGGAGGGAAGGGGAGCGG + Intronic
1050105450 9:2161521-2161543 CAGTGGAGGAAGAAGAAAAAAGG - Intronic
1050290469 9:4148875-4148897 CTGTGGAGGAGAGAGGAGAATGG - Intronic
1050360804 9:4829290-4829312 TTATGGAGATGGAAGGAGAACGG + Intronic
1050422803 9:5484406-5484428 CTAGGGAGAAGGAAGGATAAGGG - Intergenic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1050985450 9:12076590-12076612 GAGTGGAGAGGGGAGGAGAGAGG - Intergenic
1051046897 9:12886658-12886680 CAGGAGAGAAGGAAAGAGAGAGG + Intergenic
1051191195 9:14515272-14515294 AAGTGGAGAAGGAAGAAAAAGGG + Intergenic
1051195344 9:14558038-14558060 CAGGAGAGCAGGATGGAGAAAGG + Intergenic
1051257223 9:15226861-15226883 GAGTGGAAATGGAAGGAGATTGG - Intronic
1051273312 9:15375639-15375661 CAGTGGAGATGAAAGGGGAGTGG - Intergenic
1051680990 9:19607793-19607815 CATTGGAGAAAGAAAGAGAGAGG + Intronic
1051741260 9:20254575-20254597 AGGTGGTGAAGGGAGGAGAAGGG + Intergenic
1052104145 9:24491381-24491403 CAGAGGAGAAGAATTGAGAAGGG - Intergenic
1052294103 9:26878603-26878625 AAGTGGAGGAAGATGGAGAATGG - Intronic
1052721753 9:32179750-32179772 CAATAGAGAAGGCAGGAGAAAGG + Intergenic
1053317495 9:37064325-37064347 CAGAGGGGAAAGGAGGAGAATGG - Intergenic
1053630739 9:39935406-39935428 CAGAGGAGGAAAAAGGAGAAAGG + Intergenic
1053705266 9:40746919-40746941 CACTGGATAAGGGAGGGGAAAGG + Intergenic
1053775027 9:41528099-41528121 CAGAGGAGGAAAAAGGAGAAAGG - Intergenic
1053946368 9:43312943-43312965 AAGGGAGGAAGGAAGGAGAAGGG + Intergenic
1054213148 9:62315292-62315314 CAGAGGAGGAAAAAGGAGAAAGG - Intergenic
1054415343 9:64870526-64870548 CACTGGATAAGGGAGGGGAAAGG + Intergenic
1054877167 9:70109023-70109045 GACTGGATAAGGAAGGAGGATGG + Intronic
1055022677 9:71686806-71686828 CAATGGAGAAGGAAGGGTGAGGG - Intronic
1055429481 9:76229037-76229059 GAGGAAAGAAGGAAGGAGAAAGG + Intronic
1055697687 9:78904599-78904621 AAGAGGAGGAGGAAGAAGAAAGG - Intergenic
1055883720 9:81033788-81033810 AAGTGGGGAAGAAAGGAGAAAGG + Intergenic
1056232305 9:84559147-84559169 CAGTGAAGAAGGAAGGAATTAGG + Intergenic
1056513366 9:87327167-87327189 CAAAGAAGAAGGAAGAAGAAGGG + Intergenic
1056546214 9:87616106-87616128 CGCTAGAGAAGGAAGCAGAAAGG - Intronic
1056905194 9:90641380-90641402 CACAGGGAAAGGAAGGAGAAAGG - Intronic
1056959622 9:91111583-91111605 CTGAGGAGAAGGAAAGAGATGGG + Intergenic
1056998444 9:91485466-91485488 CTGAGGAGAAGGAAGGAGTATGG - Intergenic
1057392921 9:94654105-94654127 AGGTGGAGAAGGATGGAAAATGG + Intergenic
1057725438 9:97564903-97564925 AAGTGGAGAAGGAAAGAAAGTGG - Intronic
1057936606 9:99244905-99244927 AAGGGGAGAAGGAGAGAGAAGGG + Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058561422 9:106233078-106233100 AGGAGGAGAAGGAAAGAGAAAGG - Intergenic
1058561490 9:106233400-106233422 GAGAGGAAAAGGAAGAAGAAAGG - Intergenic
1058565873 9:106284534-106284556 CATGGCAGAAGGAAAGAGAAGGG - Intergenic
1058613578 9:106801527-106801549 CAGTAGAAAATGAAGAAGAAAGG + Intergenic
1058799643 9:108532778-108532800 CACTGGAGAAGGATGGCAAAAGG + Intergenic
1058839314 9:108890884-108890906 CTGTGGGGAAGGAAGGAGAGTGG - Intronic
1058857645 9:109079758-109079780 AAGTGTAGAAGAGAGGAGAAAGG + Intronic
1058886652 9:109326762-109326784 CAATGGAGATGGAAGGGGCAGGG - Intergenic
1058913283 9:109541016-109541038 AGGAGGAGGAGGAAGGAGAAGGG - Intergenic
1058935774 9:109767955-109767977 GAGAAAAGAAGGAAGGAGAAAGG + Intronic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059397166 9:114042893-114042915 CAGTGGCTAGGGTAGGAGAAAGG - Intronic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1059970122 9:119658635-119658657 GTATGGAGAAGGAAGGAGGATGG + Intergenic
1060294570 9:122334487-122334509 TTGTAGAGAAGGAAGGAGAAAGG + Intergenic
1060454101 9:123774009-123774031 CAGTGAAAGAGGAAGGGGAAGGG + Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1061205803 9:129162611-129162633 CAATGGAGAAGCCACGAGAAAGG + Intergenic
1061394438 9:130336121-130336143 AAGGAAAGAAGGAAGGAGAAAGG + Intronic
1061423308 9:130483886-130483908 AAGTGGAGGAGTAAGGAGGAAGG - Intronic
1061560062 9:131396228-131396250 AAGGGAGGAAGGAAGGAGAAAGG - Intronic
1061572691 9:131487536-131487558 GAGAGGAGGAGGAAGGAGCAAGG - Intronic
1061762374 9:132859602-132859624 GGGAGGAGAAGGGAGGAGAAGGG - Intronic
1062050517 9:134444429-134444451 GAGGGGGGAAGGAAGGAGAAAGG - Intergenic
1062050633 9:134444731-134444753 TAGGAAAGAAGGAAGGAGAAGGG - Intergenic
1062309477 9:135928384-135928406 GAGTGGAGATGGATGGAGACAGG - Intergenic
1062314580 9:135960516-135960538 AAGGGGAAGAGGAAGGAGAAGGG + Intronic
1062453000 9:136623348-136623370 CTGGAGAGAAGGAAGGAGAAAGG - Intergenic
1062687466 9:137822084-137822106 CAGGGGAGAAGGAGGGACTAAGG - Intronic
1203589498 Un_KI270747v1:41501-41523 AAGGGAGGAAGGAAGGAGAAGGG + Intergenic
1185623406 X:1466839-1466861 AAGAAGAGAAGGAAGGAGAGAGG - Intronic
1185623838 X:1468981-1469003 GAGGGGAGAGGGAAGGAGAGGGG - Intronic
1185623868 X:1469056-1469078 AAGGGGAGAGGGAAGGAGAGGGG - Intronic
1185735848 X:2495652-2495674 CAAGGGAGGAGGAAGGAGGAAGG - Intronic
1185756157 X:2654805-2654827 CAGTGGAGAAGACAGGAGTGTGG + Intergenic
1185824868 X:3240508-3240530 AAGGAAAGAAGGAAGGAGAAAGG - Intergenic
1185834040 X:3328859-3328881 CAGGAGAGAAGGCAGGAGGAAGG + Intronic
1186020073 X:5245168-5245190 AAGTGAAGAAGGAAGAAGGAAGG - Intergenic
1186174475 X:6910631-6910653 CCCTGGAGGAGGAAGGAGACAGG + Intergenic
1186552637 X:10522599-10522621 CAGAGGCGGAGGCAGGAGAATGG - Intronic
1186561568 X:10618918-10618940 ATGAGGAAAAGGAAGGAGAAGGG - Intronic
1186588115 X:10898228-10898250 AAAAGGAAAAGGAAGGAGAAAGG + Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1186953969 X:14659681-14659703 CCTGGGAGAAAGAAGGAGAAAGG + Intronic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187399054 X:18943270-18943292 TAGTGGAGAAGAAATGAGATGGG - Intronic
1188137157 X:26504731-26504753 CAGAGGAGGAGGTAGGGGAATGG - Intergenic
1188540555 X:31245819-31245841 CAGAGGAGAGGGAAAGAGATGGG - Intronic
1189110652 X:38286242-38286264 GAGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110667 X:38286293-38286315 GAGAAGAGGAGGAAGGAGAAGGG - Exonic
1189110798 X:38286734-38286756 AAGAAGAGAAGGAGGGAGAAGGG - Exonic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189207260 X:39252564-39252586 AAGAGGAGGAGAAAGGAGAAGGG + Intergenic
1189224397 X:39400583-39400605 CGAGGGTGAAGGAAGGAGAAAGG - Intergenic
1189307887 X:40000832-40000854 CAGTGGGGTAAGAAGGAGAGGGG + Intergenic
1189322551 X:40095708-40095730 GAGCGAAGAAGGAAGGAGGAGGG - Intronic
1189335242 X:40167093-40167115 CAGTGGAGAAGGTAGATGGAGGG - Intronic
1189624685 X:42883898-42883920 GAGTAAAGAAGGAGGGAGAATGG - Intergenic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1189960813 X:46323316-46323338 CAGGGGAGAAGTATGGGGAAAGG + Intergenic
1190123406 X:47682719-47682741 GATGGGAGAAGGAAGAAGAAGGG - Intergenic
1190260386 X:48793501-48793523 GAATGGAGAAGGAAGGAGGGAGG - Intronic
1190326326 X:49209310-49209332 CAGAGGAGGAGGAAGAAGAGGGG - Exonic
1190444017 X:50504933-50504955 GAGTGGAGGAGGAGGGAAAAGGG - Intergenic
1190789502 X:53686158-53686180 CAGAGGAGAGGGAAGGTGAGGGG - Intronic
1190925122 X:54896269-54896291 CAGGGGAGAGGGAAAGAGAAAGG - Intergenic
1191026056 X:55914674-55914696 AAGTTGAGAAAGAAGGAGCATGG + Intergenic
1191669080 X:63732343-63732365 AAATTGAGAAGGAGGGAGAATGG - Intronic
1191715372 X:64190467-64190489 AAGAGGAGGAAGAAGGAGAATGG - Exonic
1192011648 X:67278980-67279002 CAGAGGCGGAGGCAGGAGAATGG + Intergenic
1192137755 X:68620334-68620356 GAGAAAAGAAGGAAGGAGAAGGG - Intergenic
1192171849 X:68860643-68860665 CACTTGGCAAGGAAGGAGAAGGG + Intergenic
1192216830 X:69165019-69165041 GAGGGAAGAAGGAAGGAGAGGGG + Intronic
1192357520 X:70418116-70418138 GGGTGCAGAGGGAAGGAGAAGGG - Intronic
1193214697 X:78850061-78850083 CAGTGGATAATGAATGTGAAAGG - Intergenic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1193477955 X:81990224-81990246 AAGTGGAGGAGGGAAGAGAAAGG + Intergenic
1193602405 X:83523897-83523919 CACTTGAGAAGGCAGGAGAGAGG - Intergenic
1193665967 X:84317344-84317366 TAGTGGGGAAGGAATAAGAAAGG - Intergenic
1193956709 X:87872732-87872754 CAGGGCAAAAGAAAGGAGAAAGG - Intergenic
1194949583 X:100109338-100109360 CAATGGAGAAGGGAAGGGAAGGG + Intergenic
1195175232 X:102308350-102308372 CAGCGTAGAAAGAAGCAGAAAGG - Intronic
1195183633 X:102378743-102378765 CAGCGTAGAAAGAAGCAGAAAGG + Intronic
1195494616 X:105516071-105516093 GTCAGGAGAAGGAAGGAGAAGGG + Intronic
1195737634 X:108030185-108030207 CAATGCAGAAGAAAGGTGAAGGG + Intergenic
1195842635 X:109191572-109191594 CAGTGGGGAAGAAAATAGAACGG - Intergenic
1195882912 X:109611327-109611349 GAGTAGAGGAGGAGGGAGAAAGG + Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196311943 X:114178662-114178684 CAGAGGAGAAGGAAGAAGAGGGG - Intergenic
1196469355 X:116008271-116008293 CAGGTGTGAAGGAAGGACAAAGG + Intergenic
1196556925 X:117099061-117099083 CAGTGGAGAAGGAATTAGGCTGG + Intergenic
1196717420 X:118824543-118824565 CAGCGGAGAAGGCCAGAGAAGGG - Intronic
1197134086 X:123040899-123040921 CAGTGGAGGAAGAAGTACAAGGG + Intergenic
1197282409 X:124552727-124552749 CAGAGGAGTGGGAAGGAGATTGG - Intronic
1197295664 X:124716441-124716463 CAGTGGATGAGGAAGGAGATTGG - Intronic
1197665285 X:129216635-129216657 CAGGGTAGCAGGAAGGAGAAGGG + Intergenic
1197827241 X:130602809-130602831 GAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1198137941 X:133772964-133772986 CCTTGGAGAAGGAAAGAGGAAGG + Intronic
1198184484 X:134240055-134240077 CAGTGAAAAAGGGTGGAGAATGG + Intronic
1198919911 X:141713914-141713936 TAGTAGAGAAGGAAGGGAAAAGG - Intergenic
1198929292 X:141836566-141836588 CAGAGCAGAAGGTAGGAGACAGG + Intergenic
1198972818 X:142300518-142300540 CAGAGCAGGAGAAAGGAGAAAGG + Intergenic
1199049438 X:143219972-143219994 GGGTGGAGAAGGATGGAAAATGG - Intergenic
1199074174 X:143510859-143510881 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199093168 X:143714120-143714142 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199215167 X:145254040-145254062 AGGTGGAGAAGGAAGGGGGATGG + Intronic
1199411756 X:147532220-147532242 CAGTGTAGAGGAAGGGAGAATGG - Intergenic
1199498905 X:148487548-148487570 AAGAGGTGAAGGAAGTAGAAGGG - Intergenic
1199498910 X:148487586-148487608 AAGAGGTGAAGGAAGTAGAAGGG - Intergenic
1199555057 X:149098138-149098160 AAGGAGAGAAGGAAGGAGGAAGG + Intergenic
1199953490 X:152723971-152723993 TAGTTGAGAGGGAGGGAGAAGGG + Intergenic
1199956192 X:152744479-152744501 TAGTTGAGAGGGAGGGAGAAGGG - Intergenic
1200002564 X:153069588-153069610 AGGTGCAGAAGGAAGGAGAGTGG + Intergenic
1200005160 X:153080422-153080444 AGGTGCAGAAGGAAGGAGAGTGG - Intergenic
1200180498 X:154147487-154147509 CCGTGCAGAAGGAAGCAGAGGGG - Intronic
1200186326 X:154185882-154185904 CCGTGCAGAAGGAAGCAGAGGGG - Intergenic
1200191978 X:154223020-154223042 CCGTGCAGAAGGAAGCAGAGGGG - Intronic
1200197733 X:154260824-154260846 CCGTGCAGAAGGAAGCAGAGGGG - Intronic
1200465579 Y:3512463-3512485 CAGTGGAGAATCAGGAAGAAGGG + Intergenic
1201054360 Y:9974238-9974260 AAAAGGAGAAGGAGGGAGAAAGG + Intergenic
1201112809 Y:10812779-10812801 GAGTGGAGTAGAATGGAGAAGGG - Intergenic
1201300226 Y:12498705-12498727 AAGAGGAGAAGGAGGGGGAAGGG - Intergenic
1201302968 Y:12526066-12526088 GCGTGGTGAAGGACGGAGAAAGG + Intergenic
1201458098 Y:14193378-14193400 CATTGAACAAAGAAGGAGAAAGG + Intergenic
1201471155 Y:14336290-14336312 CAGAGGACAAAGGAGGAGAAAGG - Intergenic
1201741202 Y:17326042-17326064 GAGGGAAGAAGGAAGGAGAGAGG + Intergenic