ID: 1132840632

View in Genome Browser
Species Human (GRCh38)
Location 16:1976988-1977010
Sequence GTGTGGCCAAGCCCTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132840617_1132840632 26 Left 1132840617 16:1976939-1976961 CCACTCAGCGCTGCCATGATAAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1132840632 16:1976988-1977010 GTGTGGCCAAGCCCTTGCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1132840627_1132840632 -3 Left 1132840627 16:1976968-1976990 CCATAGCCACTGGGGTGGGGGTG 0: 1
1: 0
2: 3
3: 48
4: 325
Right 1132840632 16:1976988-1977010 GTGTGGCCAAGCCCTTGCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1132840619_1132840632 13 Left 1132840619 16:1976952-1976974 CCATGATAAGGTGACTCCATAGC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1132840632 16:1976988-1977010 GTGTGGCCAAGCCCTTGCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 181
1132840629_1132840632 -9 Left 1132840629 16:1976974-1976996 CCACTGGGGTGGGGGTGTGGCCA 0: 1
1: 0
2: 3
3: 56
4: 374
Right 1132840632 16:1976988-1977010 GTGTGGCCAAGCCCTTGCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132840632 Original CRISPR GTGTGGCCAAGCCCTTGCTG GGG Intronic
900480686 1:2897589-2897611 GGGTGACGAAGCCCCTGCTGAGG - Intergenic
900693380 1:3995229-3995251 GTGAGGCCAGCACCTTGCTGTGG + Intergenic
900786548 1:4653899-4653921 GCCTGGCCAGGCCCTTGCTCCGG - Intergenic
901462021 1:9397675-9397697 CTCTGACCAAGCCCTGGCTGAGG - Intergenic
901853286 1:12029432-12029454 GGGTGGCCAAGCCCTGGTAGGGG + Intronic
904347174 1:29880366-29880388 GAGTGGCAAAGCCCAAGCTGTGG + Intergenic
904757412 1:32775755-32775777 CTGTGGCCCAGCCCTTGTTAGGG + Exonic
906237614 1:44221378-44221400 AAGTGGCCAAGCCCTTGCAAGGG + Exonic
907272303 1:53298204-53298226 GGAGGCCCAAGCCCTTGCTGGGG + Intronic
909758864 1:79264470-79264492 TTTTAGCCAAGCCATTGCTGAGG - Intergenic
913559735 1:120005486-120005508 GTGTGGCCCAGGCCATGCTGGGG - Exonic
913638123 1:120785054-120785076 GTGTGGCCCAGGCCATGCTGGGG + Intergenic
914280322 1:146164908-146164930 GTGTGGCCCAGGCCATGCTGGGG - Exonic
914541367 1:148615848-148615870 GTGTGGCCCAGGCCATGCTGGGG - Intronic
914625273 1:149455398-149455420 GTGTGGCCCAGGCCATGCTGGGG + Intergenic
914740416 1:150460225-150460247 GTTTGGCAAAGCCAATGCTGGGG - Exonic
915601995 1:156928153-156928175 CTTTTGCCAAGCCCCTGCTGGGG + Intronic
915706808 1:157851673-157851695 GTCTGGCCTAGGCCTTCCTGAGG + Intronic
919926954 1:202196445-202196467 ATGTATCCCAGCCCTTGCTGAGG + Intronic
920955515 1:210617031-210617053 GTGTTGCCCAGCACATGCTGAGG - Intronic
921803765 1:219431457-219431479 GTCTGGACAACCCCTTGTTGAGG + Intergenic
922800243 1:228361796-228361818 GTGTCTTCAAGCCCTTGCTGAGG - Intronic
923047920 1:230369052-230369074 CTGTGGCCAAGGCCTTCCAGAGG - Intronic
924907729 1:248474064-248474086 AGGTGGCCAAGGCCTTCCTGTGG - Exonic
924916379 1:248574022-248574044 AGGTGGCCAAGGCCTTCCTGCGG + Exonic
1062939387 10:1410139-1410161 GTGGTGCCAAGGCCTGGCTGTGG + Intronic
1064030827 10:11881632-11881654 GTGTGTCCAAGGCCATCCTGAGG + Intergenic
1066587450 10:36951918-36951940 GTGTAGCCATTCCCTTGCTGTGG - Intergenic
1066647275 10:37622574-37622596 CTGAGCCCCAGCCCTTGCTGTGG + Intergenic
1067943484 10:50675938-50675960 GTGCGGCCAAGGACTTTCTGTGG + Intergenic
1069992468 10:72323852-72323874 CTGAGGCCCAGACCTTGCTGGGG + Intergenic
1070591149 10:77802043-77802065 CTGCTGCCAAGCCTTTGCTGTGG - Intronic
1073611971 10:104953290-104953312 CTGTGGCCATACCCTTGATGGGG + Intronic
1076732802 10:132446824-132446846 GGGTGCCCAGGCCCCTGCTGTGG - Intronic
1076809763 10:132880383-132880405 GGGTGGCCAAGGGCCTGCTGAGG + Intronic
1076837562 10:133028748-133028770 GGGTGGCCATGCTCTAGCTGAGG + Intergenic
1077116577 11:887834-887856 GTGTGGCCAAGGCCATGAGGTGG - Intronic
1077477160 11:2795895-2795917 GTGTGGCCAACCCCTTGCACAGG + Intronic
1078931179 11:15913033-15913055 CTGTGGCCTCGCCCTTACTGGGG + Intergenic
1078965452 11:16335037-16335059 ATCTGGCAAAGCTCTTGCTGTGG - Intronic
1079333779 11:19553750-19553772 GTCTGGCCATTCCCTTTCTGGGG + Intronic
1083296065 11:61716261-61716283 GTGTGACCAGGGCCATGCTGGGG + Intronic
1083737735 11:64691248-64691270 ATGTGGGCAAGCCCTTTCTCAGG + Intronic
1084791991 11:71480918-71480940 GTGTGGCCACGCCCCTGGGGTGG + Intronic
1085040830 11:73325321-73325343 GTGTGGCCAGGCCTGGGCTGTGG + Intronic
1088691613 11:112333243-112333265 GGGTAGCACAGCCCTTGCTGTGG + Intergenic
1088837614 11:113591164-113591186 CTGTGGCCAAGGCTTTCCTGTGG - Intergenic
1091654091 12:2332463-2332485 GTCTGGCCAAGTCTTTCCTGTGG - Intronic
1092345725 12:7713094-7713116 CTGTGGCCAAGCCCGCGCTTGGG - Intronic
1094099101 12:26742040-26742062 GTGTGGGCACTCCCTTGCAGAGG - Intronic
1101302091 12:103493560-103493582 GGGTGGCCAAGTCCTCTCTGAGG - Intronic
1104016492 12:124965465-124965487 GGGCTGCCAACCCCTTGCTGAGG - Intronic
1104748612 12:131224624-131224646 GGGTGGCCAAGCCATGGGTGTGG + Intergenic
1104784510 12:131440940-131440962 GGGTGGCCAAGCCATGGGTGTGG - Intergenic
1106806585 13:33314206-33314228 GTCAGGCCAAGCCCAAGCTGAGG + Intronic
1107660656 13:42636042-42636064 GTGAGGCCATTGCCTTGCTGAGG + Intergenic
1108382977 13:49871856-49871878 GTGTCGACAGGCCCTTCCTGAGG - Intergenic
1109512788 13:63401740-63401762 GTTTGGCCAAGGCCTTCCTTGGG - Intergenic
1114558499 14:23575998-23576020 CTGTGGCCGAGCCCTCGATGAGG + Exonic
1118732240 14:68676680-68676702 GTGTGGCAAGCCCCCTGCTGAGG + Intronic
1121533069 14:94672095-94672117 GGGTGGCCCAGCCCTAGCTGGGG - Intergenic
1121701985 14:95961638-95961660 TTGTGGTCAGGCCCTTGCTTTGG - Intergenic
1122023796 14:98859936-98859958 GTGTGTCCAGGCCCTGGCTCAGG - Intergenic
1122625602 14:103084070-103084092 ATGAGGCCGGGCCCTTGCTGGGG + Intergenic
1122648786 14:103213522-103213544 GTGAGGCAAAGTCCATGCTGAGG + Intergenic
1123689671 15:22827435-22827457 GTGAGGCCCTGCCCATGCTGGGG + Exonic
1124504305 15:30260229-30260251 GTGTGGCCCAGCACTTTGTGAGG - Intergenic
1124739246 15:32278406-32278428 GTGTGGCCCAGCACTTTGTGAGG + Intergenic
1125427675 15:39566031-39566053 GAGTGGCCAAGAGCTTGCTTGGG - Intergenic
1128800888 15:70496188-70496210 GTGTGCCACTGCCCTTGCTGTGG + Intergenic
1132084686 15:98898135-98898157 GAGTGGGCAAGCCCTAGTTGTGG - Intronic
1132743923 16:1428930-1428952 GCTTGGCCAGGCCCTGGCTGTGG - Intergenic
1132840632 16:1976988-1977010 GTGTGGCCAAGCCCTTGCTGGGG + Intronic
1134439606 16:14290946-14290968 GTGTGGCGAAGCCTTCGCAGGGG - Intergenic
1136067118 16:27766781-27766803 GGGTGGCCAGGCCTCTGCTGAGG + Intronic
1139552274 16:67680971-67680993 GGGTGGCCAGGCCCTTGCACGGG + Intronic
1141297527 16:82783725-82783747 GTGTGGAGAAGCCCTTGCCTCGG - Intronic
1142177744 16:88652696-88652718 GTGTGCCCCCGCCCTTCCTGTGG + Intronic
1143422065 17:6801195-6801217 CTCTGGCCAGGCCTTTGCTGAGG - Intronic
1143638910 17:8184123-8184145 GAGTGGCCAGGCCCAGGCTGGGG - Intergenic
1144439759 17:15271153-15271175 GTCTGACCATGCTCTTGCTGTGG - Intergenic
1145875658 17:28317065-28317087 GTGTGGACATGGCCTTGCGGAGG - Intergenic
1146686915 17:34847263-34847285 GTGTGGCCCCTTCCTTGCTGGGG - Intergenic
1152067495 17:78119547-78119569 GTGTGACCAAGCACCTGGTGGGG - Intronic
1152067731 17:78120897-78120919 GTGTGACCAAGCCCCTGGTGGGG - Intronic
1154325298 18:13386810-13386832 GGGAGGCCAAGCCCTTTGTGAGG + Intronic
1159021440 18:63146286-63146308 CTATGGCCAAGCCCTGGCTGCGG - Intronic
1159268855 18:66122397-66122419 GTGTGGACAACCTCTTACTGAGG + Intergenic
1159762827 18:72449754-72449776 GAGAGGCCATGTCCTTGCTGTGG - Intergenic
1160805227 19:989660-989682 GTGTGGCCATGGCCGTGCAGTGG + Intronic
1164576718 19:29409404-29409426 GTAGGGCCCAGCCCTTTCTGTGG - Intergenic
1165360702 19:35335203-35335225 GTGTGGTCAAGGCCTTTCAGAGG + Intronic
1166718463 19:44984103-44984125 GTGAGGCCAACTCCTGGCTGGGG + Intronic
1166980786 19:46630963-46630985 CTGGGGCCAGGCCCATGCTGGGG - Intergenic
1167080966 19:47275747-47275769 GTGTGGGAAAGACCTTCCTGGGG + Intergenic
1168693342 19:58390759-58390781 GTTGGGCCAAACCCTTCCTGGGG + Intronic
926067728 2:9857748-9857770 GTGTGAGCAAGCCCATGCAGGGG + Intronic
926724512 2:15986889-15986911 GTGATGCCCAGCCCTGGCTGGGG + Intergenic
928489422 2:31766250-31766272 GTGTGGCCTGGCCTTTGCTTTGG - Intergenic
928952079 2:36822157-36822179 GTGTGGGCAAATCCCTGCTGAGG - Intergenic
930052225 2:47225379-47225401 GTATGGCCAAACACTTGCTCAGG + Intergenic
931716259 2:65031403-65031425 GTGTGGGCAAGCACCTGCTGCGG - Intergenic
935199226 2:100841543-100841565 GTGTGCCTAAGATCTTGCTGTGG + Intronic
937090805 2:119205077-119205099 GTGTGTGCAAGCCCCTGATGGGG - Intergenic
937913313 2:127086836-127086858 GTGAGGCCAGGCGCTTCCTGGGG - Intronic
938407886 2:131042712-131042734 GTGAGGCCCAGCCCTGGCTCAGG + Intronic
940909201 2:159195677-159195699 GTGTGGCTAAGCCTTTGGGGTGG + Intronic
941929078 2:170923444-170923466 GTGTGTCACAGCCCTTGCTCAGG + Intergenic
942693671 2:178614484-178614506 GTGTGGCCGGGCCACTGCTGTGG - Exonic
943810102 2:192174787-192174809 GTGAGCCCAAGCGCTTGGTGGGG + Intronic
948057280 2:235018115-235018137 GTGTAGCCAAACCCTTGGTGTGG + Intronic
948181994 2:235989513-235989535 GTGTGCCCAGGCCCTGCCTGGGG - Intronic
948530465 2:238600445-238600467 GTGTCACCCAGGCCTTGCTGGGG + Intergenic
1170947058 20:20900782-20900804 GTCTGGACAAGCCCTTGCCCAGG - Intergenic
1172037587 20:32020605-32020627 GTCAGGCCAAAACCTTGCTGTGG + Intronic
1172765703 20:37349668-37349690 CTGTGGTCAAGCCCTTGCCTGGG + Intronic
1174453087 20:50631560-50631582 GTAAGGCCAAGCCCCTGCTTGGG - Intronic
1176655029 21:9580095-9580117 GCGTGGCGCAGCCCTGGCTGAGG - Intergenic
1179520581 21:41941772-41941794 GTGTTGCCAAGGCCTGGGTGAGG - Intronic
1179820848 21:43936001-43936023 GTGGGGCCTAGGCCTTGCTTAGG - Intronic
1181077793 22:20393201-20393223 CTGTGGCCAAGCCTAAGCTGCGG + Intergenic
1181439211 22:22927171-22927193 GAGTTGCCAAGCCCATCCTGAGG - Intergenic
1181496793 22:23291840-23291862 GCCTGGCCAGGCCCTGGCTGTGG + Intronic
1182493694 22:30691862-30691884 GTTCGGCCACTCCCTTGCTGTGG - Intergenic
1183272624 22:36871646-36871668 GTGGGGACACGCTCTTGCTGTGG - Exonic
1183324931 22:37186006-37186028 GGGTGGCCGAGCCCATGCTTTGG + Intronic
1183614491 22:38935213-38935235 GTGTGGCCATGCCAGGGCTGCGG + Intergenic
1184433297 22:44454286-44454308 GTGTGTCCAACTCCTTACTGAGG + Intergenic
1184508426 22:44917964-44917986 GTGTGGCCAGGGCCCTGATGTGG - Intronic
949266306 3:2160707-2160729 CAGATGCCAAGCCCTTGCTGAGG - Intronic
950096295 3:10332742-10332764 CTCTTGCCACGCCCTTGCTGTGG + Intronic
952670946 3:35967573-35967595 CTGTGGCTAAAACCTTGCTGTGG + Intergenic
954966691 3:54617768-54617790 GTGTGCTCAAGAGCTTGCTGGGG + Intronic
955741825 3:62099271-62099293 GTGTAAGCAAGCCCTTACTGTGG + Intronic
960293624 3:115916155-115916177 GTGGGGCCAAGCACTCTCTGTGG - Intronic
962305799 3:134284674-134284696 GAGTGGACAAGCCCTTGAAGCGG - Intergenic
962843511 3:139255737-139255759 GTGTGTCCAGATCCTTGCTGAGG - Intronic
963103078 3:141623848-141623870 TTGGGGCCAAGTCCTTACTGAGG - Intergenic
968614861 4:1572838-1572860 GTGTGGCCAAGCCACTGTGGAGG + Intergenic
969498955 4:7541564-7541586 CTGTGGCCAGGGCCTTGCTCGGG + Intronic
969512062 4:7623720-7623742 CAGTGACCGAGCCCTTGCTGGGG + Intronic
969527049 4:7709151-7709173 ATGTGGTCAAGCCGTTCCTGAGG + Intronic
979494245 4:121366556-121366578 GGATGGCCTGGCCCTTGCTGAGG + Intronic
983246590 4:165294744-165294766 ATGTGTGCAAGCTCTTGCTGTGG - Intronic
984845386 4:184103861-184103883 GTGTGGCCAGGGGCTCGCTGGGG - Intronic
987399798 5:17463629-17463651 CTGTGGCCACCCCCTTTCTGAGG + Intergenic
987620345 5:20332059-20332081 GTTTAGCCAAGCCCTTTATGTGG + Intronic
990609228 5:57441039-57441061 GGTTGGCCAGGTCCTTGCTGTGG - Intergenic
994577315 5:101595009-101595031 ATGGAGCCAAGCACTTGCTGTGG + Intergenic
997356480 5:133266035-133266057 GAGTGGCTAAGCCCTCGCTAAGG + Intronic
998856995 5:146403342-146403364 GTATGGGCATGCCCTTGCTCAGG - Intergenic
999126400 5:149249490-149249512 CTGTTTCCAAGCCCTGGCTGCGG + Intronic
999673526 5:153977595-153977617 TTGAGGCCAAGGCCTTGATGAGG - Intergenic
1000420681 5:161035026-161035048 GTCTGGCTAGGCCCTTCCTGGGG - Intergenic
1002019553 5:176354257-176354279 GTGTGCCCAAGGTCTTGCTAGGG + Intronic
1002441223 5:179265485-179265507 GGGGGGCCCAGCCCTCGCTGGGG + Intronic
1002517830 5:179772833-179772855 GTGTGGCTGAGACCATGCTGGGG - Intronic
1005944188 6:30583799-30583821 GTGTGGTCTTGCCCTTGCTGGGG - Exonic
1006196445 6:32245570-32245592 GTGTGGCCAAACCCTAACAGGGG - Intergenic
1007406899 6:41640465-41640487 GTCTGGCCCAGCCCAGGCTGGGG - Intronic
1007548158 6:42709622-42709644 GTGGGGCCAGGCCCTTCCTTGGG + Intronic
1009555224 6:65155337-65155359 GGGTGGCAAAGCTCTTGGTGTGG - Intronic
1016769869 6:147837283-147837305 GTGTGCCCAATCCTTAGCTGAGG - Intergenic
1018787711 6:167121242-167121264 GTGTGGCCACGCAGATGCTGAGG - Intergenic
1019120071 6:169795052-169795074 GTGTGGCCAAGTCGTAGCTGTGG + Intergenic
1020378444 7:7514777-7514799 GTGTGCTCATGCTCTTGCTGTGG - Intronic
1022040747 7:26579217-26579239 GTGTGGCCAGGAGCTAGCTGGGG + Intergenic
1023881230 7:44322826-44322848 CTGAGGCCAAGCCCTTCCTTTGG + Intronic
1025026531 7:55520952-55520974 GCGTGGCCCAGCCTCTGCTGCGG - Intronic
1032606182 7:133356409-133356431 GTTTCGCCAAGCCCTTAATGAGG - Exonic
1034257465 7:149732532-149732554 GCCTGGCCAAGCCTTTCCTGTGG + Intronic
1034274770 7:149819314-149819336 GTGTGCCCTGGCCCTGGCTGTGG + Intergenic
1035656644 8:1312920-1312942 GTGAGGCCAAGCCCTACGTGCGG + Intergenic
1036752071 8:11449671-11449693 GTGGGGACAAGCCCTTGGGGGGG + Intronic
1037903553 8:22702476-22702498 GTGTGACCAAGACCTTGAGGAGG + Intergenic
1038341858 8:26692907-26692929 CTGGGGCCAAGTCCTTGCAGTGG + Intergenic
1047346512 8:124033939-124033961 GTGCTGCTAGGCCCTTGCTGAGG - Intronic
1048715288 8:137261833-137261855 GTGTGGCCCACCATTTGCTGGGG + Intergenic
1051367288 9:16330028-16330050 GTGTGGTCAGGCCTTTGGTGTGG - Intergenic
1057077155 9:92143898-92143920 ATGTATCCCAGCCCTTGCTGAGG + Intergenic
1057268871 9:93636049-93636071 GTGAGGCCAAACCGTGGCTGAGG + Intronic
1057355945 9:94331693-94331715 GTGTGGCCCAGGACTTTCTGTGG - Intergenic
1057651811 9:96925936-96925958 GTGTGGCCCAGGACTTTCTGTGG + Intronic
1057897099 9:98917846-98917868 GTGTGGCCTGACCCTTGCTGGGG - Intergenic
1058703449 9:107619889-107619911 CTGTGGCCAAGCACTGGCTGTGG + Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1059534457 9:115068476-115068498 ATGTGACCATGCCCCTGCTGTGG - Intronic
1060877196 9:127091924-127091946 ATGTTCCCAAACCCTTGCTGGGG + Exonic
1061263589 9:129493185-129493207 GCTGGGCCAAGGCCTTGCTGTGG - Intergenic
1061324631 9:129856151-129856173 GTCTGGCGAAGGCCTTTCTGGGG + Intronic
1062374706 9:136256673-136256695 GTGTGGCCGTGCCCTTCCTGTGG - Intergenic
1062525455 9:136976418-136976440 CTGTGGCCCATCCCTTGCTGGGG - Intergenic
1062530536 9:136997570-136997592 GTGTGGCCAGGCCAATCCTGTGG - Intergenic
1203632754 Un_KI270750v1:83548-83570 GCGTGGCGCAGCCCTGGCTGAGG - Intergenic
1186788249 X:12973380-12973402 GTGAGGCCTAACCCTTTCTGAGG + Intergenic
1190059012 X:47199111-47199133 GTGGGGCCAAGGCCGGGCTGAGG + Intronic
1196016706 X:110947266-110947288 GTCTGGACAATACCTTGCTGTGG + Intronic
1196723766 X:118878078-118878100 GGGTGGCCAAGGTCATGCTGGGG + Intergenic
1199489988 X:148387485-148387507 CTGTGGCCACCCCTTTGCTGGGG - Intergenic
1200232081 X:154449098-154449120 GTGAGGCCCAGGCCTGGCTGAGG + Intronic
1201620739 Y:15954517-15954539 ATGTGGCCAAAACCTGGCTGGGG + Intergenic