ID: 1132840672

View in Genome Browser
Species Human (GRCh38)
Location 16:1977170-1977192
Sequence CGCACCAGAGGCCACGCCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132840672_1132840683 26 Left 1132840672 16:1977170-1977192 CCACCGGCGTGGCCTCTGGTGCG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1132840683 16:1977219-1977241 CTGGCCACGGCCTCAGCTGATGG 0: 1
1: 0
2: 0
3: 16
4: 205
1132840672_1132840681 13 Left 1132840672 16:1977170-1977192 CCACCGGCGTGGCCTCTGGTGCG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1132840681 16:1977206-1977228 CATGGACCAGGTGCTGGCCACGG 0: 1
1: 0
2: 3
3: 30
4: 353
1132840672_1132840675 -5 Left 1132840672 16:1977170-1977192 CCACCGGCGTGGCCTCTGGTGCG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1132840675 16:1977188-1977210 GTGCGTCCAGTTCTCTCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 97
1132840672_1132840677 1 Left 1132840672 16:1977170-1977192 CCACCGGCGTGGCCTCTGGTGCG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1132840677 16:1977194-1977216 CCAGTTCTCTCCCATGGACCAGG 0: 1
1: 0
2: 0
3: 14
4: 167
1132840672_1132840678 7 Left 1132840672 16:1977170-1977192 CCACCGGCGTGGCCTCTGGTGCG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1132840678 16:1977200-1977222 CTCTCCCATGGACCAGGTGCTGG 0: 1
1: 0
2: 3
3: 18
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132840672 Original CRISPR CGCACCAGAGGCCACGCCGG TGG (reversed) Exonic