HTGT WGE

Individual CRISPR Summary

ID: 1132841151

 View in Genome Browser
Species Human (GRCh38)
Location 16:1979081-1979103
Sequence AGTCCACGCACCCTCGAGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132841142_1132841151 26 Left 1132841142 16:1979032-1979054 CCTCATCGGGATCCTCGCGCTCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1132841151 16:1979081-1979103 AGTCCACGCACCCTCGAGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 58
1132841140_1132841151 28 Left 1132841140 16:1979030-1979052 CCCCTCATCGGGATCCTCGCGCT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1132841151 16:1979081-1979103 AGTCCACGCACCCTCGAGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 58
1132841143_1132841151 14 Left 1132841143 16:1979044-1979066 CCTCGCGCTCACTGCTCCGTCGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1132841151 16:1979081-1979103 AGTCCACGCACCCTCGAGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 58
1132841141_1132841151 27 Left 1132841141 16:1979031-1979053 CCCTCATCGGGATCCTCGCGCTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1132841151 16:1979081-1979103 AGTCCACGCACCCTCGAGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 58
1132841148_1132841151 -2 Left 1132841148 16:1979060-1979082 CCGTCGTGGGGTGCGGCACAGAG 0: 1
1: 0
2: 1
3: 15
4: 111
Right 1132841151 16:1979081-1979103 AGTCCACGCACCCTCGAGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132841151 Original CRISPR AGTCCACGCACCCTCGAGGG CGG Exonic