ID: 1132841153

View in Genome Browser
Species Human (GRCh38)
Location 16:1979087-1979109
Sequence CGCACCCTCGAGGGCGGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132841143_1132841153 20 Left 1132841143 16:1979044-1979066 CCTCGCGCTCACTGCTCCGTCGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1132841153 16:1979087-1979109 CGCACCCTCGAGGGCGGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 128
1132841148_1132841153 4 Left 1132841148 16:1979060-1979082 CCGTCGTGGGGTGCGGCACAGAG 0: 1
1: 0
2: 1
3: 15
4: 111
Right 1132841153 16:1979087-1979109 CGCACCCTCGAGGGCGGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132841153 Original CRISPR CGCACCCTCGAGGGCGGCCC TGG Exonic