ID: 1132841156

View in Genome Browser
Species Human (GRCh38)
Location 16:1979095-1979117
Sequence CGAGGGCGGCCCTGGCGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132841143_1132841156 28 Left 1132841143 16:1979044-1979066 CCTCGCGCTCACTGCTCCGTCGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1132841156 16:1979095-1979117 CGAGGGCGGCCCTGGCGCCGTGG 0: 1
1: 0
2: 2
3: 32
4: 277
1132841148_1132841156 12 Left 1132841148 16:1979060-1979082 CCGTCGTGGGGTGCGGCACAGAG 0: 1
1: 0
2: 1
3: 15
4: 111
Right 1132841156 16:1979095-1979117 CGAGGGCGGCCCTGGCGCCGTGG 0: 1
1: 0
2: 2
3: 32
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132841156 Original CRISPR CGAGGGCGGCCCTGGCGCCG TGG Exonic
900245507 1:1634368-1634390 CGCGGGCGGCCTTGGGGCAGGGG + Intronic
900256738 1:1701527-1701549 CGCGGGCGGCCTTGGGGCAGGGG + Intronic
900392400 1:2439365-2439387 CGGGGGCAGCCCTGGGGTCGGGG - Intronic
900473263 1:2864683-2864705 GGAGGGCGGAGCTGGCGTCGGGG + Intergenic
900494459 1:2970221-2970243 GGAGGGCGGCCCTGGGCGCGGGG + Intergenic
901249241 1:7761306-7761328 TGAGGGCAGCACTGGCGCTGTGG + Intronic
901641262 1:10694256-10694278 CGGGGGAGGCCCGGGGGCCGCGG - Intronic
902044322 1:13513698-13513720 AGAGGGCGGCCCGGGCGGGGAGG + Exonic
902072187 1:13749516-13749538 CCTGGGCGGGCGTGGCGCCGGGG - Intronic
902332205 1:15736165-15736187 CGAGGGCGGGCCTGGACCCTGGG - Intergenic
902451365 1:16498937-16498959 CGAGGCCTGCCCGGGCGCAGAGG - Intergenic
902921001 1:19665794-19665816 CGACGGCGGCCCTGCCCCCCAGG - Exonic
903044289 1:20553887-20553909 CGCGGGCGGCGGGGGCGCCGGGG - Exonic
903573415 1:24322583-24322605 CGGCGGCGGCCCGGGCGGCGCGG + Intronic
905173988 1:36125093-36125115 CGAGGGCGGCCCGGGCGGCGAGG + Exonic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
910839323 1:91546468-91546490 CGGGGGCGGCCCTGGGGCCTCGG + Intergenic
912659531 1:111515664-111515686 CTGAGGGGGCCCTGGCGCCGGGG + Intronic
914489996 1:148146119-148146141 GGAGCGCGGCCCTGGGGCCCGGG + Intronic
914803024 1:150974367-150974389 GGCCGGCGGGCCTGGCGCCGCGG - Intronic
915550720 1:156632066-156632088 CGAAGGTGGGCCTGGCGCAGCGG - Intergenic
915562867 1:156697575-156697597 AGTGGGAGGCCCTGGCCCCGGGG + Intergenic
915934784 1:160084076-160084098 CGCTGGCGGCCGCGGCGCCGCGG - Exonic
916365137 1:164017737-164017759 TGAGGGTGGCCCTGGTGCCTTGG - Intergenic
918480640 1:184974015-184974037 CGGGGGCGGCACTGACCCCGAGG + Intronic
921390542 1:214609095-214609117 GGAGTGCGGCCCTGGGGCCCAGG - Intronic
923782949 1:237042267-237042289 GGAGGGCGGCCCGGGCCCGGAGG - Exonic
924052389 1:240092160-240092182 CGAAGGCGGCGGTGGCGCCGAGG + Exonic
924732415 1:246724260-246724282 TGGGCGCGGCCCTGGCGCGGCGG + Exonic
1063576896 10:7270250-7270272 AGAGGGCGGCCCTGGCTTCTGGG - Intronic
1064208881 10:13347525-13347547 CGCGTGCGGCCCAGGAGCCGGGG + Intronic
1066126576 10:32347607-32347629 TGGGGGCGGCCGTGGCCCCGGGG - Intronic
1073076863 10:100829722-100829744 CGAGGGCGGCGAGGGCGCCGAGG + Exonic
1074056055 10:109923569-109923591 CGTGGCGGGCGCTGGCGCCGCGG + Intergenic
1074867161 10:117551694-117551716 CGCGGGCTGCCGTGGCGCTGAGG + Intergenic
1075671131 10:124264854-124264876 GGAGGGTGGCCCTGGTGTCGAGG - Intergenic
1075699763 10:124461804-124461826 CGACGCCGGCGCCGGCGCCGCGG - Intergenic
1077008542 11:370033-370055 CGCGGGCGGCGCGGGCGGCGGGG + Intronic
1080037294 11:27722637-27722659 CGGGGGCTGCCCCGCCGCCGGGG + Intergenic
1081528504 11:43942834-43942856 CGAGGGCGGCCGCTGCGCCGGGG - Exonic
1083811273 11:65108197-65108219 GGAGGGCGGCTCAGGCGCCCCGG + Exonic
1084003660 11:66312352-66312374 CGTGGGCGGCCCCGGGGGCGGGG + Intergenic
1084524249 11:69686036-69686058 CGGGGGCCGCCATTGCGCCGCGG + Intergenic
1084669189 11:70595282-70595304 GGAGGGTGGCACTGGCACCGGGG - Intronic
1085621494 11:78041169-78041191 CCAGGGCGGCACTGGCGCAGTGG + Intronic
1087117830 11:94543924-94543946 GGAAGGCGGACCCGGCGCCGCGG - Exonic
1091550112 12:1530477-1530499 GGAGGGAGGCCCTGGGCCCGAGG - Intronic
1094155456 12:27333172-27333194 CGGGGGCAGACCTGGCGTCGCGG - Intronic
1096215312 12:49795135-49795157 GGAGCGAGCCCCTGGCGCCGAGG - Exonic
1098161438 12:67649959-67649981 CGCGGGCGGCCCGGGCGGTGGGG + Intronic
1100963102 12:99984843-99984865 CGAGGGCGGCGGCGGCGGCGAGG + Intergenic
1103322295 12:120099253-120099275 TGAGGGTGGCCCTGGAGCCTGGG + Intronic
1103781015 12:123398950-123398972 CCAGGGCGGGCCTAGCGCCAGGG + Intronic
1104448993 12:128854040-128854062 CGAGGGCAGGGCTGGCACCGCGG - Intronic
1104912760 12:132247634-132247656 CGAGTGCGGCCATGGCGTCTGGG - Intronic
1106109086 13:26760928-26760950 CGAGGGCGGCCCAGGGGCGCGGG + Intergenic
1106517110 13:30465247-30465269 CGAGGGCGGCGCGGGGGCCTGGG - Intronic
1106760051 13:32859201-32859223 GGAGGGTGCCCCTGGCACCGTGG + Intergenic
1107467805 13:40665817-40665839 CGACAGCGGCCCGGGCGGCGGGG + Exonic
1107695099 13:42992176-42992198 CGACGGCGGCCCGGGACCCGCGG - Exonic
1110630107 13:77697882-77697904 CGAGGGCGCCGCGGCCGCCGGGG - Intronic
1110705975 13:78602263-78602285 CGCGGGCGGCGCGGGCGCGGCGG - Exonic
1113200992 13:107867327-107867349 CGCGGGCGGCCCTGCGGCAGCGG - Intergenic
1113822115 13:113222053-113222075 CGTGGGCAGCCCTGGCGCTGAGG + Intronic
1114483321 14:23048286-23048308 CGCGGGAGGGCCGGGCGCCGGGG + Exonic
1114521981 14:23345373-23345395 AGAGGGAGGCCCTGGCACTGAGG + Intergenic
1118019481 14:61695899-61695921 CGAGGCCGGCCCAGGAGCCCAGG - Intronic
1119539259 14:75428096-75428118 CGGCGGCGGGGCTGGCGCCGCGG + Intronic
1119601918 14:75982346-75982368 CGCGGGCGGCCCCGGGACCGGGG - Intronic
1121255692 14:92528624-92528646 CAAGGGCAGACCTGGCGCTGGGG - Intronic
1121415868 14:93779078-93779100 CGAGGGCAGCCCTGCCTCCTTGG - Intronic
1122081806 14:99272039-99272061 CCAGCGCTCCCCTGGCGCCGCGG + Intergenic
1122316246 14:100827478-100827500 CGGGGTCGGCCTTTGCGCCGTGG + Intergenic
1122857582 14:104567285-104567307 CCAGGGCAGCCCTGGCTCCCAGG - Intronic
1122924441 14:104893158-104893180 CGAGGGTGGCTCTGGCACAGGGG - Intronic
1122937151 14:104965565-104965587 GGAGGGAGGCCCTGGAGCCCAGG - Intronic
1122947721 14:105020824-105020846 GGAGGGCGGCGAGGGCGCCGCGG + Intronic
1122993298 14:105248980-105249002 CGGCGGCGGCGCTGGCGCGGGGG - Exonic
1125677846 15:41512049-41512071 CGAGGGCTGCCTGGGGGCCGGGG - Intronic
1128067775 15:64775357-64775379 CGAGCGCGGCGCCGGCCCCGCGG + Exonic
1128309691 15:66622356-66622378 CCACGGCGGCCCTGGCCCGGCGG - Intronic
1128309763 15:66622531-66622553 AGGGGGCCGCCCTGGCGCGGGGG - Intronic
1128743945 15:70100753-70100775 CGGGCTCGGCCCTGGCGCTGGGG - Intergenic
1129332786 15:74836401-74836423 CTAGGCCTGCCCTGCCGCCGTGG - Exonic
1129394648 15:75237303-75237325 CCAGGGAGGCCCTGGCCCAGGGG - Intergenic
1129983616 15:79897017-79897039 CGAGGGCGCCCAGGGCGCCGAGG - Exonic
1131367552 15:91853394-91853416 GGAGGGCGGCCCGGCGGCCGAGG - Intergenic
1131467395 15:92666883-92666905 AGAGGGCGGCCCTGGGGACACGG - Intronic
1131827453 15:96332282-96332304 CCAGGGCGGCCCTGGCGGCCCGG + Exonic
1132499904 16:280655-280677 GGCGCGCGGCCCGGGCGCCGCGG - Exonic
1132527868 16:426320-426342 GGAGCGCGGCCCTGGGCCCGGGG - Exonic
1132588145 16:715116-715138 CCAAGGCGGCCCCGGCGCTGGGG + Exonic
1132728997 16:1351548-1351570 CGAGGGCGGCCCGGGCCCGGCGG - Exonic
1132828929 16:1918269-1918291 CGGGGGCGGCCAGGGCGCAGGGG - Exonic
1132841156 16:1979095-1979117 CGAGGGCGGCCCTGGCGCCGTGG + Exonic
1132934513 16:2473946-2473968 GGGGGGCGGGCCTGGAGCCGCGG + Exonic
1133332934 16:4987706-4987728 GGTGGGCGGCCCTGGGGCTGGGG + Exonic
1138478292 16:57284721-57284743 AGGGGGCGGCCCCGGCGGCGGGG - Intergenic
1138594907 16:58024820-58024842 CAAGGGCAGCCCTGGCGCGGCGG - Intergenic
1139504947 16:67394069-67394091 CGACGGCAGCCCTGCTGCCGGGG + Intergenic
1141665292 16:85462677-85462699 GGAGGGCGGCGGGGGCGCCGCGG + Intergenic
1142136400 16:88453731-88453753 CGGGGGCGGCGCTGGCGGCTGGG - Intronic
1142187438 16:88701228-88701250 CTTGGGCCGCCCTGGAGCCGGGG - Intronic
1142276176 16:89120031-89120053 GGAGTGCGGCCCTGGCGATGTGG - Intronic
1143016429 17:3893232-3893254 CGAGGTCGGCCCCGCCGCAGGGG - Intronic
1143223751 17:5282675-5282697 CGAGGGCGGCGCGGGCGCCCCGG + Intronic
1143634554 17:8156876-8156898 CTAGGGCGCCTCTGGCGCTGGGG + Intronic
1143979250 17:10854138-10854160 CAAGTGCTGCCCTGGAGCCGTGG + Intergenic
1144831909 17:18136551-18136573 CGATGGCGTCCCTGGAGCAGAGG - Exonic
1145190602 17:20840770-20840792 GGAGCGCGGCCCTGGGGCCCGGG + Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146053302 17:29568650-29568672 CGCGGGCGGCGCGGGCGGCGCGG + Exonic
1147189379 17:38730085-38730107 CGGGGGTGCCCCAGGCGCCGAGG + Intergenic
1148090256 17:45019085-45019107 CGAGGGCGGCGAGGGCGGCGCGG + Intergenic
1148090259 17:45019094-45019116 CGAGGGCGGCGCGGGCGGCCCGG + Intergenic
1148156890 17:45429818-45429840 CGCGGGCCGCACGGGCGCCGCGG + Intronic
1148664056 17:49361808-49361830 CGGGGCCGGCCCGGGCTCCGGGG - Intronic
1150388594 17:64778592-64778614 CGCGGGCCGCACGGGCGCCGTGG + Intergenic
1151555213 17:74843173-74843195 CAGGGGCGGCCCCGGCGTCGGGG + Exonic
1151780146 17:76240269-76240291 GGAGGGCGGCGCGGGCACCGGGG - Exonic
1151802343 17:76385598-76385620 CCAGGGGGTCCCTGGCGCTGTGG - Exonic
1151876431 17:76870036-76870058 CGAGTCCGGCCCCCGCGCCGGGG - Intronic
1152586403 17:81191380-81191402 TGAGGCTGGCCCTGGCCCCGCGG - Intronic
1152602639 17:81272485-81272507 GGAGGGCTGCCCTGTTGCCGGGG - Intronic
1152927134 17:83092479-83092501 TGAGGGTGGTCCCGGCGCCGTGG + Intronic
1152932844 17:83119123-83119145 GGAGGGCGGTCCTGCTGCCGAGG - Intergenic
1153480455 18:5542996-5543018 CGAAGGCGGCTCTGCCGCGGTGG - Intronic
1153997598 18:10455077-10455099 CGGAGGCAGCCCGGGCGCCGCGG + Intronic
1154139585 18:11811200-11811222 GGAGGGCTGCGCTGGGGCCGTGG - Intronic
1154202242 18:12307936-12307958 CGAGTCGGGCCCTGGCGTCGGGG - Intronic
1160024934 18:75209236-75209258 CGGGGGCTGCGCCGGCGCCGGGG - Exonic
1160025064 18:75209651-75209673 CGAGCGCGGCCCGGGCGGCGGGG + Intergenic
1160454798 18:78992828-78992850 CGAAGGCGGCCGGGGCGGCGGGG - Exonic
1160719161 19:589995-590017 CGGCGGCGGCCCCGGCGCGGGGG - Exonic
1160738739 19:676431-676453 CCAGAGTGGCCCTGGCGCCCCGG - Exonic
1160765656 19:806427-806449 CCAGGGGGGCCAGGGCGCCGTGG - Exonic
1160807885 19:1000610-1000632 CCCGGGCCGCCCTGGCGCCGCGG + Exonic
1160863835 19:1248812-1248834 CCAGGGCGGCGCTGGCTGCGCGG - Intronic
1160909221 19:1467207-1467229 CGAGCGCGGCGGGGGCGCCGGGG + Exonic
1160996713 19:1885368-1885390 GGAGCGCGGCCCTGGGGCCCGGG - Exonic
1161006811 19:1941256-1941278 GGAGGCCGGCCCAGGCGGCGCGG + Exonic
1161108769 19:2456905-2456927 CGACGGCGGCCCGGGCTCGGCGG + Exonic
1161252166 19:3286046-3286068 AGAGGGCGGGGCTGGCGCCCAGG - Intronic
1161393991 19:4035106-4035128 CTGGGGCGGCCCTGGCACGGTGG + Intronic
1161560291 19:4969273-4969295 CGGGGGCGGCCATGGCGGCGGGG - Intronic
1161699427 19:5786829-5786851 CGAGAGCGGCCGTGGAGCTGGGG + Exonic
1161802708 19:6424709-6424731 CGGGGCCGGGCCTGGCGCGGAGG + Exonic
1161808828 19:6459860-6459882 CGAGGGCGGAGCTGGGGGCGTGG + Intronic
1162028559 19:7907681-7907703 CGAGGGTGGCCCCGGAGCCTGGG - Intronic
1162490138 19:10986819-10986841 CGTGGGCAGCCCTGGCTCCAGGG - Intronic
1162731746 19:12722378-12722400 CGCGCGCGGCCCGGGCGTCGGGG - Intronic
1163243158 19:16076556-16076578 TGAGGCCGGCCATGGCGCGGAGG - Intronic
1163282394 19:16325587-16325609 CGAGGGCGCCCCGGGCCCGGCGG + Exonic
1163443755 19:17334643-17334665 CGAGGCCGCCTCCGGCGCCGGGG - Exonic
1163573563 19:18097759-18097781 CGGGGGCGGGCCTGGCGGCGCGG + Intronic
1163708627 19:18832383-18832405 CGCGGGAGGCCCGGGCGGCGCGG + Exonic
1165114897 19:33522819-33522841 GGAGGGCGTCCCTGGCGCCAAGG + Intergenic
1166118040 19:40667631-40667653 CGAGGGCGGGCCTGGCTCCCAGG + Exonic
1166316475 19:41992464-41992486 GGAGGCCGGCCCAGGCGCAGAGG - Intronic
1167134433 19:47608681-47608703 CGGGGGCGGCGCCGGCGCGGAGG + Intronic
1167149758 19:47701914-47701936 CGTGGGGGGCCCTGGCGCGCCGG + Exonic
1167264676 19:48477764-48477786 AGGGGGCTGCCCTGGCGCCCTGG + Intronic
1167350204 19:48969561-48969583 CGAGGGCGACGGTGGCACCGAGG + Exonic
1167463854 19:49640046-49640068 CGGGGGCGGCCCCGGGGCGGGGG - Exonic
1167532280 19:50025486-50025508 AGAGGGCGGGCCTGCCGCGGAGG - Exonic
1168140742 19:54385132-54385154 AGAGGGTGAACCTGGCGCCGTGG - Intergenic
1168157660 19:54485256-54485278 AGAGGGTGAACCTGGCGCCGTGG + Intergenic
1168694434 19:58396621-58396643 AGCGGGCGGCCCAGGCGCAGAGG - Exonic
925959716 2:9003622-9003644 CGCGGGCGGCCGGAGCGCCGAGG - Exonic
926171537 2:10555855-10555877 CGAGCGGGGCCCTGGCGGGGAGG + Intergenic
927156544 2:20224447-20224469 CGACGGGGGCCCGGCCGCCGCGG + Intronic
927571469 2:24164507-24164529 AGAGGGCTGCCCTGGCCCCCTGG + Intronic
927646397 2:24879757-24879779 GGAGGGGAGCCCTGGCCCCGGGG - Intronic
927811772 2:26184439-26184461 CGCGGGAGGCACTGGCGGCGGGG + Exonic
929983017 2:46698990-46699012 CGGGGGCGGCCCGGGAGTCGGGG - Exonic
930096461 2:47570346-47570368 CGAGCGCCGCCCCGGCCCCGGGG - Exonic
930730697 2:54725009-54725031 CGAGGACGGCCCCGGCGCGCGGG + Exonic
932058214 2:68467772-68467794 CCCGGGTGGCCCTGGCGCCCGGG + Exonic
933698567 2:85238100-85238122 CCAGAGCAGCCCTGGCGCAGTGG + Intronic
935972760 2:108546432-108546454 GGAGGGCGGCCCAGGCACCGTGG - Intronic
936278722 2:111120772-111120794 CGCCGGCGGCCGCGGCGCCGAGG + Intronic
940453884 2:153872465-153872487 CGCGGGCGGACCTGGCGACGCGG + Intronic
940883188 2:158967980-158968002 CCCGGGCGTCCCTGGGGCCGCGG - Intergenic
941962089 2:171263531-171263553 GGATGGCAGCCCTGGCGCCAGGG - Intergenic
945492837 2:210476469-210476491 CGAGGGCGGCGGCGGCGCCCAGG + Exonic
946358812 2:219206801-219206823 CGAGGGAGGAGCGGGCGCCGGGG + Exonic
947549778 2:231037822-231037844 CGAGGGCGGCTGGGGCGGCGGGG + Exonic
947741278 2:232486128-232486150 CGGGGGTGGGCCTGGCGGCGCGG - Exonic
947766783 2:232642984-232643006 CAAGGGTGGCCCTGGGGCAGTGG + Intronic
948407965 2:237736985-237737007 CCAGAGCGGCCCCGGCGCCCAGG + Intronic
948449635 2:238061056-238061078 TGGAGGCGGCCGTGGCGCCGGGG + Exonic
948467446 2:238159093-238159115 CGAGGGCGCCCCAGGCTCCGGGG - Exonic
948587320 2:239027590-239027612 CCAGGGCGAGCATGGCGCCGGGG + Intergenic
1168777748 20:462278-462300 CGAGGGCGGCCCGGGGGGCAGGG - Intronic
1168800848 20:642472-642494 CGAGGGCGGCCCTCGGGCTCTGG + Intergenic
1169118669 20:3082946-3082968 CGGGGGCGGGCCTGGGGCTGGGG - Intronic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1171398696 20:24857719-24857741 CGAGGGAGGCCCTGCAGCCCTGG + Intergenic
1172193550 20:33076837-33076859 TTAGGGCAGCCCTGGCGCCGGGG - Intergenic
1172771334 20:37384294-37384316 CGAAGGCCGCGCTGGGGCCGCGG - Exonic
1175369676 20:58479804-58479826 CGATGGTGGCCCTGGCTGCGTGG + Intronic
1175939262 20:62530437-62530459 AGAGGGAGGCCCTGGGGCCTGGG - Intergenic
1176550048 21:8217074-8217096 CGAGGGGGGCCCGGGCACCCGGG + Intergenic
1176568975 21:8400109-8400131 CGAGGGGGGCCCGGGCACCCGGG + Intergenic
1176576889 21:8444344-8444366 CGAGGGGGGCCCGGGCACCCGGG + Intergenic
1179891650 21:44338712-44338734 CGAGGGCGGCGAAGGAGCCGCGG - Intronic
1180099843 21:45579235-45579257 CGTGGGCGGCCCTGGGACGGGGG + Intergenic
1181057846 22:20268296-20268318 CGAGGGCGGCGGCGGCGCGGGGG + Exonic
1181121681 22:20671220-20671242 GGAGCGCGGCCCTGGGGCCCGGG - Intergenic
1181334649 22:22118260-22118282 GGAGCGCGGCCCTGGGGCCCGGG - Intergenic
1183489656 22:38109629-38109651 CGAGAGCTGCCCTTGCCCCGGGG - Intronic
1183628207 22:39017667-39017689 AGAGGGCGGGCCTGGAGCCCCGG - Intronic
1184247420 22:43242621-43242643 GGAGGGCGGCTCAGGCGCCTGGG + Intronic
1184768731 22:46586125-46586147 CGAGGGCAGCCCTGGCTCCCCGG - Intronic
1184783111 22:46658838-46658860 CCAGGGCGGCACTGGCGCCCAGG - Intronic
1185283130 22:49984046-49984068 TGGGAGCGGCCCTGGCCCCGCGG - Intergenic
1203254938 22_KI270733v1_random:133400-133422 CGAGGGGGGCCCGGGCACCCGGG + Intergenic
1203262994 22_KI270733v1_random:178479-178501 CGAGGGGGGCCCGGGCACCCGGG + Intergenic
949947319 3:9200978-9201000 CGAGGGAGGCCCTGGAGCAGAGG + Intronic
950215230 3:11154328-11154350 CGGGGGCGGCCCTGGGCGCGTGG + Intronic
950940390 3:16885102-16885124 TCAGGGCGCCCTTGGCGCCGAGG - Intronic
951898401 3:27632966-27632988 TGAGGCCGGCCATGGCGCGGAGG - Intergenic
954117213 3:48473485-48473507 AGAGGGCGACCCTGGGGCCCTGG + Intronic
961067004 3:123884214-123884236 CGAAGGCGGCCCGGGAGCCGGGG + Intronic
961212636 3:125137650-125137672 CAAGGGCGGCCCTGACACAGGGG + Intronic
967448065 3:189590394-189590416 CTAGGGCGGGCCTGGAGCTGCGG - Intergenic
968148338 3:196318234-196318256 GGAGGGCGGCCCTGTTGCCCTGG - Exonic
968178168 3:196568983-196569005 CGATGGCGGCGCCGGCCCCGGGG + Exonic
968230780 3:197003426-197003448 CAGGGGCGCCCCGGGCGCCGGGG + Exonic
968426525 4:527128-527150 CCAAGGCTGCCCTGGCGCTGGGG + Exonic
968575889 4:1365979-1366001 CGAGGGCGGCGGTGCCCCCGGGG - Intronic
968914007 4:3489310-3489332 CGAGGCCGGCCCTGGGGATGGGG + Intronic
969295892 4:6270396-6270418 CGAGGGCGGCCGTGGGTCCCGGG - Intronic
969651183 4:8469259-8469281 CGAGAGTGGCCCTGGCTCAGTGG + Intronic
969715743 4:8867406-8867428 GGGGGGTGGCCGTGGCGCCGGGG + Exonic
970456108 4:16226184-16226206 CGAGGGCGGCGGGGGCGCCTTGG - Intronic
974754601 4:66187119-66187141 CAAGGGCTGCCCTGGCACTGGGG + Intergenic
976389274 4:84492951-84492973 CGAGGGGGACCCGGGCGCTGAGG + Exonic
985478374 5:92255-92277 CGGGGGCGGCCCAGGCGCCCGGG + Intergenic
985537981 5:475173-475195 CGAGGTCTCCCCTGCCGCCGTGG - Intronic
990308696 5:54518156-54518178 AGACGGCGGCCCGGGCGCCCCGG + Exonic
992663610 5:78984903-78984925 CGGGGGCGGCGCGGGCGGCGGGG + Intronic
999699038 5:154211227-154211249 GGAGGGTGGCCCTGGGGCTGGGG + Intronic
1001525198 5:172423928-172423950 CCAGGGCGGGCCGGGCGCGGTGG - Intronic
1002021244 5:176365669-176365691 CGAGAGCGGCGCTGGGACCGGGG + Exonic
1002929574 6:1624140-1624162 GGAGGGCGGGCCGGGCTCCGAGG + Exonic
1003175661 6:3751107-3751129 CGAGGGGTGCCCGGGCGGCGGGG - Intronic
1003556025 6:7141113-7141135 CGAGGGGGCCCCTGCGGCCGTGG - Intronic
1004044458 6:12011805-12011827 CGCGGGACGCCCAGGCGCCGGGG - Intronic
1006424315 6:33954705-33954727 AGAGGGAGGCCATGGCGCTGGGG - Intergenic
1006677808 6:35776742-35776764 AGAGGGTGGCCCCGCCGCCGGGG + Intronic
1010489043 6:76452490-76452512 CTAGGCCAGCCCTGGAGCCGCGG - Intergenic
1013009576 6:106107146-106107168 CAAGGGCAGCCCAGGCGCCGGGG - Exonic
1014079519 6:117270790-117270812 AGGGGGCGGCCTGGGCGCCGAGG - Exonic
1014844461 6:126258313-126258335 AGACGGCGGCCCTGGCCCCAGGG - Intergenic
1015149334 6:130020207-130020229 CGCGGGCCGTCCTCGCGCCGCGG + Intronic
1017470394 6:154733230-154733252 CGCGGGCGGCCCCGGAGCCAAGG + Intergenic
1017470666 6:154734123-154734145 GGAGGGCCGCCCTGGGGCGGAGG + Intronic
1018613009 6:165662046-165662068 CGAGGGCGAAGCTGGCGCCCTGG + Exonic
1019711475 7:2520007-2520029 CGGGGGCTGCCCCGGCGCCCGGG + Exonic
1020274366 7:6615684-6615706 CGGGGGCGGGGCGGGCGCCGCGG - Exonic
1023016318 7:35971513-35971535 CGTTGGCGGCCCTGGCCCCCGGG - Intergenic
1023866437 7:44240591-44240613 CGAGGGCAGGCCTGCCGCAGAGG + Intronic
1023899938 7:44467887-44467909 TGAGGGCGGCCATGATGCCGAGG - Intronic
1025207898 7:57004021-57004043 CGCCGGGGGCCGTGGCGCCGGGG + Intergenic
1026025373 7:66740408-66740430 GGAGGGCGACGCTGGCTCCGCGG - Intronic
1026776689 7:73235134-73235156 CGAGGGCGCCCCTGCCCCCAGGG - Intergenic
1027017541 7:74788504-74788526 CGAGGGCGCCCCTGCCCCCAGGG - Intronic
1027070482 7:75157428-75157450 CGAGGGCGCCCCTGCCCCCAGGG + Intergenic
1029615697 7:101655834-101655856 AGAGGGAGGGCCAGGCGCCGTGG - Intergenic
1029849329 7:103446066-103446088 CGCGGGCGGCCGCGGGGCCGGGG - Intronic
1030018091 7:105244616-105244638 CAAAGGCGGCCCTGGCGCGCTGG - Intronic
1030292151 7:107883493-107883515 TGAGGGCGGGCCGGGCGCGGTGG + Intergenic
1033299973 7:140176830-140176852 CGGGGGCGGCGGAGGCGCCGAGG + Exonic
1033989075 7:147262515-147262537 GGAGGCCGGGCCTGGCGCGGTGG + Intronic
1034414717 7:150958392-150958414 CGCGGGCGCCCCGGGGGCCGTGG - Exonic
1034414721 7:150958401-150958423 CGCGGGCGGCGCGGGCGCCCCGG - Exonic
1034471157 7:151255059-151255081 CGAGGGCTCCCCTGGCCCCGTGG - Intronic
1034781839 7:153888129-153888151 CGAGGCCGGCGCGGGCGCCAGGG - Intronic
1035385775 7:158471839-158471861 TGAGAGGGGCCCTGGGGCCGGGG - Intronic
1035621319 8:1037368-1037390 CGAGGGAAGCCCTGGGCCCGAGG - Intergenic
1035675003 8:1450153-1450175 GGTGGGCGGCCCTGGTGCCTCGG + Intergenic
1037567523 8:20130253-20130275 AGAGGGTGGCCCTGGGGCCACGG - Intergenic
1038883612 8:31640103-31640125 GGACCGCGGCCCTGGCGCCGGGG + Intronic
1039502960 8:38031291-38031313 CGGGGGGGACCCTGGCGCCACGG + Intronic
1039595450 8:38787122-38787144 CGGGGGCGGCGGCGGCGCCGGGG - Intronic
1040474573 8:47764755-47764777 CGTGGGCGGCCCTGTCGCCGGGG - Intergenic
1041622535 8:59989893-59989915 CGAGGGCAGGCCTGGAGCCCGGG + Intergenic
1043463952 8:80486950-80486972 CGCGGGCGGCGCTGGCGGCGGGG - Exonic
1044822016 8:96161106-96161128 CGAGGGGGACCCTGGCGCGGCGG - Intergenic
1045336061 8:101205401-101205423 CGGGGGCGGTGCTGACGCCGCGG - Intronic
1049100771 8:140577610-140577632 GGAGGGAGGCCATGGCGCTGGGG + Intronic
1049555313 8:143278652-143278674 AGAGGGCGACCCCGGCGCCCGGG + Intergenic
1049644132 8:143728515-143728537 CGTGGGCGTCCCTGGGGTCGGGG - Exonic
1054905860 9:70413372-70413394 CGACGGCAGCCCAGGCGGCGCGG + Exonic
1057596443 9:96418869-96418891 CGAGGGCGGGGCGGGCGGCGGGG - Intergenic
1061261470 9:129482906-129482928 CGGGGGAGGCCGTGGCCCCGAGG - Intergenic
1061365919 9:130172468-130172490 CCCGGGCGGTCCGGGCGCCGCGG - Intergenic
1061961673 9:133991971-133991993 CGGCGGCGGCCCAGGCGCCCTGG - Intronic
1061975994 9:134068209-134068231 CGAGAGCGGGCCTGGCCCGGGGG + Intronic
1062537590 9:137027725-137027747 CGAGGGAGGCCCTGGTTCCCAGG - Exonic
1062568358 9:137173124-137173146 CGAGGGGGTCCCTGGTGCCCAGG - Intergenic
1203471340 Un_GL000220v1:116546-116568 CGAGGGGGGCCCGGGCACCCGGG + Intergenic
1203479161 Un_GL000220v1:160518-160540 CGAGGGGGGCCCGGGCACCCGGG + Intergenic
1189302196 X:39960153-39960175 GGAGGGCGGCCCTGGCAGCAAGG - Intergenic
1189331013 X:40145287-40145309 CTGGGGCGGGCCGGGCGCCGCGG - Intronic
1190984467 X:55488620-55488642 CGAGGGCGGGGCTTGCGGCGCGG + Exonic
1192908933 X:75582733-75582755 TGAAGCCGGCGCTGGCGCCGCGG + Intergenic
1196828317 X:119758201-119758223 CGAGGGCGCCCCTTCCGCAGCGG - Intergenic
1200146340 X:153928179-153928201 GGAGGGCGCCGCGGGCGCCGTGG + Intronic
1200173646 X:154097301-154097323 CGCGGGCGCCCCTGTCGCCGGGG - Intronic
1200787550 Y:7273751-7273773 CGGGGGCGCCCCGGGCGCGGAGG + Intergenic