ID: 1132841156 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:1979095-1979117 |
Sequence | CGAGGGCGGCCCTGGCGCCG TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 312 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 32, 4: 277} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1132841143_1132841156 | 28 | Left | 1132841143 | 16:1979044-1979066 | CCTCGCGCTCACTGCTCCGTCGT | 0: 1 1: 0 2: 0 3: 1 4: 32 |
||
Right | 1132841156 | 16:1979095-1979117 | CGAGGGCGGCCCTGGCGCCGTGG | 0: 1 1: 0 2: 2 3: 32 4: 277 |
||||
1132841148_1132841156 | 12 | Left | 1132841148 | 16:1979060-1979082 | CCGTCGTGGGGTGCGGCACAGAG | 0: 1 1: 0 2: 1 3: 15 4: 111 |
||
Right | 1132841156 | 16:1979095-1979117 | CGAGGGCGGCCCTGGCGCCGTGG | 0: 1 1: 0 2: 2 3: 32 4: 277 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1132841156 | Original CRISPR | CGAGGGCGGCCCTGGCGCCG TGG | Exonic | ||