ID: 1132841157 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:1979096-1979118 |
| Sequence | GAGGGCGGCCCTGGCGCCGT GGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 181 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 168} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1132841148_1132841157 | 13 | Left | 1132841148 | 16:1979060-1979082 | CCGTCGTGGGGTGCGGCACAGAG | 0: 1 1: 0 2: 1 3: 15 4: 111 |
||
| Right | 1132841157 | 16:1979096-1979118 | GAGGGCGGCCCTGGCGCCGTGGG | 0: 1 1: 0 2: 0 3: 12 4: 168 |
||||
| 1132841143_1132841157 | 29 | Left | 1132841143 | 16:1979044-1979066 | CCTCGCGCTCACTGCTCCGTCGT | 0: 1 1: 0 2: 0 3: 1 4: 32 |
||
| Right | 1132841157 | 16:1979096-1979118 | GAGGGCGGCCCTGGCGCCGTGGG | 0: 1 1: 0 2: 0 3: 12 4: 168 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1132841157 | Original CRISPR | GAGGGCGGCCCTGGCGCCGT GGG | Exonic | ||