ID: 1132841160

View in Genome Browser
Species Human (GRCh38)
Location 16:1979108-1979130
Sequence GGCGCCGTGGGCGCCGCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 245}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132841148_1132841160 25 Left 1132841148 16:1979060-1979082 CCGTCGTGGGGTGCGGCACAGAG 0: 1
1: 0
2: 1
3: 15
4: 111
Right 1132841160 16:1979108-1979130 GGCGCCGTGGGCGCCGCTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 245
1132841152_1132841160 1 Left 1132841152 16:1979084-1979106 CCACGCACCCTCGAGGGCGGCCC 0: 1
1: 0
2: 3
3: 13
4: 144
Right 1132841160 16:1979108-1979130 GGCGCCGTGGGCGCCGCTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 245
1132841154_1132841160 -6 Left 1132841154 16:1979091-1979113 CCCTCGAGGGCGGCCCTGGCGCC 0: 1
1: 0
2: 2
3: 19
4: 153
Right 1132841160 16:1979108-1979130 GGCGCCGTGGGCGCCGCTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 245
1132841155_1132841160 -7 Left 1132841155 16:1979092-1979114 CCTCGAGGGCGGCCCTGGCGCCG 0: 1
1: 0
2: 3
3: 17
4: 187
Right 1132841160 16:1979108-1979130 GGCGCCGTGGGCGCCGCTCCAGG 0: 1
1: 0
2: 2
3: 25
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132841160 Original CRISPR GGCGCCGTGGGCGCCGCTCC AGG Exonic