ID: 1132842321

View in Genome Browser
Species Human (GRCh38)
Location 16:1984151-1984173
Sequence TGGCCTGGAGGCTGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 1, 2: 5, 3: 44, 4: 394}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132842309_1132842321 20 Left 1132842309 16:1984108-1984130 CCCGCGAGCACGGCGCGCGCCTC 0: 1
1: 0
2: 0
3: 18
4: 95
Right 1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG 0: 1
1: 1
2: 5
3: 44
4: 394
1132842313_1132842321 1 Left 1132842313 16:1984127-1984149 CCTCCGGCTCCTGTGGCCGCGCG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG 0: 1
1: 1
2: 5
3: 44
4: 394
1132842307_1132842321 22 Left 1132842307 16:1984106-1984128 CCCCCGCGAGCACGGCGCGCGCC 0: 1
1: 0
2: 0
3: 20
4: 145
Right 1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG 0: 1
1: 1
2: 5
3: 44
4: 394
1132842316_1132842321 -8 Left 1132842316 16:1984136-1984158 CCTGTGGCCGCGCGCTGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 173
Right 1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG 0: 1
1: 1
2: 5
3: 44
4: 394
1132842305_1132842321 27 Left 1132842305 16:1984101-1984123 CCCGGCCCCCGCGAGCACGGCGC 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG 0: 1
1: 1
2: 5
3: 44
4: 394
1132842310_1132842321 19 Left 1132842310 16:1984109-1984131 CCGCGAGCACGGCGCGCGCCTCC 0: 1
1: 0
2: 0
3: 23
4: 131
Right 1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG 0: 1
1: 1
2: 5
3: 44
4: 394
1132842308_1132842321 21 Left 1132842308 16:1984107-1984129 CCCCGCGAGCACGGCGCGCGCCT 0: 1
1: 0
2: 0
3: 17
4: 64
Right 1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG 0: 1
1: 1
2: 5
3: 44
4: 394
1132842306_1132842321 26 Left 1132842306 16:1984102-1984124 CCGGCCCCCGCGAGCACGGCGCG 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG 0: 1
1: 1
2: 5
3: 44
4: 394
1132842314_1132842321 -2 Left 1132842314 16:1984130-1984152 CCGGCTCCTGTGGCCGCGCGCTG 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG 0: 1
1: 1
2: 5
3: 44
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132842321 Original CRISPR TGGCCTGGAGGCTGACCTGG AGG Intronic
900515900 1:3082148-3082170 TGGGCAGGAGGCTGGCCCGGGGG + Intronic
900838891 1:5031153-5031175 TCCCCAGGAGGCTGACCTGGAGG - Intergenic
901659448 1:10789286-10789308 AGGCCTGGAGGCTGGGGTGGGGG - Intronic
902392787 1:16115955-16115977 TGACCTGGAGGCCCAGCTGGTGG + Intergenic
903418429 1:23200912-23200934 TGGCCTGGAGGTGGAGGTGGGGG - Intergenic
904032936 1:27544407-27544429 TGGGGTGGAGGCTGAACTGGAGG + Intronic
904326047 1:29727726-29727748 TGGAGTGGAGGCTGAGCTGAGGG + Intergenic
904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG + Intergenic
905268518 1:36771435-36771457 GGGCGTGGAGGCTGGCCTGCTGG - Intergenic
905824385 1:41017619-41017641 TGTCCTGCAGGCTCACCTTGAGG + Exonic
906436420 1:45800678-45800700 TGGGCCGGAGGCTGTCCTAGAGG + Intronic
906475773 1:46168497-46168519 AGGGCTGGAGGCAGCCCTGGGGG - Intronic
907159997 1:52362656-52362678 GGACCTGGAGGCTGAGCTGCTGG - Exonic
907334059 1:53688938-53688960 TGGCCCAGAGTCTGGCCTGGGGG - Intronic
907425589 1:54377265-54377287 GGGCCTGGAGGCAGACCTTGTGG - Intronic
907522482 1:55033314-55033336 TGGTGTGGGGGCAGACCTGGGGG - Intergenic
907522486 1:55033326-55033348 TGGGCTGGAGGCTGGTGTGGGGG - Intergenic
908499581 1:64729829-64729851 TTTCCTGGTGGCTTACCTGGTGG + Intergenic
909695630 1:78465382-78465404 TGTGCTGCAGGCTGAGCTGGGGG + Intronic
910846461 1:91609415-91609437 TGGCCTGGAGGCTGACCTACAGG - Intergenic
912449264 1:109759348-109759370 TGGCCTGGATGCTGTCTAGGCGG + Exonic
913201075 1:116495732-116495754 TGGCCTGAAGCCTGGGCTGGAGG - Intergenic
913257449 1:116966506-116966528 TGGCCAGGAGCCTGGCTTGGAGG + Intronic
913972353 1:143424350-143424372 TGGCCTGGGGGCTGACGGAGGGG + Intergenic
914066735 1:144249963-144249985 TGGCCTGGGGGCTGACGGAGGGG + Intergenic
914112418 1:144716391-144716413 TGGCCTGGGGGCTGACGGAGGGG - Intergenic
915118694 1:153615537-153615559 TGGCCTGGAGGCCGAGCAGGGGG - Intronic
915274005 1:154775627-154775649 TGGCTGAGAGGCTCACCTGGTGG + Intronic
915575233 1:156771425-156771447 TGGCCTGGATGATGAACTAGGGG + Intronic
916006608 1:160666996-160667018 TGGACTGGATCCTGACCTGGAGG - Intergenic
916206721 1:162322146-162322168 TGGCCTGGACATTGACCTGAGGG + Intronic
917798953 1:178552990-178553012 TGGTCAGGAGGCCGCCCTGGCGG - Intergenic
919640593 1:200040967-200040989 AGCCCCGGAGGCTGACCTGTGGG + Intronic
920044096 1:203122381-203122403 TGGCCTGGAGGAGGACTTTGTGG - Intronic
921225455 1:213015300-213015322 TGGTCTGGAGGCTGGGTTGGGGG + Intronic
921389439 1:214604045-214604067 TGTCCTTGAGCCTGACCTAGAGG + Intronic
921829609 1:219712046-219712068 AGGCCTGGAAACTGCCCTGGTGG - Intronic
922046715 1:221952201-221952223 TGTCCTGGATGCTGGTCTGGTGG - Intergenic
922157459 1:223051572-223051594 GGGCCTGGAAGCTGACTTGGGGG + Intergenic
922891569 1:229065932-229065954 TGGGCTGGAGGCTGGGCTGCAGG - Intergenic
1064006398 10:11702659-11702681 TGGCCAGGAGGGTCCCCTGGAGG + Intergenic
1064989862 10:21246722-21246744 TGCTCTGGAGGCTGAGCAGGAGG + Intergenic
1065390384 10:25175981-25176003 TGGCCTGGAGGAAGACCTGTGGG - Exonic
1067317173 10:45179979-45180001 TGGCTAGGAGGCTGACATAGAGG + Intergenic
1067752103 10:48978366-48978388 GGGCTTGGAGGCTGAGCCGGGGG - Exonic
1067809668 10:49417389-49417411 TGGCCTCAAGCCTGGCCTGGGGG - Intergenic
1069619440 10:69827576-69827598 TGATGTGGAGGCTGGCCTGGAGG + Intronic
1069720617 10:70547440-70547462 TGGGGTGGGGGCTCACCTGGCGG - Exonic
1069856275 10:71442886-71442908 TGGCCGGGAGGCAGGACTGGAGG + Intronic
1070804505 10:79263206-79263228 TGGCGTGGAGCCTGACCTCGTGG + Intronic
1072433943 10:95398491-95398513 TGTCCTGGAGGCTTGGCTGGCGG + Intronic
1074141824 10:110680130-110680152 TGTCATGCAGGCTGTCCTGGGGG + Intronic
1074411192 10:113230212-113230234 TGCCCAGAAGGATGACCTGGGGG - Intergenic
1075112236 10:119596724-119596746 TGGCCTGAGCGGTGACCTGGCGG - Intronic
1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG + Intronic
1076991786 11:279513-279535 CGGCCCGGAGCCTGCCCTGGAGG + Exonic
1077076145 11:703099-703121 CGGCCTGGAGGCCGTCCTGCAGG + Exonic
1077096687 11:801979-802001 TGACCTGGAGACCTACCTGGAGG - Exonic
1077121729 11:911828-911850 TGGCCTGAAGCCTGACCTTTGGG + Intronic
1077191945 11:1259292-1259314 TGCCTTGGTGGCTCACCTGGGGG - Intronic
1077329585 11:1978166-1978188 CTGCCTGGGGGCTGCCCTGGTGG - Intronic
1077555049 11:3221942-3221964 AGGCCTGGACGGTGACCTCGAGG - Intergenic
1077722056 11:4639149-4639171 GGGCCTGGAGCAGGACCTGGAGG + Intergenic
1078204545 11:9216760-9216782 TAGTCTGGAGGCTGAGGTGGAGG + Intronic
1079115544 11:17638485-17638507 TGGCCTGGGCACTGCCCTGGTGG + Exonic
1081787354 11:45756824-45756846 TGGCCTGGATGTGGCCCTGGGGG - Intergenic
1082847928 11:57741410-57741432 TGGCCTGGAGGCGGACCTTGGGG - Intronic
1083254173 11:61486260-61486282 TGGCCTGGAGGCAGAGTGGGTGG + Intronic
1083265635 11:61545690-61545712 TGACCTGGTGGCTGAGATGGGGG + Intronic
1083310722 11:61782290-61782312 TGCGCTGGGGGCTGCCCTGGGGG + Intronic
1083697929 11:64455119-64455141 TGGCCTGGAGGCTGCCCCGATGG - Intergenic
1084178642 11:67435969-67435991 TGGCCTGCAGGCTGACCCTGGGG - Exonic
1084284626 11:68122965-68122987 AGGCCTGGAAGTTGACCTGCAGG + Intergenic
1084381448 11:68815770-68815792 GGGCCTGGATGCTGGCTTGGAGG - Intronic
1084381466 11:68815835-68815857 GGGCCTGGATGCTGGCTTGGAGG - Intronic
1084381489 11:68815900-68815922 GGGCCTGGATGCTGGCTTGGAGG - Intronic
1084381511 11:68815965-68815987 GGGCCTGGATGCTGGCTTGGAGG - Intronic
1084381534 11:68816030-68816052 TGGCCTGGATGCTGGCTTGGAGG - Intronic
1084675254 11:70630294-70630316 TGGCCTGGTTCCTGTCCTGGGGG - Intronic
1088971069 11:114775195-114775217 CTGCCTGAAGGCGGACCTGGAGG - Intergenic
1089365461 11:117918521-117918543 TGTCACCGAGGCTGACCTGGCGG + Exonic
1089672985 11:120069288-120069310 TGGCCGGAATGCAGACCTGGTGG + Intergenic
1090151036 11:124384429-124384451 TGCCCTGGAGGTAGAACTGGTGG + Intergenic
1090606087 11:128424387-128424409 AGGCCTGGAGGCAGACAGGGAGG - Intergenic
1202812564 11_KI270721v1_random:33345-33367 CTGCCTGGGGGCTGCCCTGGTGG - Intergenic
1091399055 12:171797-171819 TGTCCTGAGGGCTGTCCTGGGGG + Intronic
1093079106 12:14788998-14789020 GGACCAGGAGGCAGACCTGGAGG + Exonic
1093079112 12:14789010-14789032 AGACCTGGAGGTGGACCTGGGGG + Exonic
1094053010 12:26240869-26240891 TGGACTGGCGCCTGACGTGGAGG - Intronic
1096435742 12:51590476-51590498 TGGCCTGGGGGCTGTCAGGGAGG + Intronic
1096514306 12:52147766-52147788 GGGCCTGGAGGGGGACCTGCAGG + Intergenic
1096589969 12:52651697-52651719 GGGCCTGGAGGATACCCTGGTGG - Exonic
1099232937 12:80049053-80049075 TTACCTGGAGGCTCAACTGGAGG + Intergenic
1099766283 12:86990099-86990121 TGGCCTGGAGGTTAAAGTGGAGG - Intergenic
1100638303 12:96457185-96457207 TAGTCTGGAGGCTGAAGTGGGGG - Intergenic
1101090300 12:101278588-101278610 TGGCATGGAAGCAGAGCTGGTGG - Intergenic
1102250723 12:111385588-111385610 CCGCCAGGAGGCTCACCTGGGGG + Intergenic
1102594519 12:113982158-113982180 TGCCCTGGAGGCTGGCCCGATGG - Intergenic
1103478973 12:121238747-121238769 TGGCCTGGTGGCTGGCCCAGGGG - Exonic
1103702709 12:122856018-122856040 TGCACTGGAGGGTGAGCTGGAGG + Exonic
1104682369 12:130760732-130760754 TGGGGTGGAGGCAGACCTGGAGG - Intergenic
1104718865 12:131033641-131033663 TGGACTGGAGCCGGCCCTGGAGG + Intronic
1104794720 12:131509475-131509497 AGGGCTGGCTGCTGACCTGGGGG + Intergenic
1107128801 13:36872853-36872875 TGGCCAGGAGGCTGAGCTGGGGG + Exonic
1108248783 13:48544292-48544314 TGGTCTGGAGGATGACATGAGGG + Intergenic
1109426723 13:62174109-62174131 TGTCCTGGAGGCTGAGCCTGTGG + Intergenic
1109652919 13:65353096-65353118 TGGCCTGGAGGCTGGGTTTGTGG - Intergenic
1109652943 13:65353203-65353225 TGGCCTGGAGGCTGGGTTTGTGG - Intergenic
1109652968 13:65353310-65353332 TGGCCTGGAGGCTGGGTTTGTGG - Intergenic
1112825740 13:103390850-103390872 TGGAATGGAAGGTGACCTGGGGG + Intergenic
1113162424 13:107397002-107397024 TGGCCTGGAGGCATATTTGGAGG + Intronic
1113287876 13:108873610-108873632 TGGCCTGGACCCTGTCCTGGTGG - Intronic
1113730435 13:112637500-112637522 GGGCCTGGAGGCCGCCCTGGCGG - Intergenic
1114239454 14:20852867-20852889 TAGCCTGGAGCCTGCACTGGGGG + Intergenic
1114598375 14:23933796-23933818 TGGTCCGGAGGCTGACCTGAAGG - Intergenic
1115348243 14:32365665-32365687 TGACCAGGAGGATGGCCTGGTGG - Intronic
1115474440 14:33800179-33800201 CGGCCTGGACGCGGGCCTGGTGG + Exonic
1115688913 14:35824702-35824724 CGTCCGGGAGGCTGGCCTGGCGG + Intergenic
1115706771 14:36007363-36007385 TGGCCGGGGAGATGACCTGGTGG + Intergenic
1116145390 14:41061432-41061454 TGGCCTGGTGGGAGGCCTGGTGG + Intergenic
1117089051 14:52231394-52231416 TTCCCTGGAGGGTGACATGGGGG + Intergenic
1117627029 14:57650770-57650792 GGGCCATGAGGCTGACCTGGAGG - Intronic
1118367624 14:65109201-65109223 TGGCATGGAGACTCACCAGGGGG - Intergenic
1119410832 14:74429172-74429194 AGCCCTGGAAGCTCACCTGGAGG + Intergenic
1119519732 14:75277196-75277218 TTGCCTGGAGACGGCCCTGGCGG + Intergenic
1121323392 14:93006003-93006025 TGGCCTGGAGCCTTTCCAGGGGG - Intronic
1121634473 14:95444541-95444563 CGGCTTGGACCCTGACCTGGAGG + Exonic
1122177979 14:99935073-99935095 TGGCTAGAAGGCTGTCCTGGTGG + Intronic
1122359924 14:101153084-101153106 GGGCCTGGAGGGAGGCCTGGGGG - Intergenic
1122414420 14:101542034-101542056 CAGCCTGGAGGCTGAGCGGGTGG - Intergenic
1122632404 14:103113005-103113027 GGGCCTGGGGGCTGAGCTTGGGG - Intergenic
1122956434 14:105073646-105073668 TGGCCTGGGGGCTGCAGTGGGGG + Intergenic
1123409228 15:20044669-20044691 TGGCCTGGGGGGTTCCCTGGGGG - Intergenic
1123423357 15:20148681-20148703 TGGCCTGGGGGCTGACGGAGGGG - Intergenic
1123518559 15:21051377-21051399 TGGCCTGGGGGGTTCCCTGGGGG - Intergenic
1123532578 15:21155202-21155224 TGGCCTGGGGGCTGACGGAGGGG - Intergenic
1125479589 15:40070789-40070811 TGGCCTGGAGCCAGGCATGGTGG + Intergenic
1125526854 15:40382021-40382043 TACCCTGGAGGCTGAGGTGGGGG - Intergenic
1128339173 15:66808474-66808496 TGCCCTGAGGGGTGACCTGGGGG + Intergenic
1128659894 15:69491178-69491200 AGGCCTGGAGGCTGAACAGCTGG + Intergenic
1128900680 15:71419309-71419331 TACCCAGGAGGCTGAGCTGGGGG - Intronic
1129660847 15:77552120-77552142 AGGCCTAGAGGCTGCCCTGCAGG - Intergenic
1129725524 15:77899658-77899680 TGGCATGGAGGCTGGGCGGGAGG - Intergenic
1129845904 15:78767636-78767658 TGGCCTGCAGGCTCACCAGCAGG + Intronic
1131554003 15:93380895-93380917 TGGCCTGGGGGCTCCCCTTGGGG + Intergenic
1132269127 15:100507611-100507633 TGGGCTGGATGCTGAGCTGGTGG - Intronic
1132514037 16:358034-358056 TGGCCTGGGGCCTGGCATGGAGG + Intergenic
1132547708 16:540879-540901 TGGTCTGGAGGCAGTCCAGGTGG + Intronic
1132572583 16:650441-650463 CGGCCTGGAGGACAACCTGGCGG + Intronic
1132828345 16:1915924-1915946 TGGCCCGGAGACTCAACTGGGGG + Intronic
1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG + Intronic
1132842324 16:1984163-1984185 TGACCTGGAGGCTCATCTGGAGG + Intronic
1132918762 16:2370948-2370970 TGCCCTGAAGGCTGACCTGTAGG + Intergenic
1133731131 16:8579473-8579495 TGTCCTTGAGTCTGTCCTGGAGG + Intronic
1133970555 16:10564738-10564760 CCTCCTGGAGGCTGCCCTGGTGG - Intronic
1135220468 16:20610700-20610722 TGGCCGAGAGGCTGACTGGGAGG + Intronic
1135220992 16:20613811-20613833 TGGCCTAGAGGCTGTCTGGGAGG + Intronic
1135498758 16:22975622-22975644 TGTGCTGGAGGATCACCTGGGGG - Intergenic
1136472320 16:30489307-30489329 TGACCTGAAGGCAGACCTGCAGG + Exonic
1136861461 16:33706920-33706942 TGGCCTGGGGGCTGACGGAGGGG + Intergenic
1137264509 16:46857936-46857958 TTGCCTTGAGGCTGGTCTGGGGG - Intergenic
1137720177 16:50623107-50623129 AGGCCTGGAGGCTGAAGTGCCGG + Intronic
1138418948 16:56886860-56886882 TGCCCTGGAGGCTGCCCCAGGGG - Intronic
1138424610 16:56922557-56922579 TGCCCTAGATGCTGGCCTGGAGG + Intergenic
1138461179 16:57148691-57148713 TGTCCAGGGGGCTTACCTGGAGG - Intergenic
1139069705 16:63365106-63365128 TACCCTGGAGGCTGACGAGGTGG + Intergenic
1139967942 16:70755955-70755977 TGGCCTGGGGTCCCACCTGGGGG - Intronic
1140735341 16:77893179-77893201 TGGTTTGGAGGGTGAACTGGTGG + Intronic
1140877094 16:79162762-79162784 TGCCCTGGAAGCTGTGCTGGGGG + Intronic
1141200720 16:81895735-81895757 TGGGCCGGGGGCTGACCTCGGGG + Intronic
1203122960 16_KI270728v1_random:1555111-1555133 TGGCCTGGGGGCTGACGGAGGGG + Intergenic
1143281628 17:5758796-5758818 TGGTCTGGAGGATGCCCTGCAGG - Intergenic
1143509657 17:7388510-7388532 GGGCGTGGAGGCAGGCCTGGAGG - Exonic
1144845715 17:18217846-18217868 TGGCCTGGGGGTGGACCTGATGG - Intergenic
1146003938 17:29149089-29149111 GGGCCTGGAGGCCGGCCTGGCGG - Intronic
1146283863 17:31561262-31561284 TGTCCTGGAGGCTTACCCAGTGG + Intergenic
1147360416 17:39926744-39926766 TCACCTGGTGGCTGCCCTGGTGG - Exonic
1147584729 17:41647738-41647760 TGGCCTGGAGGAAGACCTCCAGG + Intergenic
1148686220 17:49502616-49502638 TGCCCTGAAGGCTGACCTTGGGG + Intronic
1149866944 17:60156421-60156443 TGGCCTGAAGGCTGTGCTGCAGG - Intronic
1150426162 17:65078716-65078738 TGTCCTGGGGGCTGGCCTGTGGG + Intergenic
1151726990 17:75891030-75891052 AGGCCTGGAGGCTGTCCTCCTGG + Exonic
1151791267 17:76307403-76307425 AGGCCTGGAGGGCGGCCTGGAGG + Intronic
1151976370 17:77485666-77485688 TGGCCAGGACACAGACCTGGTGG + Intronic
1152067786 17:78121128-78121150 TGGCCAGGAGGCTGTGCTGCTGG - Exonic
1152122877 17:78429421-78429443 TGGCCAGGAGGCTGACCTGGAGG - Intronic
1152361619 17:79835582-79835604 AGGCCTGGAGGCAGCTCTGGTGG + Intronic
1152366615 17:79860196-79860218 TGGCCTGGAGGCTGGCTGGCAGG + Intergenic
1152586935 17:81193383-81193405 TGGCTTCCAGGCTGTCCTGGTGG + Intronic
1152727193 17:81953179-81953201 TGGCCTTGTGGCTGTCATGGAGG + Exonic
1153260984 18:3224575-3224597 TGGCCTGGAGTCTGGTCTAGAGG - Intergenic
1153443757 18:5149965-5149987 TGGCCTGGAGGCTAGTGTGGTGG - Intronic
1153618790 18:6957023-6957045 TGGCATCGGAGCTGACCTGGGGG - Intronic
1155932933 18:31725514-31725536 GGGTCTGGAGTCTGAGCTGGGGG - Intergenic
1156462613 18:37329862-37329884 TGCCCATGACGCTGACCTGGGGG + Intronic
1157539474 18:48489604-48489626 AGGGCAGGAGGCTAACCTGGGGG + Intergenic
1158549638 18:58424497-58424519 GGCCCTGGAGGTTGCCCTGGAGG + Intergenic
1158571191 18:58598200-58598222 TGGCCTGAAGGGAGTCCTGGAGG + Intronic
1159896755 18:74004193-74004215 TGACCTGCAGGTTGACCTGTGGG - Intergenic
1160365066 18:78317334-78317356 TTGCGTGGAGGCCGAGCTGGGGG - Intergenic
1160368413 18:78349614-78349636 TGGCTTGCAGGCTGACCTGAGGG + Intergenic
1160841896 19:1150054-1150076 TGGCCTGGAGGCTCAGCCCGAGG + Intronic
1160875443 19:1294440-1294462 AGGCCTGGAGGCAGGGCTGGGGG + Intronic
1161634799 19:5381041-5381063 TACCCTGGAGGCTGACGTGGGGG + Intergenic
1161646153 19:5454732-5454754 AAGCCTGGAGGCCAACCTGGCGG + Intergenic
1163667538 19:18610342-18610364 TGCCCTGGAGGCTGAGCCTGGGG + Intronic
1164498826 19:28794182-28794204 TGACCTTGTGTCTGACCTGGAGG - Intergenic
1164893759 19:31849985-31850007 TGCCCAGGAGGCTGAGGTGGGGG + Intergenic
1165327674 19:35123722-35123744 TGCCCTGGAGGCTGACACAGAGG + Intronic
1165445543 19:35855194-35855216 TGGGCTGGATGCCGAGCTGGGGG + Intronic
1165495920 19:36151936-36151958 CGCCCTGGAGTCTGGCCTGGGGG + Intronic
1165520528 19:36310894-36310916 TGCCCTGGAGGCTGCCTTGTTGG - Intergenic
1165623543 19:37267690-37267712 TGCCCTGGAGGCTGCCTTGTTGG + Intergenic
1165635354 19:37335318-37335340 TGTCCTGGAGGCTGCCTTGTTGG + Intronic
1165953618 19:39488588-39488610 TGCCCTGGAGGATGACCCGCTGG + Exonic
1166099838 19:40565462-40565484 GGGCCTGAAGACTGAGCTGGAGG + Exonic
1166129907 19:40739938-40739960 CAGCCTGGAGGCTGACAGGGAGG - Exonic
1166822596 19:45589693-45589715 TGACTTGGAGTCTGATCTGGAGG - Intronic
1166827092 19:45616469-45616491 TGCCCAGGCGGCTGACCTTGCGG + Exonic
1167078602 19:47264301-47264323 TAGCCTCCAGGCTGACATGGTGG - Intronic
1167298343 19:48664549-48664571 TGGCCTGCAGACAGGCCTGGGGG - Intronic
1167331509 19:48859202-48859224 TGTCCTTGAGGCTGACTTGATGG - Intronic
1167567919 19:50268386-50268408 GGGTCTGGAGGGTGGCCTGGTGG - Intronic
1167807394 19:51797989-51798011 TGGACTGGAGGCTGAGGTGGGGG - Intronic
1168228748 19:55015207-55015229 TGGCTTGGAGGGGGTCCTGGAGG - Intronic
1168247013 19:55117507-55117529 TGGCCCGGCGGCTGGCCCGGGGG - Exonic
1168337803 19:55606045-55606067 GCATCTGGAGGCTGACCTGGAGG - Intronic
1168464236 19:56589282-56589304 GGGGCTGGAGGCTGACCTCTGGG - Intergenic
926327379 2:11797006-11797028 TGGCCTGGAGGCTGCATGGGAGG + Intronic
926621149 2:15048404-15048426 AGGCCTGGGGGCTGAGCTGATGG - Intergenic
927809498 2:26173500-26173522 GGCCCAGGAGGCGGACCTGGCGG - Intronic
928720488 2:34115262-34115284 AGGCCTGGAGGTTGAGCTGCTGG + Intergenic
930557321 2:52914704-52914726 TGGCCTTGTTGCTTACCTGGTGG - Intergenic
934177046 2:89585288-89585310 TGGCCTGGGGGCTGACGGAGGGG + Intergenic
934287353 2:91659647-91659669 TGGCCTGGGGGCTGACAGAGGGG + Intergenic
935814541 2:106834986-106835008 TATCCTGGAGGCTGACAAGGAGG + Intronic
936797442 2:116224276-116224298 AGGCCTGGAGCCTGAGCTGTAGG - Intergenic
937475347 2:122210004-122210026 TGTCTTGGAGGCTGAGCTGCAGG + Intergenic
937936430 2:127249269-127249291 AGACCTGGAGGTGGACCTGGGGG - Intergenic
937936436 2:127249281-127249303 GGACCAGGAGGCAGACCTGGAGG - Intergenic
938763299 2:134444023-134444045 TGACCTGGACCCTGGCCTGGAGG - Intronic
940468322 2:154060849-154060871 CCCCCTGGAGGCTGACCTGTAGG - Intronic
940512720 2:154639420-154639442 TGTCCTTGAGGATAACCTGGAGG + Intergenic
941256787 2:163241629-163241651 TGGCATTGGGGCAGACCTGGAGG + Intergenic
941719501 2:168798493-168798515 TGGCCTGGAAGCTGCTCTGCTGG - Intronic
943664437 2:190594035-190594057 TGGCCTGAAGGCTGCCCTATTGG + Intergenic
944089930 2:195895546-195895568 TACCCAGGAGGCTGACGTGGGGG - Intronic
944480040 2:200147575-200147597 AGCCCTGGATGCTGACTTGGTGG - Intergenic
944666129 2:201961209-201961231 TGGCTTTGAGGCTGAGATGGAGG + Intergenic
945273306 2:207963174-207963196 TGGCCTGAAGAATGAGCTGGGGG + Intronic
945314745 2:208359869-208359891 TGGGCAGGAGGCTGGGCTGGTGG + Intronic
947033117 2:225820556-225820578 AAGCCTGGAGGCTGACATAGTGG + Intergenic
947634447 2:231673015-231673037 TGGCCTGAGGGCAGATCTGGAGG + Intergenic
948043938 2:234928383-234928405 TGGGGTGGAGGCTGACTTTGGGG - Intergenic
948422133 2:237866145-237866167 GGGCCTGGATGCAGACGTGGGGG - Intronic
948464378 2:238145211-238145233 AGGCCTGGAGCCTCACCTGAAGG - Intronic
948708032 2:239807242-239807264 GGGCCTGGGTGCTGGCCTGGGGG - Intergenic
948772188 2:240257309-240257331 TGGGCTGGAGGCTCTCGTGGGGG - Intergenic
1169674879 20:8142231-8142253 CAGCCTTGAGGCAGACCTGGAGG + Intronic
1170603526 20:17859545-17859567 AGGGCAGGAGGCTGTCCTGGTGG - Intergenic
1171213555 20:23335428-23335450 TGGCCTGGACTCTGGCCTGTGGG + Intergenic
1172226694 20:33310079-33310101 TGGTCTTGAGGCTGACATGAAGG - Intergenic
1174113994 20:48214551-48214573 TGACCTGCAGACTGACCAGGTGG + Intergenic
1174167851 20:48597978-48598000 TGACCTGCAGGCTGACCAGGTGG - Intergenic
1174653799 20:52152733-52152755 TGGGCTGGAGGGGCACCTGGAGG + Exonic
1175775223 20:61648905-61648927 TGTCCTGGAGTCTGTCCTGCAGG + Intronic
1175862820 20:62159310-62159332 TGGCCGTCAGACTGACCTGGAGG + Intronic
1176423550 21:6533999-6534021 AGGTCTGGAGGCAGACCTGGAGG + Intergenic
1178411647 21:32368519-32368541 TGATCTGGTGGCTGACCTTGTGG - Exonic
1178467227 21:32859312-32859334 TGTCCTGGAGGCTGCCATGAAGG - Intergenic
1179171397 21:38975703-38975725 TTGCCTGGAGGCTGAACTGAAGG - Intergenic
1179699044 21:43142315-43142337 AGGTCTGGAGGCAGACCTGGAGG + Intergenic
1180958286 22:19750846-19750868 GGGCGTGGAGGCTGCCGTGGAGG - Intergenic
1181047535 22:20222735-20222757 TGGCTTGGGGTCTGACCTGGAGG + Intergenic
1181114843 22:20625359-20625381 TGGCCATGTGGCAGACCTGGTGG + Intergenic
1181356366 22:22298450-22298472 TGGCCTGGGGGCTGACGGAGGGG - Intergenic
1181454878 22:23053442-23053464 TGGCATGGAGGCTGCCCAGCAGG + Intergenic
1181668112 22:24412265-24412287 AGGGCTGGGGGCTGACATGGGGG - Intronic
1182365423 22:29775715-29775737 AGGCCTGGAGCCAGAGCTGGTGG - Intergenic
1183107882 22:35627763-35627785 TGGCCTGGAGACTGCCCAGACGG - Intronic
1183500732 22:38177272-38177294 TTGCCGGGAGGCTGCCTTGGAGG - Intronic
1184196485 22:42932836-42932858 TGTCCTGGGGGCTGCCCAGGAGG - Intronic
1184407630 22:44308914-44308936 GGGGCGGGAGGCTGACCTTGGGG + Intronic
1184691327 22:46118627-46118649 AGCCCTGGAGGCTGAGCGGGAGG - Intergenic
1184783167 22:46659136-46659158 TGGAGTGGAGGCTGAGCGGGAGG - Intronic
1184857447 22:47154125-47154147 TGGCCTGGAGACAGTGCTGGAGG - Intronic
1185119237 22:48955963-48955985 TGGCCCGGAGCCTCACCTGTGGG - Intergenic
1185364984 22:50433323-50433345 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365026 22:50433447-50433469 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365130 22:50433757-50433779 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365153 22:50433819-50433841 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365238 22:50434067-50434089 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365300 22:50434253-50434275 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365344 22:50434377-50434399 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365388 22:50434500-50434522 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365411 22:50434562-50434584 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365452 22:50434674-50434696 TGCCCTGGAGGTGAACCTGGAGG + Intronic
1185365473 22:50434736-50434758 TGCCCTGGAGGTGAACCTGGAGG + Intronic
949432629 3:3994081-3994103 TGGCCTGGAGGATGCCTTGTTGG - Intronic
950057176 3:10034715-10034737 TGGCCTGGAGTCTTACATTGAGG + Exonic
950569601 3:13791913-13791935 TGCCCTGGGGGCTGACCCTGGGG + Intergenic
950663769 3:14482659-14482681 TGGCCTGGAGGTGGTGCTGGTGG + Intronic
951085943 3:18512784-18512806 TGGTTAGGAGGCTGACCAGGAGG - Intergenic
952289769 3:32003805-32003827 TGTCCTGGAGGATGACCTCCAGG - Intronic
954039117 3:47870899-47870921 TGGCCAGGCGGCTGAGCCGGGGG + Exonic
954215404 3:49121680-49121702 TGCCCAGGAGGCTGAGCAGGTGG - Exonic
954855823 3:53642695-53642717 TGGCCAGCAGGGTGACCTGGTGG - Intronic
955583708 3:60453447-60453469 TAGCCTGGTGCCTGGCCTGGCGG - Intronic
957335178 3:78818587-78818609 CGCCTTGGAGGCTGAACTGGTGG + Intronic
958980124 3:100709985-100710007 TGGCCAGGAGGCGCGCCTGGGGG + Intronic
959387023 3:105722088-105722110 TGGTCGTGAGGCTGAGCTGGGGG + Intronic
959471182 3:106752343-106752365 TGGCCTGGAGGCTGAAATTCAGG + Intergenic
961340374 3:126213282-126213304 CGGCCTGGAGGGAGACCCGGCGG + Intergenic
961443741 3:126968376-126968398 TGGCCTGGGGGCTGAACAGCTGG - Intergenic
961656155 3:128443134-128443156 TGGGCTGGAGGCTGTCCTGGAGG + Intergenic
961656161 3:128443157-128443179 TGGACTGGAGGCTCCGCTGGAGG + Intergenic
962402938 3:135077224-135077246 TGGCCTGCAGCCTTCCCTGGAGG - Intronic
964282387 3:155080251-155080273 GGGCCCAGAGGGTGACCTGGAGG + Intronic
964492235 3:157249230-157249252 TGGCCAGGAGGCAGTCCTTGAGG + Intergenic
964743303 3:159989064-159989086 TGGCTGGGAGGCTGACCCAGGGG - Exonic
964852107 3:161105593-161105615 TGGCCTCGAGGCGGCCCTGGAGG + Intronic
967186577 3:186949378-186949400 TGGCCTTGGGCCTGAGCTGGAGG + Intronic
968896957 4:3409878-3409900 CTGCCTGGAGGGTGGCCTGGAGG - Intronic
969038398 4:4274502-4274524 GGGACAGGAGGCTGACCTTGAGG - Exonic
969279500 4:6160683-6160705 AGGCGTGGAGGCTGGCCTGTTGG - Intronic
969373997 4:6751035-6751057 TGCTCTGGAGGCTGTGCTGGAGG + Intergenic
970741880 4:19249409-19249431 TGGCCTGATGGCTGGTCTGGTGG - Intergenic
971311051 4:25526031-25526053 TGGCCAGAAGACTGCCCTGGAGG + Intergenic
972164055 4:36260853-36260875 AGGCCGAGAGGCTGACTTGGAGG - Intergenic
973343634 4:49031213-49031235 TGGCCTGGATGCTGTCCTCATGG + Intronic
974054296 4:56970185-56970207 TACCCTGGAGGCTGAGGTGGAGG + Intronic
976205730 4:82621635-82621657 TGGCCTAGTGGTTGACCTAGTGG + Intergenic
979712056 4:123791328-123791350 TGGCCAGGGGGAGGACCTGGTGG + Intergenic
984639060 4:182143644-182143666 TGGCGGGGAGGCGGCCCTGGGGG - Intergenic
986438637 5:7759349-7759371 TGCTCTGGAGGCTGAGCAGGTGG - Intronic
986613083 5:9589478-9589500 AGGACCAGAGGCTGACCTGGAGG - Intergenic
990332537 5:54741899-54741921 TGGCTTGAAGGCAGACATGGTGG + Intergenic
990654272 5:57937198-57937220 GGGCCTGGACACTGACCTGGAGG - Intergenic
991025516 5:62025439-62025461 AGGCCTGAAGGCAGGCCTGGTGG + Intergenic
991026461 5:62035836-62035858 AGGCCTGAAGGCAGGCCTGGTGG + Intergenic
995185532 5:109267200-109267222 TGGCCTGGAGCCTGAGTTTGTGG - Intergenic
995216477 5:109600977-109600999 TTGCGTGGAGGCTGACCTCCTGG + Intergenic
997260375 5:132461080-132461102 TGGCCTGGACTCTGCCCTTGGGG - Exonic
998041156 5:138951747-138951769 TGTCCTGGAGGCTGGGCAGGAGG + Intronic
998383368 5:141741693-141741715 TAGCCTGGAGGCTGAACTGAGGG + Intergenic
999274110 5:150317483-150317505 TGGCCTGAGAGCTGACCTGTGGG + Intronic
999637128 5:153634548-153634570 TGGCCTGGAAGCAGATGTGGTGG + Intronic
1001300197 5:170528112-170528134 TTGCCTGGGGCCTGCCCTGGAGG + Intronic
1001584789 5:172826464-172826486 GGGACTGGAGTCTGACATGGTGG + Intergenic
1001905180 5:175466289-175466311 TGGCCTCGATGCTGACCTTCTGG - Intergenic
1002429072 5:179192627-179192649 TGGCAGGGAGCCTGGCCTGGGGG - Intronic
1002944416 6:1747294-1747316 TGGCTTGGATACTGAACTGGAGG - Intronic
1003639189 6:7862409-7862431 CCGGCTGGAGGCTGACCTGGTGG - Exonic
1003933453 6:10951314-10951336 TACTCTGGAGGCTGACATGGGGG + Intronic
1004755068 6:18601908-18601930 GGGCCCGGAGGCAGACCTGCAGG - Intergenic
1006000894 6:30964338-30964360 TGTGCTGGAGGCTGTGCTGGAGG - Intergenic
1006220267 6:32484115-32484137 GGGCCTGGAGGCGGTCCTGCTGG - Intergenic
1006514511 6:34538520-34538542 TCGCCACGAGGCTGACCTGGTGG - Intronic
1006633152 6:35443520-35443542 GGGCATGGAGCCTGCCCTGGAGG + Intergenic
1007353370 6:41291850-41291872 TTCCCTGGAGGCTGTCATGGTGG - Intergenic
1007607173 6:43125394-43125416 GGTGCTGGAGGCTGAGCTGGGGG + Intronic
1007704371 6:43781827-43781849 GGGCCTGGGGGCTGACCGGCTGG + Intronic
1008000652 6:46356426-46356448 TGGTCTGGAGGGAAACCTGGAGG + Intronic
1011260829 6:85468274-85468296 TGGCATAGAGGCAGAGCTGGAGG + Intronic
1011546805 6:88490588-88490610 TGAGCTGGAGGATGACCTGGTGG + Intergenic
1012447795 6:99324310-99324332 TACTCTGGAGGCTGACGTGGGGG - Intronic
1013473195 6:110484226-110484248 AGGACTGGAAGCTGCCCTGGGGG - Intergenic
1014550941 6:122789321-122789343 GGGCCGCGGGGCTGACCTGGAGG - Exonic
1016282866 6:142439039-142439061 TGCTCTGGAGGCTGAGATGGTGG + Intronic
1016503391 6:144748409-144748431 TGACCTGGACGCTGACATGAAGG + Exonic
1016749885 6:147620736-147620758 TGGCTTGGAGGCTTACCTCAGGG + Intronic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1018279997 6:162175182-162175204 TTGCCTGGAGGGAGACTTGGAGG - Intronic
1018628683 6:165804644-165804666 TGGCCTGCAGGCGGGGCTGGTGG + Intronic
1019292118 7:255966-255988 TGGCCAAGAGGAAGACCTGGCGG + Exonic
1019409458 7:900259-900281 AGGCCTGGGCCCTGACCTGGTGG - Intronic
1019463957 7:1176234-1176256 TGTCCCGGAAGCTGTCCTGGCGG - Intergenic
1019511512 7:1419877-1419899 TGGCCAGGTGGCTCCCCTGGTGG + Intergenic
1019626959 7:2020627-2020649 TGGGAGGGAGGCTGACCCGGTGG + Intronic
1019737084 7:2655991-2656013 TGGGCTGGAGGGAGACCTGGGGG + Intronic
1020129132 7:5549609-5549631 TGTGTTAGAGGCTGACCTGGAGG + Intronic
1021942278 7:25689545-25689567 TGGGCAGGAGGCTGCCCTTGGGG + Intergenic
1022026895 7:26456461-26456483 TGGGCTCAAGGCTGACATGGAGG - Intergenic
1022416113 7:30178498-30178520 TAGCCAGGAGGCTGAGGTGGGGG + Intergenic
1022465690 7:30652204-30652226 AAGCCTGGAAGCTGCCCTGGTGG + Intronic
1022510967 7:30934517-30934539 TGGGGAGGAGGCTGGCCTGGGGG + Intergenic
1024588716 7:50862788-50862810 TTGCCTGGTACCTGACCTGGGGG - Intergenic
1025082170 7:55993305-55993327 AGGGCTGTAGGCTGGCCTGGTGG + Intronic
1025231054 7:57203570-57203592 TGGTCTGGAGGTTATCCTGGCGG - Intergenic
1029445902 7:100612723-100612745 GGGCCTGGAGTCAGAGCTGGGGG - Exonic
1030084983 7:105808155-105808177 GGGCCTGCAGGCAGCCCTGGTGG + Intronic
1030090108 7:105850825-105850847 TGGTGTGTAGGCTGAGCTGGAGG + Intronic
1030399298 7:109028403-109028425 GGGCCTGGTGGTTTACCTGGTGG + Intergenic
1031447820 7:121875704-121875726 TTGCCAACAGGCTGACCTGGAGG + Intronic
1035076499 7:156181041-156181063 CGGGCTGGAGGGTGTCCTGGTGG - Intergenic
1035381910 7:158445875-158445897 TGGTCTGAGGGCTGACCCGGAGG - Intronic
1036503933 8:9338048-9338070 TGCCCAGGAGGCTGAGCTGGAGG + Intergenic
1037495742 8:19439077-19439099 TGGCCTGTAGTTTGCCCTGGAGG - Intronic
1037794861 8:21984649-21984671 TGGCCTGGAAGATCCCCTGGAGG + Exonic
1037906601 8:22719204-22719226 GGGCCCTGAGGCTGCCCTGGAGG + Intronic
1040423471 8:47261171-47261193 TGGACCGGAGCCGGACCTGGGGG - Intronic
1045860084 8:106806504-106806526 TGGGCTGGAGGCTTACCTTATGG + Intergenic
1047202608 8:122780139-122780161 TGGCCTTGGGGCTGACTGGGTGG - Intergenic
1047222940 8:122933071-122933093 TGGCCTGGAGGCGGGGATGGAGG + Intronic
1047652292 8:126936154-126936176 TGTCCTGAAGGCTGACCTCAGGG + Intergenic
1048579488 8:135719366-135719388 TGGCATGGAGGCTGAGGGGGAGG + Intergenic
1048964973 8:139608709-139608731 TGGCCTGAAGGGTGGGCTGGTGG - Intronic
1053166377 9:35846643-35846665 TGGACTGGAGGTGGACCTGCTGG + Intronic
1053304131 9:36972159-36972181 AAGGCTGGAGGCTGACCTGGCGG - Intronic
1055432409 9:76257594-76257616 TGTGCTGGAAGCTGAACTGGAGG - Intronic
1056031973 9:82562312-82562334 TGGCTTGGAGTCTGACTTGAAGG + Intergenic
1056383239 9:86074580-86074602 AGGGGTGGAGGCTGGCCTGGGGG + Intronic
1057696261 9:97324878-97324900 TGGCCTAGAAGTTGACCTTGAGG + Intronic
1058375116 9:104313903-104313925 TAGCCTGTAGGCAGGCCTGGAGG - Intergenic
1058539686 9:105998855-105998877 TGTCCAAGAGGCTGACCTGTGGG + Intergenic
1059533860 9:115063061-115063083 GGTCCAGGAGGCTGACCAGGTGG - Exonic
1059664784 9:116436352-116436374 TGGCCTGGAGTCCCACCTGCTGG - Intronic
1060057072 9:120423922-120423944 TGCCCAGGTGGCTGGCCTGGTGG - Intronic
1060521147 9:124294831-124294853 TGGGCTGGAGGCTGGGCTGCAGG + Intronic
1060599689 9:124869551-124869573 GGAGCTGGAGGCTGACCTGAGGG - Intronic
1061388848 9:130306133-130306155 TGGTGTGGATGCTGACCTGTGGG - Intronic
1062091354 9:134680248-134680270 TGGCCTGTAGCCGGGCCTGGAGG - Intronic
1062293040 9:135805982-135806004 GGTCCTGGAGGCAGACCTGCTGG - Intergenic
1062413184 9:136434835-136434857 TGGCCAGGAGGCTGCCCTCCAGG + Exonic
1062415485 9:136447182-136447204 GAGACTGGGGGCTGACCTGGAGG + Intronic
1062497944 9:136840447-136840469 TGAGCTGGAGGCTTTCCTGGGGG + Exonic
1062627294 9:137449106-137449128 TCGCCTGGAGGCTCAGCTGTGGG - Exonic
1185476258 X:417289-417311 TGTCCAGGAGGCTGACAGGGAGG + Intergenic
1185504022 X:619134-619156 GGGCCAGGAGGCTGAGCTGCGGG + Intergenic
1185645019 X:1609981-1610003 TGGCCTGGAGGCTTGGCTGGAGG - Intergenic
1186295259 X:8142051-8142073 GGGTCTGGAGGCTGACTGGGTGG + Intergenic
1186438890 X:9567678-9567700 TGGCCTGGAAGGAGACATGGTGG - Intronic
1187256750 X:17650146-17650168 TGACCTTGAGGGTGACCTCGAGG - Intronic
1187526932 X:20062940-20062962 TGGCCTTGTGCCTGCCCTGGAGG + Intronic
1193989742 X:88291790-88291812 AAGCCTGGAGGCTGGCATGGTGG + Intergenic
1195803449 X:108736651-108736673 AGGCCTGGAGATTGACCGGGAGG - Intergenic
1195877411 X:109556340-109556362 TGCTCTGGAGTCAGACCTGGAGG + Intergenic
1196525479 X:116724421-116724443 TGGCCTGGAGGCGGGCCTGGAGG + Intergenic
1198544949 X:137681564-137681586 TGGCCTGGAAGGTGGCCAGGAGG - Intergenic
1200251626 X:154557204-154557226 AGGCCTGGAGGCTGAGCTAGCGG + Intronic
1200253833 X:154568888-154568910 AGGCCTGGAGGCTGAGCTAGCGG + Intergenic
1200263936 X:154635520-154635542 AGGCCTGGAGGCTGAGCTAGCGG - Intergenic
1200266141 X:154647212-154647234 AGGCCTGGAGGCTGAGCTAGCGG - Intergenic
1200272637 X:154700318-154700340 TGAACTGGAGGCAGAACTGGAGG + Intronic
1200785598 Y:7257735-7257757 TGGCGTGGTGGCCGACCTAGGGG - Intergenic