ID: 1132844081

View in Genome Browser
Species Human (GRCh38)
Location 16:1992078-1992100
Sequence GGCCCAGCGCGACGCCGAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132844081 Original CRISPR GGCCCAGCGCGACGCCGAAG CGG (reversed) Exonic
900237451 1:1599546-1599568 GGCCCAGCGCGCAGCGGCAGCGG + Exonic
905126458 1:35718964-35718986 GGCCCCGCGCGGGGGCGAAGCGG - Exonic
914197363 1:145454486-145454508 CGCCCAGCTCGTCCCCGAAGCGG + Intergenic
920857636 1:209675786-209675808 GGCCGAGCACCACGCCGAAGAGG - Exonic
1073135738 10:101219104-101219126 GGCCCCGCGCGGCGCTAAAGCGG + Intergenic
1075878018 10:125823620-125823642 AGTCCAGCGCGACGAGGAAGAGG + Exonic
1077185288 11:1233038-1233060 GTCCCAGCGCTACGCCTACGTGG + Exonic
1084190652 11:67497273-67497295 GGCCCAGTGGGGAGCCGAAGAGG + Exonic
1084527402 11:69705375-69705397 GGCCCAGCGCAAAGGCGATGGGG + Intergenic
1085208094 11:74749153-74749175 CGCCCAACGCGCCGCCGACGCGG + Exonic
1089303518 11:117512875-117512897 GGCCCAGCGAGTCGCCGAGACGG + Intronic
1090086487 11:123654695-123654717 GGCCCAGCGCCGCGCCGAGCGGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1106242566 13:27922663-27922685 TGCTCAGCGCGACGCGGCAGGGG - Intronic
1109061691 13:57629885-57629907 AGCCCAGCGCTCCGCCAAAGCGG - Intergenic
1122264096 14:100538658-100538680 GGCCCCGCTGGAGGCCGAAGTGG - Exonic
1132844081 16:1992078-1992100 GGCCCAGCGCGACGCCGAAGCGG - Exonic
1140750820 16:78021929-78021951 GTCCCAGTGGGAGGCCGAAGTGG - Intergenic
1148936316 17:51166679-51166701 GGCCCTGCGCGGGGCGGAAGCGG + Exonic
1151731624 17:75914797-75914819 GGCCGAGCGCGAGGCCGAGCGGG - Exonic
1152758792 17:82097935-82097957 GGCCCCGGGCGCCTCCGAAGGGG + Intronic
1160691145 19:461106-461128 GGCCCAGCGCGCAGCCGCGGGGG + Intergenic
1165060786 19:33204322-33204344 CCCCCAGCCCGAAGCCGAAGTGG - Intronic
1168412183 19:56146989-56147011 GGCCCGGCGCGTCGCCCAGGTGG - Exonic
1168694492 19:58396844-58396866 GGCCCAGGGCGACCCCGGCGGGG - Exonic
933791735 2:85888785-85888807 GGGCCCCCGCGACGCCGAGGAGG + Intronic
936512128 2:113157247-113157269 GGCCCAGCCCGGCGCCACAGCGG + Intergenic
938015367 2:127862741-127862763 GGCCCAGCACCACACTGAAGTGG - Exonic
942084044 2:172427914-172427936 TGGCCAGCGAGAAGCCGAAGAGG - Exonic
1175394644 20:58650259-58650281 GGCCCAGCGCGCGGCCGGAGCGG - Intergenic
1179794758 21:43776407-43776429 GGGCCACCGCGACCCCGCAGGGG - Exonic
1182541385 22:31044575-31044597 AGTCCAGCGGGAGGCCGAAGTGG + Intergenic
1184220507 22:43096923-43096945 GGCCCAGTGAGACGCAGAAACGG + Intergenic
1184919344 22:47594662-47594684 GGCCCAGTGCGAAGCAGAAGTGG - Intergenic
954277836 3:49554236-49554258 GGCTCAGCGCGACGTCCCAGAGG + Intergenic
963253098 3:143120082-143120104 GGCACAGCGCGACCCCGCAGCGG - Exonic
973613771 4:52659614-52659636 GGCCGACCCCGACGCGGAAGCGG + Intergenic
990545399 5:56816206-56816228 GGCGCCGCCCGACTCCGAAGGGG - Intronic
990581778 5:57173370-57173392 GCCCGAGCGCGAGGCCCAAGCGG + Intergenic
1002837106 6:874322-874344 GGCCCAGCGCCAGGCCTCAGGGG - Intergenic
1005958202 6:30679248-30679270 AGCCCAACCCGACGACGAAGAGG - Exonic
1007110849 6:39312953-39312975 GACCCAGCGCGGAGCGGAAGTGG - Intronic
1026471133 7:70694680-70694702 GGCCCCGCGCGCCGCAGGAGCGG + Intronic
1033159071 7:138981197-138981219 GGGCCAGCGCGACCCCGGCGCGG + Exonic
1036655055 8:10672519-10672541 GGCCCAGCGCATCGCAGGAGGGG + Intronic
1039460099 8:37736693-37736715 GGCCCAGCGCGCGCACGAAGGGG - Exonic
1039476453 8:37841629-37841651 GGCCCTGCCCGCCGCCGCAGAGG + Exonic
1045215580 8:100145660-100145682 GGCCGGGCGAGGCGCCGAAGCGG + Intronic
1057293050 9:93819265-93819287 GGCCCAGCGCCACCCGGAAGGGG - Intergenic
1062646335 9:137550507-137550529 GGCCCAGCGCGGCGGGGATGGGG + Exonic
1062696319 9:137877939-137877961 CGCCCAGCTCGTCCCCGAAGCGG - Exonic
1189324040 X:40102453-40102475 GGCCCAGCGCGGCGGCGTCGAGG - Intronic
1190276985 X:48905170-48905192 GGCCCAGTGCTGTGCCGAAGAGG + Exonic
1196886404 X:120250670-120250692 GGCAGAGCACGGCGCCGAAGTGG + Intergenic
1200149592 X:153944704-153944726 GGCCCAGCGGAACCCTGAAGAGG - Intergenic