ID: 1132844489

View in Genome Browser
Species Human (GRCh38)
Location 16:1993501-1993523
Sequence CTACCCACAGGGACATGGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132844489_1132844496 17 Left 1132844489 16:1993501-1993523 CCATCCCATGTCCCTGTGGGTAG 0: 1
1: 0
2: 2
3: 34
4: 186
Right 1132844496 16:1993541-1993563 TCATGGTGGTGCGTCCCGTCCGG 0: 1
1: 0
2: 0
3: 2
4: 37
1132844489_1132844494 0 Left 1132844489 16:1993501-1993523 CCATCCCATGTCCCTGTGGGTAG 0: 1
1: 0
2: 2
3: 34
4: 186
Right 1132844494 16:1993524-1993546 TGACTGTCTCGTTTCTGTCATGG 0: 1
1: 0
2: 1
3: 7
4: 114
1132844489_1132844495 3 Left 1132844489 16:1993501-1993523 CCATCCCATGTCCCTGTGGGTAG 0: 1
1: 0
2: 2
3: 34
4: 186
Right 1132844495 16:1993527-1993549 CTGTCTCGTTTCTGTCATGGTGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132844489 Original CRISPR CTACCCACAGGGACATGGGA TGG (reversed) Exonic
902797017 1:18806632-18806654 CTACACACAGGCACATAGTAGGG - Intergenic
904253325 1:29239435-29239457 CTAGCCCCAGGGAAAAGGGAGGG - Intronic
905594740 1:39196882-39196904 TTACCCACAGGAATTTGGGATGG - Intronic
906784463 1:48602510-48602532 CTCCCCACAGGGCCATGCCAAGG - Intronic
907804497 1:57804709-57804731 CTACCCAGAGGGAAATTGCAAGG + Intronic
911973730 1:104466114-104466136 CTCCCCAAAAGGACAAGGGAAGG - Intergenic
912711633 1:111954047-111954069 CAACCCACAGTGACCTGGCAGGG - Intronic
914664702 1:149823335-149823357 CTACACTCATGAACATGGGAGGG + Intergenic
914671063 1:149870483-149870505 CTACACTCATGAACATGGGAGGG - Intronic
914873305 1:151493329-151493351 GTACCCACAGGGACAGGGGAGGG + Intergenic
916818969 1:168379599-168379621 CCACCCACAGGCACTGGGGAAGG + Intergenic
917569603 1:176251431-176251453 CTCCCTTCAGGGACAGGGGAGGG + Intergenic
919785277 1:201254686-201254708 CTGACCCCAGGGACTTGGGAAGG - Intergenic
919906952 1:202084998-202085020 CTGCCCAGAGACACATGGGACGG - Intergenic
920649502 1:207826194-207826216 GTACCAACGGGGTCATGGGAAGG - Intergenic
921441406 1:215190811-215190833 CTACCCACAGGGTGTTAGGATGG + Intronic
922767849 1:228165417-228165439 CCACCGAATGGGACATGGGATGG + Intergenic
924162419 1:241246404-241246426 CTACCCGCAGGGACATGGTCTGG - Intronic
924300273 1:242631013-242631035 CTAACCAGATGGACATTGGAAGG - Intergenic
1064253594 10:13725675-13725697 GTTCCCACAGGGCCCTGGGAAGG - Intronic
1065574068 10:27100823-27100845 GCACCCAAAGGGACATGGAAGGG - Intergenic
1066447380 10:35496022-35496044 CTACCCACAGGAAAAAGGAAAGG + Intronic
1067263656 10:44716716-44716738 CTACAAACAGGGACACAGGAAGG + Intergenic
1068928663 10:62565919-62565941 AAACCCACAGGAAAATGGGATGG - Intronic
1070679007 10:78435616-78435638 TTAGCCACAGAGAGATGGGAAGG + Intergenic
1076378736 10:130010803-130010825 GGACACACAGGGACATGGGCAGG + Intergenic
1078542621 11:12223908-12223930 CTCAACACAGGGAGATGGGATGG + Intronic
1078716320 11:13842411-13842433 CACCCCATAAGGACATGGGATGG - Intergenic
1079361145 11:19771519-19771541 CAGCCCACAGGGACATTGGGAGG + Intronic
1080587456 11:33694766-33694788 TTACCCACAGGCACATGGCTAGG - Intergenic
1081611742 11:44567078-44567100 CTCTCTACAGGGACATGGTAGGG - Intronic
1081755384 11:45540700-45540722 TCTCCCACAGGGAAATGGGAAGG - Intergenic
1083437049 11:62649736-62649758 CCACCAGCAGGGACATGAGAGGG + Exonic
1084533532 11:69743375-69743397 CTGCCCACAGGGACTGGAGAGGG + Intergenic
1084572510 11:69968152-69968174 GTTCCCACAGGGCCAGGGGAAGG - Intergenic
1084974685 11:72790262-72790284 CTGCCCACAGCCACATGGGAGGG - Intronic
1085014561 11:73164815-73164837 TCACTCACAGGGACAGGGGAGGG - Intergenic
1085518115 11:77123007-77123029 CCCCCCACGGGGAAATGGGAGGG - Intronic
1087623459 11:100568651-100568673 CTACCCTCAGGTACCTAGGAAGG - Intergenic
1088409656 11:109520320-109520342 CTCCCCAGAGGTACATGGGGAGG - Intergenic
1089787039 11:120915151-120915173 CAACCCACTGAGACCTGGGAAGG + Intronic
1090083911 11:123634097-123634119 TGACCTACAGGAACATGGGAGGG - Intronic
1090979074 11:131701286-131701308 CTACCCACAGGGCCATTGCCAGG + Intronic
1096770155 12:53930480-53930502 CTTTCCACAGGGACCTGTGAGGG + Intergenic
1100862167 12:98817853-98817875 CTCCCCACAGGCACAGGGGAAGG - Intronic
1101995819 12:109524233-109524255 CTGCCCACAGGGGGATGTGAGGG - Intronic
1102198371 12:111040509-111040531 CCAACCACAGAGAGATGGGAGGG - Intronic
1103795419 12:123499772-123499794 CCAGCCACAGGGAGATGAGAAGG - Intronic
1103920566 12:124397090-124397112 CCACAAACAGGGACATGGGCGGG + Intronic
1105269652 13:18859968-18859990 CAGCCTACATGGACATGGGAAGG + Intergenic
1105302842 13:19151171-19151193 CTGCCTTCAGGGACAGGGGAGGG - Intergenic
1106026425 13:25960066-25960088 CCACCAACAGGGCTATGGGAAGG + Intronic
1109528382 13:63606275-63606297 CTTCCCACAGAGACCTGGCAGGG - Intergenic
1111954962 13:94746750-94746772 CTATCCACAAGGACTTAGGATGG + Intergenic
1112479983 13:99766530-99766552 CTCCCCAAAGGGACATAGCAAGG - Intronic
1112515000 13:100045675-100045697 CTACCCATAAGGTCATGAGATGG - Intergenic
1112626589 13:101111548-101111570 CTACCCACAGTGATATGGTTTGG + Intronic
1115511049 14:34138171-34138193 CTGACCACAGGGGCATGGGAAGG + Intronic
1117226010 14:53659706-53659728 CTCCCCAGATGAACATGGGAAGG - Intergenic
1117770999 14:59134605-59134627 CCACTCCCAGGGAGATGGGAAGG + Intergenic
1119431800 14:74573293-74573315 CTCCTCACAGGGTCATGGCAAGG + Intronic
1122955578 14:105069185-105069207 CTAAACACAGAGACATGGAAGGG - Intergenic
1202829692 14_GL000009v2_random:14036-14058 CAGCCCACATGGACATGGGAAGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1126381199 15:48049086-48049108 CTCCCCATGGGGACAGGGGAAGG + Intergenic
1127375610 15:58381972-58381994 CTACCCAGAGGGGTCTGGGAAGG + Intronic
1127566989 15:60199715-60199737 CTCCCAATAGGGACATGGGTGGG + Intergenic
1127791964 15:62406053-62406075 CTAACCATAGGGACAGGAGAAGG + Intronic
1128215177 15:65929840-65929862 CGTCCCACTGGGACATGGCAGGG + Exonic
1129111102 15:73337809-73337831 CTTCCCACAGGGACAAGGGTAGG - Intronic
1132808768 16:1787846-1787868 CCACCCACAGGGACTCGGGAAGG - Intronic
1132844489 16:1993501-1993523 CTACCCACAGGGACATGGGATGG - Exonic
1132869073 16:2107568-2107590 CCAGCAACAGGGACATGGGCTGG + Intronic
1134550127 16:15134965-15134987 CCAGCAACAGGGACATGGGCTGG + Intronic
1134718342 16:16368030-16368052 CCAGCAACAGGGACATGGGCTGG - Intergenic
1134956410 16:18384129-18384151 CCAGCAACAGGGACATGGGCTGG + Intergenic
1136039661 16:27568027-27568049 CTACCCAGAGAGGCATGTGAAGG - Intronic
1136552640 16:30989777-30989799 CGACCCACGGGTACATGGGATGG + Exonic
1138390503 16:56667195-56667217 CAACCTACAGGGACAAAGGAAGG + Intronic
1140384406 16:74521839-74521861 CTAGTCACAGGGGCATGGAAAGG + Intronic
1141304902 16:82853257-82853279 CTACATACAGGGACATAGCAGGG - Intronic
1141567945 16:84915899-84915921 CTCCCCACAGGGAAAGGGCATGG + Intronic
1142409952 16:89910937-89910959 CTCCTCACAGGGACCTGGGGAGG + Intronic
1143256593 17:5562187-5562209 CTTCCCAGAGGAACAGGGGATGG - Intronic
1144635046 17:16900743-16900765 CTGACCACAGGCACATGGTATGG - Intergenic
1144643379 17:16952083-16952105 CAACACACAGTGACAAGGGAGGG + Intronic
1145252509 17:21304294-21304316 CTGCCCACTGGGGCATGGGAGGG + Intronic
1147387597 17:40091276-40091298 ATGCACACACGGACATGGGAAGG + Intronic
1148699038 17:49577063-49577085 CTTCCCACAGTGGCATGGGGCGG - Intronic
1151816507 17:76473954-76473976 CCACCCACAGGGACGTGGGTAGG - Intronic
1152012070 17:77724852-77724874 GCCCCCACAGGGACAAGGGAGGG - Intergenic
1152078989 17:78174951-78174973 CTGGCCGCAGGGACAGGGGATGG + Intronic
1152147929 17:78580422-78580444 CGGCTCAGAGGGACATGGGAGGG + Intergenic
1152278700 17:79372665-79372687 CCACCCACAGGGGCAGGGCAGGG + Intronic
1152573562 17:81130745-81130767 CTATGCACAGGGACAGGGGTGGG - Intronic
1152627013 17:81392537-81392559 CCACTGCCAGGGACATGGGAGGG - Intergenic
1153256259 18:3174613-3174635 CTACCCAGAGGCACACTGGAGGG + Intronic
1155504703 18:26521805-26521827 CTGCCGGCTGGGACATGGGAGGG + Intronic
1156157172 18:34316812-34316834 TTATACACAGGGTCATGGGAGGG - Intergenic
1158340490 18:56460766-56460788 CTGCCCACAAGGAAAGGGGAAGG - Intergenic
1160556554 18:79729377-79729399 CTCACCCCAAGGACATGGGACGG + Intronic
1161346680 19:3771799-3771821 CTACCGGCAGGGACAGGGCAGGG + Exonic
1163561262 19:18020853-18020875 GTAACCCCAGGGACATGGGGAGG - Intergenic
1164739159 19:30563971-30563993 CTAGCCCCAGGGGCCTGGGATGG + Intronic
1166733041 19:45069329-45069351 CCACCCACAGGGAGCTGGGCAGG - Intronic
1167530337 19:50011917-50011939 CCAGCCACTGGGACATGGTATGG - Intronic
1167705968 19:51081499-51081521 CTAGGTACAGGGACAGGGGAGGG + Intronic
1202643000 1_KI270706v1_random:113749-113771 CAGCCCACATGGACATGGGAAGG + Intergenic
925664747 2:6240756-6240778 CAACACTCTGGGACATGGGATGG + Intergenic
926429021 2:12767159-12767181 TTACACAGAGGGACAAGGGAGGG - Intergenic
929555646 2:42924107-42924129 CTCCCCACAGGGCCTTGGCAGGG + Intergenic
934498872 2:94837226-94837248 CAGCCCACATGGACATGGGAAGG + Intergenic
935259502 2:101342567-101342589 CTACCCACTGAGACCTGGGCAGG + Intergenic
937357866 2:121209450-121209472 CTCCCCGCAGCCACATGGGACGG + Intergenic
938483294 2:131679765-131679787 CTTTCCCCAGGGCCATGGGATGG + Intergenic
938883925 2:135623981-135624003 CTATACAGAGAGACATGGGAAGG + Intronic
941563410 2:167077769-167077791 TTACCCAGAGTGACAAGGGAAGG + Intronic
942372513 2:175300460-175300482 CTACCTACAGAGAAGTGGGAGGG - Intergenic
946025496 2:216669604-216669626 CAACACAGAGGGAGATGGGATGG + Intergenic
946225939 2:218264189-218264211 CCACCCCCAGAGACTTGGGAAGG + Exonic
947596823 2:231418224-231418246 CTACTGACAGGGACATGAGGCGG + Intergenic
948388124 2:237594206-237594228 ATTCCCATGGGGACATGGGATGG + Intronic
1170088570 20:12565141-12565163 CAAATCACAGGGACATGTGAGGG - Intergenic
1171890123 20:30703951-30703973 CAGCCCACATGGACATGGGAAGG + Intergenic
1173349678 20:42233380-42233402 CTACCCAGAAGTAGATGGGAGGG - Intronic
1174486707 20:50865845-50865867 CTGCCCACAGAGAAATGGGAGGG + Intronic
1174570176 20:51495841-51495863 TTTCCCACAGGGACAGAGGAGGG - Intronic
1175496184 20:59415860-59415882 CTACTCACAGGGAAGTGGAAGGG + Intergenic
1176608877 21:8858876-8858898 CAGCCCACATGGACATGGGAAGG - Intergenic
1176854907 21:13959275-13959297 CAGCCTACATGGACATGGGAAGG + Intergenic
1179044297 21:37831004-37831026 CCACCCTGAGGGACATGGGAGGG + Intronic
1180120047 21:45739770-45739792 CCACCCAGAGGGCCATGGGCAGG - Intronic
1180358967 22:11868708-11868730 CAGCCCACATGGACATGGGAAGG - Intergenic
1181328957 22:22074551-22074573 CTTTCCACAGGGACCAGGGAAGG - Intergenic
1181371419 22:22421204-22421226 CTGCCCTGAGTGACATGGGATGG + Intergenic
1182068076 22:27444210-27444232 CGCCCAACAGGGACAAGGGAGGG - Intergenic
1183979760 22:41532573-41532595 CCACCCACATGGTCAGGGGAGGG - Intronic
1184443047 22:44530446-44530468 CTACCCACAGGGACTGTGGCAGG - Intergenic
1184528691 22:45040708-45040730 CCAACCACAGGTACAGGGGAGGG + Intergenic
1184665633 22:45987492-45987514 CTGCACTCAGGGACCTGGGAAGG + Intergenic
1184682229 22:46078610-46078632 GGACCCACAGGGGCATGGCAGGG - Intronic
950099527 3:10348417-10348439 CCAGGCACAGGAACATGGGAGGG - Intronic
950137356 3:10590981-10591003 ATACCTACAGGGACAGGGCACGG - Intronic
950475002 3:13209574-13209596 CTAGCCCCAGGCACATGGGAGGG - Intergenic
951359297 3:21705548-21705570 CTACCTACGTGGGCATGGGAAGG + Intronic
953207892 3:40848110-40848132 CTCCCCACATGGGCATGGCAGGG - Intergenic
954744112 3:52777367-52777389 CTACACAGAGGGACATGGTCTGG + Intergenic
955950711 3:64239586-64239608 CCAGCCACAGGGACAGGGGAGGG + Intronic
956387897 3:68740419-68740441 GAAGCCACAGGAACATGGGAGGG + Intronic
959354129 3:105304004-105304026 ATATCCACAGGGATATGGGTAGG + Intergenic
959464888 3:106673349-106673371 CTAGCAACAGGGAAAAGGGAAGG + Intergenic
961500486 3:127329593-127329615 CTACCTACAGAGGCATGGGCAGG - Intergenic
961818103 3:129561570-129561592 TTCCCCACTGGGGCATGGGATGG + Intronic
963643367 3:147883851-147883873 CTACTCACAGAGCTATGGGAGGG - Intergenic
964698429 3:159536304-159536326 CTACATATAGGGACATGGCATGG - Intronic
967194717 3:187016473-187016495 CTTCCTCCAGGGACATGGGCTGG + Intronic
967272810 3:187744730-187744752 TTACCCAGAAGGACAGGGGAAGG + Intronic
967414005 3:189196645-189196667 ATTCCCACAGTGTCATGGGAGGG - Intronic
969041746 4:4303104-4303126 GTACCCACAGGCAGAAGGGAAGG + Intronic
969307136 4:6332308-6332330 ATTCCCACAGGGACAGAGGAGGG + Intronic
975556856 4:75673525-75673547 CTCCGCAGAGGGACACGGGAAGG - Exonic
976090400 4:81451379-81451401 CTACCTACATTGACATGGAAGGG + Intronic
984144742 4:176046561-176046583 CAACCCACTGGGCCATGGGTTGG - Intergenic
984818224 4:183857823-183857845 ATACCCTCAGAGGCATGGGAGGG - Intronic
984821013 4:183882402-183882424 CGACCCACTGGGAAATGAGAAGG - Intronic
985341347 4:188957713-188957735 GTACCCACGGTGACAGGGGAAGG + Intergenic
1202770369 4_GL000008v2_random:199644-199666 CAGCCCACCTGGACATGGGAAGG + Intergenic
992625874 5:78635386-78635408 CTTCCCCCAGGGAAAAGGGATGG + Intronic
995742901 5:115373831-115373853 ATGCCCACAGGGACTAGGGATGG + Intergenic
1003164355 6:3663364-3663386 CTTCCCACTGTGACAAGGGAGGG - Intergenic
1003255424 6:4470965-4470987 CTACACACAGGGATATGTGAGGG + Intergenic
1004325470 6:14670449-14670471 CAACCCACAGGGACAGGTCAGGG + Intergenic
1006001937 6:30972139-30972161 CTGCTCACAGGGACAGGAGAGGG - Intergenic
1006444057 6:34069061-34069083 TTACACACAGGGACAGGGGCAGG + Intronic
1007396891 6:41583140-41583162 CTATCCACATGGGCCTGGGAGGG - Intronic
1012938842 6:105396503-105396525 CTCCCCACTGGGACAAGGAAAGG - Intronic
1012973286 6:105754023-105754045 CAAGCCACAAAGACATGGGATGG + Intergenic
1013010366 6:106114977-106114999 GTTCCCACAGGGACATGGTATGG + Intergenic
1013491135 6:110646979-110647001 CTCCCCACAGAGACAGAGGAGGG + Intronic
1016865330 6:148760370-148760392 CTGCCCACAGTGAAATGGGATGG - Intronic
1017440896 6:154463414-154463436 CAACCCACTGGCACATGGGCTGG + Intronic
1019367395 7:641581-641603 CAACCCACAGGTCCATGGCAGGG + Intronic
1020888678 7:13851821-13851843 CCACCCCCATGGACTTGGGAGGG - Intergenic
1029270179 7:99372932-99372954 CTTCCCACAGGGACAAGTGTAGG - Intronic
1031206488 7:118764746-118764768 ATACCCACAGGGAGCTGTGAGGG + Intergenic
1032197837 7:129799570-129799592 CTGCCCTCAGAGACATGGGTAGG + Intergenic
1033867366 7:145707897-145707919 TTACCCACAGGGAGCTGAGAGGG + Intergenic
1034116146 7:148585679-148585701 GTACCCACAAAGCCATGGGATGG + Intergenic
1034696474 7:153058631-153058653 CTACCCAGAGGAACATGGGAGGG - Intergenic
1034759487 7:153658014-153658036 CTAACTACAGGGAGAAGGGAGGG - Intergenic
1036289342 8:7473624-7473646 ATACCCACAGGGACTGGGGATGG - Intronic
1036332139 8:7837908-7837930 ATACCCACAGGGACTGGGGATGG + Intronic
1037877538 8:22555264-22555286 CCTCCCACAGGGACTGGGGATGG + Intronic
1038017976 8:23530553-23530575 CTCCCCACTGGGACACTGGAGGG - Intronic
1038692204 8:29773774-29773796 CTACCCACTGTGATATGGGTGGG - Intergenic
1040757117 8:50790089-50790111 CTACTCAAAGGGCCGTGGGAAGG - Intronic
1044282382 8:90371239-90371261 CTACCCAGAGACACCTGGGATGG + Intergenic
1048227492 8:132602686-132602708 ATACACACAGGGACATGAGTAGG - Intronic
1048267564 8:133000956-133000978 CTTCCCACAGGGACCTTGGAAGG - Intronic
1049353375 8:142175968-142175990 CTCCCCACAGGGAGATGGGTAGG - Intergenic
1050393301 9:5169045-5169067 CTAATCCCAGGGACTTGGGAAGG - Intronic
1053135311 9:35647052-35647074 CTACCCACTGGGACAAGCCAAGG - Intergenic
1053658288 9:40243329-40243351 CAGCCCACATGGACATGGGAAGG - Intronic
1053908660 9:42872603-42872625 CAGCCCACATGGACATGGGAAGG - Intergenic
1054358981 9:64094265-64094287 CAGCCCACATGGACATGGGAAGG - Intergenic
1054370411 9:64389604-64389626 CAGCCCACATGGACATGGGAAGG - Intronic
1054526310 9:66132892-66132914 CAGCCCACATGGACATGGGAAGG + Intronic
1054678039 9:67879359-67879381 CAGCCCACATGGACATGGGAAGG - Intronic
1054876050 9:70097455-70097477 CAACACACAGGGTCATGGGTGGG - Intronic
1054901710 9:70375854-70375876 CTACCTACAGGTAAATGAGAAGG + Intergenic
1059358335 9:113718743-113718765 ATACATACAGGGACATTGGAGGG - Intergenic
1059470009 9:114497858-114497880 CTCCCCACAGCCACCTGGGAAGG + Intronic
1061202481 9:129145868-129145890 CTCCGCCCAGGTACATGGGAGGG + Intronic
1203704276 Un_KI270742v1:24101-24123 CAGCCCACATGGACATGGGAAGG - Intergenic
1203559723 Un_KI270744v1:41721-41743 CAGCCCACATGGACATGGGAAGG + Intergenic
1193472626 X:81925702-81925724 CCACCCAGAGGAACATGGCAAGG - Intergenic
1195346937 X:103960274-103960296 CTACCCCTAGGGAAGTGGGAAGG + Intronic
1195360505 X:104078567-104078589 CTACCCCTAGGGAAGTGGGAAGG - Intergenic
1195425391 X:104723637-104723659 CTACCCACAGAGAAATGACAAGG + Intronic
1202053672 Y:20806831-20806853 CTAGCCACAGGGACAGGAAACGG - Intergenic