ID: 1132845389

View in Genome Browser
Species Human (GRCh38)
Location 16:1998845-1998867
Sequence GCCTGGGTCTGGGGGTCAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 541}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132845381_1132845389 -5 Left 1132845381 16:1998827-1998849 CCCGTGGGGCAGGCAGCAGCCTG 0: 1
1: 0
2: 6
3: 46
4: 418
Right 1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG 0: 1
1: 0
2: 4
3: 73
4: 541
1132845373_1132845389 27 Left 1132845373 16:1998795-1998817 CCTCTCCCGGAAGTTCTCGGGGA 0: 1
1: 1
2: 0
3: 8
4: 80
Right 1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG 0: 1
1: 0
2: 4
3: 73
4: 541
1132845376_1132845389 21 Left 1132845376 16:1998801-1998823 CCGGAAGTTCTCGGGGACTAGGT 0: 2
1: 0
2: 0
3: 2
4: 53
Right 1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG 0: 1
1: 0
2: 4
3: 73
4: 541
1132845382_1132845389 -6 Left 1132845382 16:1998828-1998850 CCGTGGGGCAGGCAGCAGCCTGG 0: 1
1: 1
2: 9
3: 83
4: 653
Right 1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG 0: 1
1: 0
2: 4
3: 73
4: 541
1132845374_1132845389 22 Left 1132845374 16:1998800-1998822 CCCGGAAGTTCTCGGGGACTAGG 0: 1
1: 1
2: 0
3: 6
4: 90
Right 1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG 0: 1
1: 0
2: 4
3: 73
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132845389 Original CRISPR GCCTGGGTCTGGGGGTCAGA AGG Exonic
900104430 1:976318-976340 GGCTGGGTCTTGCGGGCAGACGG - Intronic
900120340 1:1046154-1046176 CCCCAGGTCTGTGGGTCAGATGG + Exonic
900177757 1:1298336-1298358 GCCTGGGGCTGGGGCCCTGATGG - Intronic
900186263 1:1334642-1334664 GCTTGGCTCTGGGGCCCAGATGG - Exonic
900360032 1:2284018-2284040 GTCTGGGTCTGGGGAGAAGATGG - Intronic
900420350 1:2553473-2553495 GCCTCGGGCTTGGGGACAGAAGG - Intergenic
900424076 1:2568185-2568207 GCCTCGGGCTTGGGGACAGAAGG + Intergenic
900990756 1:6097153-6097175 ATCTTGGTCTGGGGGTCTGAGGG - Intronic
901048936 1:6416507-6416529 GCCTGAGTCAGGAGGTCAGTGGG - Exonic
901748952 1:11394092-11394114 GGCTGGGTCTGCTGGGCAGAGGG - Intergenic
902115319 1:14116397-14116419 GCTTGGGTCTTGGCTTCAGAGGG + Intergenic
902217169 1:14941535-14941557 GCCTGGGTTGGGGGGTGGGATGG + Intronic
902404117 1:16173782-16173804 GCCTGTGACTGGGGGGCAGGTGG + Intergenic
902559930 1:17271007-17271029 GCCGGGGCCTGGGGGCCAGAGGG - Intronic
902579315 1:17398391-17398413 GCCTGGGTATTGGGCTCAGCTGG + Intronic
903329123 1:22588259-22588281 ACGTGGGGCTGGGGGTCTGAGGG - Intronic
903363564 1:22792401-22792423 GCCTGAGCCTGGGGGTCTGCAGG - Intronic
903468965 1:23571971-23571993 GCCTGGGACTGGGGGACAGAAGG + Intergenic
903810916 1:26034731-26034753 GCTTGGGGATGGGGGTCAAAGGG + Intronic
903929450 1:26854008-26854030 ACCTGGGTTTGGGGAGCAGAGGG - Exonic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
904688851 1:32278963-32278985 GAGGGGGTCTGGGGGTCTGAGGG - Intronic
905362432 1:37430112-37430134 CCCTGGGGTTGGGGGTCAGTGGG - Intergenic
905403775 1:37720118-37720140 GGCTGGATCTGGGGCTCAGTGGG - Intronic
905796914 1:40820995-40821017 GCTTGGGTTTGGGGCTCAGAGGG - Intronic
905857288 1:41322386-41322408 GCCTGGGTCTGGGTGTGATGGGG + Intergenic
907006540 1:50920216-50920238 GCTTGAGCCTGGGGGGCAGAGGG + Intronic
907267625 1:53272432-53272454 GCATGAGCCTGGGGGGCAGAGGG - Intronic
907437637 1:54459733-54459755 GCCTGGCTCAGGGGCTCAGCAGG - Intergenic
912860284 1:113208019-113208041 GCATGGGTGGTGGGGTCAGATGG + Intergenic
912882261 1:113427319-113427341 GACTGGGTTAGGGGGCCAGATGG - Intronic
913123906 1:115767848-115767870 GCGTCTCTCTGGGGGTCAGACGG - Intronic
914846743 1:151287662-151287684 GCTGGGGACTGGGGGACAGAAGG + Exonic
915097640 1:153474760-153474782 GCCTGGCCCTGGGGGTCTGCTGG + Intergenic
915437295 1:155917599-155917621 GGCTGGGGCTGGGGGCCAGCAGG + Exonic
915491218 1:156250995-156251017 TCCTGGGGATGGGGGGCAGAGGG + Exonic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
915895438 1:159808097-159808119 GCCTTAGGCTGGGGGACAGAGGG + Intronic
916496144 1:165349118-165349140 GCCTGGCTCTGTGGGTCAGGCGG - Intronic
916522387 1:165575877-165575899 GCGTGGGCCTGGGGGTCAGGAGG - Intergenic
916789850 1:168115670-168115692 GGCGGGGTGTGGTGGTCAGAAGG + Intronic
918528941 1:185496137-185496159 GCCTGGGTCTGGGTGACAGATGG + Intergenic
919856956 1:201712601-201712623 GCCAGGATCTGGGGTTCAGAGGG + Intronic
919915307 1:202135269-202135291 GCCTGGGGCTAGGGGACAGCGGG + Intronic
920003103 1:202812570-202812592 ACCTGGGTGTGGGGCTCAAAGGG + Intergenic
920080376 1:203368683-203368705 GCCTGGGGCTTGAAGTCAGAGGG + Intergenic
920366229 1:205449753-205449775 GCCTGGGTCTGGGGTTCTGGGGG - Intronic
920366261 1:205449836-205449858 GCCAGGGGCTGGGGGTCCCAGGG + Intronic
920403473 1:205692095-205692117 GCCAGGGGCTGGGGGACAGAGGG - Intergenic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921314412 1:213876676-213876698 TCCTGGGTTTGGGGGTGAGCTGG - Intergenic
922475465 1:225904441-225904463 GCATGGGCCTGGGGCTCAGAGGG - Intronic
922909685 1:229205109-229205131 GACTGGGTAAGGGGCTCAGAGGG - Intergenic
923920449 1:238558599-238558621 TCCTGGGTCTGCAGGTCAGTGGG + Intergenic
924101825 1:240611699-240611721 GCGTGTGTCTGGGGGCCACAAGG - Intronic
1062771240 10:103284-103306 GCGTGGGGCTGGGGGTGAGGGGG - Intergenic
1063590775 10:7393779-7393801 TCCTAGGTCTAGGGGTCAGAGGG - Intronic
1063707827 10:8448069-8448091 GCCTGGGGCTGGGGGCTAGAGGG + Intergenic
1064091892 10:12392798-12392820 ACCTGGGCCTGGGGGTCAGGGGG - Intronic
1064883703 10:20085704-20085726 GCCTGGGTCCAAGTGTCAGAAGG - Intronic
1066308118 10:34167115-34167137 GCCTGGGTCTGTGTGTCTGAGGG + Intronic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1067092626 10:43276646-43276668 GCCAGGGTCTGGGGGTGGGTGGG - Intergenic
1067286590 10:44911762-44911784 GCCTAGGGCTGGGGACCAGAGGG + Intronic
1067539902 10:47143801-47143823 GCCTGGGGCTGGGGGAGGGAAGG + Intergenic
1068798092 10:61106576-61106598 GCTTGGGTCTGGGAATGAGAAGG - Intergenic
1068931953 10:62599869-62599891 GCCTGGGGCTGGGAGAAAGAGGG + Intronic
1069256542 10:66338282-66338304 GCCTGGGCCTGGAGGTCGGAAGG + Intronic
1069619928 10:69830905-69830927 GCCTGGGGCTGGGGGTCGGAGGG - Intronic
1069959323 10:72070331-72070353 GCCTCTGTCTGCGGCTCAGATGG - Exonic
1069979576 10:72242881-72242903 GCCTGTGTCCCAGGGTCAGAAGG + Intergenic
1070328174 10:75401214-75401236 GCCTGGCGCAGGGGGTCAGAGGG + Exonic
1071064449 10:81614273-81614295 GCATGGGGATGGGGGTCGGAGGG + Intergenic
1071236688 10:83657633-83657655 GCCTAGGTCCTGGGGCCAGAGGG + Intergenic
1072208182 10:93222663-93222685 GCCTGGGACTGAGAGTCAGTGGG - Intergenic
1072374850 10:94804012-94804034 GCCTGGGTGTGGAGCACAGAGGG + Intronic
1072634209 10:97166921-97166943 GCCTGGGCCCGCGGGTCAGATGG - Intronic
1072763913 10:98080827-98080849 GCCTGGGGCTGGAGGTGAGGGGG + Intergenic
1073051683 10:100671202-100671224 GCCTCGGTCTGCGGGTCCGGAGG + Intergenic
1074129526 10:110561300-110561322 GCCTGGGGCTGGGGATTGGAAGG - Intergenic
1074386246 10:113018902-113018924 GCCTGGCTCTGGGAGGCAGCTGG + Intronic
1075174086 10:120143362-120143384 GCCTGTGTCTGAGAGTCACAAGG + Intergenic
1075788555 10:125066974-125066996 ACCTGGGCCTGGTGGTCAGGCGG - Intronic
1076065104 10:127442326-127442348 GGCTGGGTCTGGGGGCCTGGTGG - Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG + Intergenic
1076647117 10:131961182-131961204 GCCTGGGCCTGGGGGCCTGGCGG + Intergenic
1076922933 10:133465016-133465038 GCCTGGGCCTGGGGGTCACTAGG + Intergenic
1077098936 11:812657-812679 GCAAGGGGCTGGGGCTCAGACGG + Intronic
1077325589 11:1962603-1962625 TCCTGGGTCTGGGTGTCTGAGGG + Intronic
1077384183 11:2261239-2261261 GCCGGGCTCTGGGGCCCAGAAGG + Intergenic
1077409539 11:2397082-2397104 GCCTGGGTCTTGGGGACTGGAGG + Exonic
1078468363 11:11567595-11567617 GGCTGGGTTTGGGGCCCAGAGGG - Intronic
1079237624 11:18701229-18701251 TCCTGGGGCTGGGGGATAGAGGG + Intronic
1079332642 11:19546390-19546412 CCCTGGGTGTGGGGCCCAGATGG + Intronic
1080057304 11:27919679-27919701 GGCTGGGTTTGGGGGAGAGATGG - Intergenic
1080283842 11:30586205-30586227 GGCTGGGGCTGGGGGCCAGGGGG + Intronic
1081660098 11:44882820-44882842 CCTTGGGTCTGGGGGTCTGGGGG - Intronic
1081691404 11:45080903-45080925 ACCTGGGGGTGGGGGTCAGGAGG - Intergenic
1082801271 11:57416531-57416553 GCTTGGGTCTGGAGGAGAGATGG + Intronic
1083299968 11:61735161-61735183 GCCAGGGTCTGGGGAAGAGAAGG - Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083801428 11:65048384-65048406 GCCTGGGAATGGGGGATAGAGGG + Exonic
1083945707 11:65921438-65921460 GCTATGGTCTGGGGGGCAGAAGG - Exonic
1084505661 11:69565532-69565554 GCCAGAGACTGGGGGTTAGAAGG + Intergenic
1084678042 11:70648230-70648252 GCCTGGGGCTGGGAGGGAGATGG + Intronic
1084692282 11:70734409-70734431 GACTGGGTATGGGAGTCAGGCGG - Intronic
1085256464 11:75176291-75176313 GACTGGGTCAGGGGCTCAGAGGG + Intronic
1085296258 11:75433372-75433394 GCCTGGGTTTGGGGGTGACCTGG + Intergenic
1085385931 11:76158429-76158451 GCCTGGGGGTGGGGGCGAGAGGG - Intergenic
1085769107 11:79309369-79309391 TCCTGGCCCTGGAGGTCAGATGG + Intronic
1085848040 11:80087980-80088002 GCCTGTGGGTGGGAGTCAGAGGG + Intergenic
1087269079 11:96092796-96092818 GCCTGGCTCTGAGGGACTGAAGG + Exonic
1088425478 11:109696932-109696954 GCCTGGGTGTGGGGTGGAGAGGG - Intergenic
1088462250 11:110093563-110093585 GCCTGGGCCTGGAGATCACACGG - Intronic
1088537042 11:110872652-110872674 GTCTGGATGTGGGGGTAAGATGG - Intergenic
1088627395 11:111739505-111739527 GCATGGGTCGGGGGTTCAGCGGG - Intronic
1089159657 11:116427894-116427916 GCCTAGCTCTGGGGGATAGAGGG - Intergenic
1090076185 11:123581385-123581407 GCCGGCCTCTGGGGGTGAGAAGG - Intronic
1090250009 11:125244558-125244580 GCCTGGGGCTGGGAGTGGGAGGG - Intronic
1090352510 11:126116289-126116311 GCCTGGGTGTGGGGATGAGCTGG + Intergenic
1090551751 11:127827310-127827332 GCCTGAGTCTGGGGGACATTGGG - Intergenic
1091307039 11:134542932-134542954 GAGTGGGCCTGTGGGTCAGAGGG + Intergenic
1091323113 11:134665417-134665439 GTCCGGGTTTGAGGGTCAGATGG + Intergenic
1091336058 11:134767222-134767244 GCCTGGGGCTGGGGGAGGGATGG - Intergenic
1202808569 11_KI270721v1_random:17782-17804 TCCTGGGTCTGGGTGTCTGAGGG + Intergenic
1091838207 12:3600885-3600907 GCCAGGTTGTGGGGCTCAGAAGG - Intergenic
1093906907 12:24703856-24703878 GCCAGGGTCAAGGGGACAGATGG - Intergenic
1093969857 12:25365239-25365261 GCCTGGGGCTGGGGGTGGGAGGG + Intergenic
1095183807 12:39178205-39178227 GCCTGGGTATGGGGTTTATATGG - Intergenic
1096344017 12:50829155-50829177 GCCTGGGGCTGGGGGAGGGATGG + Intergenic
1096480573 12:51938082-51938104 GCCTGGGTTTGGGGGAGAAAGGG - Intergenic
1096620028 12:52858699-52858721 GCCTGGGTATGGGGTAGAGAAGG - Intergenic
1096677250 12:53232340-53232362 CCCTGGGGCTGGGGGGCGGAGGG + Intronic
1097245836 12:57607177-57607199 GCCTGGCTCTGGGGGGTGGAGGG + Exonic
1098066862 12:66627875-66627897 GCCTGGGAATGAGGGTGAGAGGG + Intronic
1098217768 12:68238169-68238191 TCCTGGGACTGAGGGGCAGAAGG + Intergenic
1100430864 12:94530833-94530855 CCCTGGGCTTTGGGGTCAGATGG + Intergenic
1101874421 12:108589290-108589312 CCCTGGGGCTGGGGGGCAGTGGG - Intergenic
1102194990 12:111018830-111018852 GCTTGAATCTGGGGGGCAGAGGG - Intergenic
1102679143 12:114678833-114678855 GCCTGAATCTGGAGGTTAGAAGG - Intronic
1102881738 12:116490585-116490607 GCCTGGGGCTGGGGGTAGGGAGG + Intergenic
1102987117 12:117287129-117287151 GCTTGAGTCTGGGAGGCAGAGGG + Intronic
1103178805 12:118889674-118889696 GCCTGTGTCTGTGGGCTAGAAGG + Intergenic
1103563241 12:121803593-121803615 GCTGGGGTCTGGGGGGCCGAGGG - Intergenic
1103723764 12:122987920-122987942 GCCCAGGTCAGGGGGTCGGAGGG + Intronic
1103850118 12:123927673-123927695 GCATGCGTGTTGGGGTCAGAGGG + Exonic
1103905944 12:124327197-124327219 GGCCGGGGCTGGGGGGCAGAGGG + Intronic
1103953529 12:124564905-124564927 GCCTGGGGGTGGGGGGCAGGGGG - Intronic
1104041442 12:125133865-125133887 GCATGGGGCTGGGGGCCAGAGGG - Intronic
1104104141 12:125643075-125643097 ACGTGTGTCTGGGGCTCAGAAGG + Intronic
1104175987 12:126333104-126333126 GGCTGGGCTTGGGGTTCAGATGG + Intergenic
1104305532 12:127607544-127607566 GTCTGGGCGTGGGGGTCAGATGG + Intergenic
1104892319 12:132146163-132146185 GCCTGGGGCTGGGGGTGGAAAGG - Intronic
1104897820 12:132172867-132172889 GCCTGGACCTGGGGGGCAGTGGG + Intergenic
1105540722 13:21313939-21313961 GTCTTGGTCTGGGGTTTAGAAGG + Intergenic
1106699106 13:32209889-32209911 GCCTGTGTCTAGGGGGCAGAAGG - Intronic
1110763111 13:79252385-79252407 GCCTGGGTCTGGGGAGGACAAGG + Intergenic
1112508364 13:99988920-99988942 GCCTGGGCCTGGGGGTGGGGTGG + Intergenic
1112812057 13:103230220-103230242 ACCTGGGTTTGCTGGTCAGATGG + Intergenic
1113490696 13:110689422-110689444 CCCTGGGTCTCAGGGTCACATGG - Intronic
1113808409 13:113123109-113123131 CCCTGGGGCTGAGAGTCAGACGG + Intronic
1113825301 13:113247918-113247940 GCCTGGGTCCTGGGCTCAGCTGG - Intronic
1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG + Intergenic
1114200054 14:20511639-20511661 GCCTAGGTATGGGGGTCTGCTGG + Intergenic
1114513872 14:23285405-23285427 GGCTGGGTACGGGAGTCAGAGGG + Intronic
1114534477 14:23414095-23414117 TCCTCCGTCTGGGGGCCAGAGGG + Exonic
1114693744 14:24608070-24608092 GACAGGGTCAGAGGGTCAGAGGG - Intronic
1115755919 14:36525638-36525660 GCCTAGGACTTGGGGTCTGAAGG + Intergenic
1116085774 14:40236283-40236305 GCCTGGGGTTGGGGGAAAGATGG + Intergenic
1117535465 14:56698694-56698716 CCCTGGGGCTGGGAGTGAGATGG + Intronic
1118362046 14:65064933-65064955 GCCTGGGCCTGGAGGTAGGAGGG - Intronic
1119976547 14:79030404-79030426 GCAGGGTTCTGGGGGTCAGCAGG - Intronic
1121122574 14:91385269-91385291 CCCTGGGTCTGGGGTAGAGATGG - Intronic
1121316687 14:92965079-92965101 GCAGGGGCCTGGGAGTCAGATGG - Intronic
1121506898 14:94484409-94484431 GCCTGGGTATGGGGGATACAAGG + Intergenic
1121732591 14:96196958-96196980 GCCAGGGGCTGGGGGTAGGAGGG + Intergenic
1121798092 14:96752308-96752330 CCCTGGGACTGGAGGTCAGGAGG + Intergenic
1121846033 14:97173228-97173250 TCCTGGGCCTGGGGGTGGGATGG - Intergenic
1122147081 14:99697822-99697844 GCCTGGTTGTGGGGGTCACCTGG + Intronic
1122588952 14:102831640-102831662 GGCTGGGGCTGGGAGACAGAAGG - Intronic
1122782093 14:104147958-104147980 GCTGAGGTCTGGGGGTCTGATGG + Intronic
1122897782 14:104768976-104768998 ACCTGGGGCTGGGGGGCAGATGG + Intergenic
1122936548 14:104960624-104960646 GCCTGGGGCTGGGAGTGGGAAGG + Intronic
1122959673 14:105088589-105088611 GCCTGGGTCCGGAGCACAGAGGG - Intergenic
1122961237 14:105094413-105094435 ACCTGGGCCTGGGGGACAGAGGG - Intergenic
1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG + Intergenic
1123053848 14:105560137-105560159 GGAAGGGCCTGGGGGTCAGAGGG + Intergenic
1123078431 14:105680554-105680576 GGAAGGGCCTGGGGGTCAGAGGG + Intergenic
1124406397 15:29396263-29396285 GCCCGGGGCTGGGGGAGAGAGGG - Intronic
1125325833 15:38535207-38535229 GCCTTGGGCTGGGAGTGAGAGGG - Intronic
1125758826 15:42083661-42083683 GCCTGGATGTGGGGGTGAGGAGG - Intronic
1127958600 15:63874025-63874047 GTCTGGGTCTGGGGGAAAAAAGG - Intergenic
1128133883 15:65248792-65248814 GCCTGGGTCTGTGGGGGAGGAGG - Intronic
1128551447 15:68600555-68600577 GCCTGGGTCCGGGGGTGGGACGG - Intronic
1129166534 15:73781400-73781422 GCCCAGGTCTGGGCATCAGAAGG + Intergenic
1129230746 15:74195982-74196004 CCCAGGGCCTGGGGGTCAGTGGG + Intronic
1129516714 15:76161635-76161657 GCCTGGGCCTGAGGCTCAGATGG + Intronic
1129740220 15:77986400-77986422 GGCTGGGTCTCGGGGGCAGGTGG - Intronic
1130068104 15:80622507-80622529 GCCAGGGGCTGGGGGAAAGAGGG + Intergenic
1130209393 15:81909515-81909537 GCCTGAGTCTGGGCTTCACAGGG + Intergenic
1130256320 15:82327660-82327682 GGCTGGGTCTCGGGGGCAGGTGG - Intergenic
1130598632 15:85262328-85262350 GGCTGGGTCTCGGGGGCAGGTGG + Intergenic
1130703913 15:86213661-86213683 GCTTGGGTCTGTGGGAAAGAGGG - Intronic
1131122171 15:89829466-89829488 CCCACGGTATGGGGGTCAGAGGG - Intergenic
1131142023 15:89984565-89984587 GCCTGGGTCTATGGGTTGGACGG + Intergenic
1131259470 15:90881071-90881093 GCCTGAGTCTGGGGGTAAGGCGG + Intronic
1131783244 15:95883055-95883077 GCCCTGGTCTGGGTATCAGAGGG - Intergenic
1132112501 15:99112557-99112579 GTCTAGGTCTGGGATTCAGAAGG + Intronic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1132951703 16:2566479-2566501 GCCTGGCTCTGTGCTTCAGATGG + Intronic
1132962647 16:2633691-2633713 GCCTGGCTCTGTGCTTCAGATGG - Intergenic
1133099688 16:3471632-3471654 GCCCGGGTCTGGAGGCCACAGGG - Intronic
1133263795 16:4570844-4570866 GCCTGGCTCTGGAGGGCAAAAGG - Intronic
1134076173 16:11293007-11293029 GCCTGGGGGTGGGGTTTAGAAGG + Intronic
1134210665 16:12273769-12273791 GCCAGGGTCTGGGGGAAGGAGGG - Intronic
1134811879 16:17174604-17174626 GCCAGGGGTTGGGGGTCAGAGGG + Intronic
1135663670 16:24317815-24317837 CCCTAGGAGTGGGGGTCAGAGGG - Intronic
1135732467 16:24906596-24906618 GCCTGGGCCTGGGGCTCTGGGGG + Intronic
1135782133 16:25313607-25313629 GCCTGGGTCTTGGGTCCATAAGG + Intergenic
1136540253 16:30924476-30924498 GCCCAGGTCTGGGGGTGAGGAGG - Intronic
1136631222 16:31490302-31490324 GCCGGGGCCTGGGGCTCTGAGGG - Exonic
1137513032 16:49117850-49117872 GCCTGGGTCTGGTGGAGAGTGGG - Intergenic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1138048760 16:53753902-53753924 GCCTCTGGCTGTGGGTCAGAAGG - Intronic
1138381767 16:56607710-56607732 CCTTGGGCCTGAGGGTCAGAAGG - Intergenic
1138382331 16:56611282-56611304 CCTTGGGCCTGAGGGTCAGAAGG - Intergenic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1138845005 16:60554631-60554653 GCCTGGGCTTGGTGGTGAGATGG + Intergenic
1139390611 16:66604804-66604826 GTCGGGGTCTGGGGGCCACATGG - Exonic
1140370277 16:74409648-74409670 GCCAGGGTGTGGTGGTCAGGAGG + Intronic
1140988443 16:80183572-80183594 GCCTGGGACTGGGGGCAAAAGGG + Intergenic
1141474666 16:84264745-84264767 CCTTGGGTCTGGGGGTAACAGGG - Intergenic
1141600843 16:85125324-85125346 GCCTGAGGCTGGGGGGCAGGGGG + Intergenic
1141602703 16:85136172-85136194 GCCCTGGCCTGGGGGTCAGAAGG + Intergenic
1142022289 16:87791435-87791457 GCCTGGGCCAGGGGAACAGAGGG - Intergenic
1142811207 17:2396448-2396470 GCCTGGTTCTGGGTGAGAGAGGG + Intronic
1144781306 17:17809868-17809890 GCCTGGGTCTGGGGCTTAGGCGG + Intronic
1145001240 17:19306208-19306230 GCCAGGCTCAGGTGGTCAGAAGG + Intronic
1145933156 17:28700264-28700286 GCCTGGGACTGGAGGTGGGAAGG + Intronic
1146454225 17:32996806-32996828 GCATAGGCCTGGGGGTCAGATGG - Intronic
1146683707 17:34826471-34826493 GCAAGGGCCTGGGGGTCAGCAGG - Intergenic
1146683772 17:34826761-34826783 TCCTGGGTCTGGGGATCAAAGGG + Intergenic
1146915541 17:36676183-36676205 GGCTGTGTTTGAGGGTCAGAGGG - Intergenic
1147312591 17:39604239-39604261 GCCGGCGTCCGGGGGGCAGAAGG - Intronic
1147558696 17:41496050-41496072 GCCTGGGTCAGGGCATCTGAGGG - Intergenic
1147603983 17:41763623-41763645 GCCTGGGTCTGAGGGCCCCAGGG - Intronic
1147638073 17:41975988-41976010 AAATGGGTCTGGGGGTCAGGAGG + Exonic
1147935329 17:44007516-44007538 GGCGGGGTCTGGGGGGCAGTCGG + Intronic
1147944156 17:44070846-44070868 GGCGGGGCCTGGGGCTCAGAGGG + Exonic
1148187451 17:45654928-45654950 ACCTGGGTCTGGGTGTGGGAAGG + Intergenic
1148490814 17:48023367-48023389 GCCTGGGTGTGGGGTGCAGGGGG - Intergenic
1148840798 17:50495508-50495530 GGCTGGGGCTGGGGGTGAAAGGG + Intergenic
1149458320 17:56807475-56807497 GCCTGGGTCTGCATGTCTGACGG + Intronic
1149773238 17:59337883-59337905 GCCTGGGTCTGGGAAACAGAAGG - Intronic
1150243721 17:63657476-63657498 GCCTGGGGCTGGAGGTGGGAAGG + Intronic
1150338007 17:64344102-64344124 GCCTGGGTCGGAGGGTGAGCTGG - Intronic
1151670879 17:75571112-75571134 GCCTGGGGTTGGGGGGCAGGGGG + Intronic
1151708526 17:75785573-75785595 GCCTGAGTCTGGGAGCCCGAAGG + Intronic
1151727990 17:75895466-75895488 GCCAGGCCCTGGGGGTCAGCAGG - Intronic
1151730993 17:75910923-75910945 GCCTGGCTCTGGGAGTCAGCAGG + Intronic
1151831885 17:76557615-76557637 CCCTGGAGCTGGGGGTAAGATGG - Intergenic
1151834606 17:76574532-76574554 GCCTGGCCCTGTGGGTGAGAAGG + Exonic
1151933366 17:77247084-77247106 GCCTGGGCCGGCGGGGCAGAGGG + Intergenic
1151942982 17:77304519-77304541 GCCTGGTGCTAGGGGGCAGAAGG + Intronic
1151944222 17:77310803-77310825 GCCGGGGTCTGAGGGCCAGAGGG - Intronic
1152235947 17:79138863-79138885 GCCTGCGTGTGTGGGTGAGAGGG - Intronic
1152795511 17:82304321-82304343 CCCTGGGGCTGGGGGTGGGAAGG + Intergenic
1153530273 18:6039042-6039064 GCATGGGGCTGGGGGAGAGAGGG - Intronic
1154266529 18:12883739-12883761 GCCCGGGTCTGGGGGTCCTTGGG - Intronic
1157500190 18:48185132-48185154 GCATGGGTCTGAGGGTGGGAGGG - Intronic
1157758247 18:50237748-50237770 GCCTGGTTGTGGTGATCAGAAGG + Intronic
1158395687 18:57077160-57077182 GCCTGAGTCTGTGGGGCAGAGGG + Intergenic
1160425153 18:78774082-78774104 GCCTGGCTGTGGGGGACACAGGG + Intergenic
1160499298 18:79394439-79394461 GCGGGGGTCGGGGGGTCAGGGGG - Intergenic
1160905807 19:1451285-1451307 GCCTGGGTTTGGGGAGCAGGAGG + Exonic
1160931919 19:1574885-1574907 GCCTGGGTCTGGGGGCTGCAGGG + Intronic
1160946440 19:1646090-1646112 GCCTGGGTCTGGGGGCTGGGTGG - Intronic
1160987327 19:1845084-1845106 GCCTGGGTTCTGAGGTCAGATGG + Intronic
1161022040 19:2015196-2015218 GCGGGGGTCTCGGGGACAGAGGG + Intronic
1161261279 19:3339069-3339091 ACCTGAGGCTGGAGGTCAGAGGG + Intergenic
1161466016 19:4430894-4430916 GCCATGGTCTGTGGGTTAGAAGG + Intronic
1161665399 19:5572973-5572995 GCCTGGGTCTGTGGATTAGAGGG + Intergenic
1161904728 19:7148279-7148301 CCCTGGGTGATGGGGTCAGAAGG - Intronic
1162327483 19:10007590-10007612 GGCTGGGGCAGGGGGTCAGTGGG - Intronic
1162405911 19:10473687-10473709 GCTTTGGGCTGGGGGTCAGGAGG + Intergenic
1162568768 19:11458610-11458632 ACCTGGGTGAGGGGGTCAGATGG + Exonic
1162794452 19:13079271-13079293 GGCTGGGTCTAGGGGACAGGTGG + Intronic
1162904907 19:13817707-13817729 GCCTGAGTCTGGGGGAGACAGGG - Exonic
1163002384 19:14376209-14376231 GGCTGAGGCGGGGGGTCAGATGG - Intergenic
1163509021 19:17724459-17724481 GCGTGGGTCTGGAGGTGGGAAGG + Intronic
1163762005 19:19142341-19142363 GCTGGGGTCTGGGGTGCAGATGG + Intergenic
1163834556 19:19565245-19565267 CCCTGGGTCCGTGGTTCAGAGGG - Intronic
1163845176 19:19634598-19634620 GGCTGGGGCTGGGGGTCCCAGGG + Exonic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166648762 19:44553903-44553925 TGCAGGGTCTGGGGGTCAGGGGG + Intergenic
1166993086 19:46704877-46704899 TTCAGGGTCTGGGGGACAGATGG - Intronic
1166993116 19:46704996-46705018 TTCAGGGTCTGGGGGACAGATGG - Intronic
1167010231 19:46802340-46802362 GCCTTGCCCTGGGGGTCTGAGGG + Intergenic
1167490093 19:49787787-49787809 GCCAGGGGCTGGGGGGAAGAGGG - Intronic
1167566810 19:50261891-50261913 GCCTGGGTCTGGGTTTCCCAGGG + Intronic
1167695947 19:51015729-51015751 GCCTGGGTCTGTGAGTCTGAGGG - Intronic
1167795528 19:51705721-51705743 GCCTGGGCCTTGGAGTGAGATGG - Intergenic
1168129886 19:54311498-54311520 ACCTGTGGCTGGGGGTCACAGGG + Exonic
1168148499 19:54432520-54432542 GCCTGGCTGTGGGGGGCAGAGGG - Intronic
925462417 2:4074913-4074935 GCCTGTGTCTTGGGATCACAGGG + Intergenic
925971628 2:9110491-9110513 GCCTGGAGATGGGGGTCAGTGGG - Intergenic
927853300 2:26513276-26513298 TCCTCACTCTGGGGGTCAGATGG - Intronic
928096924 2:28410428-28410450 GCCTGGGTGGCTGGGTCAGAGGG - Intronic
928444938 2:31325620-31325642 GCCTGGGCCTGGGTGACAGAGGG - Intergenic
929413416 2:41722828-41722850 GCATGAGTCTGGTGGTCAGCTGG + Intergenic
932114869 2:69037157-69037179 GCCTGGGTTTGGGACTCAGATGG - Intronic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
933678479 2:85078305-85078327 GCCTGGGTCTGGGGCTGGCAGGG + Intergenic
933771879 2:85749796-85749818 GCTTGGGTTTTGGGGTCAGTTGG + Intergenic
933772781 2:85754574-85754596 GCCTGGCTCTGGGGCGCAGGAGG - Exonic
933938454 2:87225865-87225887 GGCTGGGTCTGGTGGGCACATGG - Intergenic
934662415 2:96150199-96150221 GCCTGGGCCTGGGGGTGGAAGGG + Intergenic
934708847 2:96502574-96502596 GCATGGGGCTGGGGGTGACAGGG + Intronic
935098000 2:99965715-99965737 GGCTGGGCCTTGGGCTCAGAAGG - Intronic
935334890 2:102006999-102007021 GCCTGGCTCTGAGCGGCAGATGG - Intronic
936246608 2:110833934-110833956 GACAGGGCCTGGGGGTGAGAGGG + Intronic
936354684 2:111739909-111739931 GGCTGGGTCTGGTGGGCACATGG + Intergenic
937236573 2:120434997-120435019 GCCTGGTTCCTGGGGTCAGGGGG - Intergenic
937591167 2:123614841-123614863 GCCTGAGTTTGGGGGAGAGATGG - Intergenic
937914577 2:127092621-127092643 GCCCGGGGCTGCGGGTCAGTGGG - Intronic
939250217 2:139672975-139672997 GCCTGGGACAGGGAGTCTGAGGG + Intergenic
940404375 2:153283929-153283951 GCCTGGGTGTGGAGCTGAGAGGG + Intergenic
941001003 2:160203846-160203868 GCCTGCATCTGGTTGTCAGAGGG - Intronic
941722654 2:168828171-168828193 GCCTGGGCCTGGGCCTCAGAGGG + Exonic
942326666 2:174781930-174781952 GCCAGGGTCTGGGGCTCACACGG + Intergenic
944855349 2:203761967-203761989 TCCTGGGTCTGTAGGTCAGCTGG - Intergenic
946170189 2:217890677-217890699 GCATGAGTCTGGGGATAAGAAGG - Intronic
946299104 2:218811643-218811665 GCTTGGCTCAGTGGGTCAGAGGG - Intronic
946734273 2:222738964-222738986 TCCTGGGTGGGGGGGTCACAAGG + Intergenic
947725182 2:232393715-232393737 CACTGGGTTTGCGGGTCAGATGG + Intergenic
948249351 2:236513201-236513223 GCCTGGGTCCTTGGGTGAGAAGG - Intergenic
948558289 2:238832974-238832996 GCATGAGTCTGAGGGTGAGAAGG + Intergenic
948587509 2:239028416-239028438 GCCAGGTCCTGGGGGTCAGAGGG + Intergenic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948664406 2:239526095-239526117 GCCCTGGACTAGGGGTCAGAAGG + Intergenic
948775285 2:240284806-240284828 GCCTCGGTCAGGAGATCAGAGGG + Intergenic
1168755778 20:316511-316533 GCCTAGGGCTGGGGATTAGAGGG + Intergenic
1168961987 20:1876275-1876297 GCCTGGGTGAGGGGGTCTGAAGG + Intergenic
1172122926 20:32609246-32609268 ACCTGGGTCTGCTGGTCTGAGGG + Intergenic
1172764683 20:37345278-37345300 GCCTGCGCCAGGGGGTAAGAGGG + Intronic
1172968178 20:38853791-38853813 GCCAGTGTCTGGGGCTCAGCTGG + Intronic
1172968844 20:38858835-38858857 ACATGGGTCAGGGGTTCAGATGG + Intronic
1173089368 20:39955632-39955654 GGCTGGGTCTGGAGGTGTGAAGG - Intergenic
1173199349 20:40943302-40943324 GCCTGGGTCTAGGGCTCCCATGG + Intergenic
1173663651 20:44750831-44750853 GCCTGGGTGGGGTTGTCAGATGG - Exonic
1173726116 20:45299131-45299153 GCATGGGTTTTGGAGTCAGATGG - Intronic
1173781101 20:45758287-45758309 GGCTGGAACCGGGGGTCAGAGGG - Intronic
1173864019 20:46302870-46302892 GCCTGGGCATGGGGGAGAGAAGG - Intronic
1174139177 20:48400767-48400789 ACCTGGGCCTTGGGCTCAGAAGG + Intergenic
1174354106 20:49987103-49987125 GCCCTGGGCTGGGGCTCAGAAGG + Intronic
1174988747 20:55485949-55485971 ACCTGAGTCTGGGAGTTAGAGGG - Intergenic
1175218524 20:57404191-57404213 GCCTGGGGCTGTGGGGCAGCTGG - Intronic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175251866 20:57614850-57614872 GCCTGTGTCTGGGCTGCAGAGGG - Intronic
1175355329 20:58361554-58361576 GCCTGGCTCTGGGAATCACATGG - Exonic
1175944392 20:62551938-62551960 GACGGGGTCTGGGGGTCAAGGGG - Intronic
1175994242 20:62805170-62805192 CCCTGGGGCTGGGGGTCGGCCGG - Intronic
1176093589 20:63329589-63329611 GCCTGGAGCTGTTGGTCAGATGG + Exonic
1176128813 20:63487705-63487727 GCCTGGTTCTGTGGATCTGAAGG + Intergenic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176709898 21:10141481-10141503 GCCTGGGTCACAGGGTGAGACGG - Intergenic
1177885853 21:26744749-26744771 GCCTAGGGCTGGGGGATAGAAGG + Intergenic
1178274534 21:31225100-31225122 GCCTGAGCCTGGGAGGCAGAGGG - Intronic
1178378985 21:32092666-32092688 TCCTGGTTCTGGAGGCCAGAAGG + Intergenic
1178544041 21:33479018-33479040 GCCTGGGTCGGGGGGTGCGGAGG - Intronic
1178618195 21:34152488-34152510 ACCAGGCTCTGGGGGTCAGGAGG - Intergenic
1179414660 21:41188555-41188577 CCCTGGGTCTGGGGGGGTGATGG - Intronic
1179486243 21:41712500-41712522 GCTGGGGGCTGGGGCTCAGAGGG - Intergenic
1179580980 21:42343809-42343831 GCCTGGGCTTGGGGGTCCGTGGG - Intergenic
1179997704 21:44981606-44981628 GCCTGCGTGTGGTGTTCAGAGGG + Intergenic
1179997735 21:44981719-44981741 GCCTGCGTGTGGTGTTCAGAGGG + Intergenic
1179997817 21:44982003-44982025 GCCTGCGTGTGGTGTTCAGAGGG + Intergenic
1179997849 21:44982118-44982140 GCCTGCGTGTGGTGTTCAGAGGG + Intergenic
1179997882 21:44982233-44982255 GCCTGCGTGTGGTGTTCAGAGGG + Intergenic
1180987838 22:19915949-19915971 GCCTGGTGCTGTGGCTCAGATGG + Intronic
1181967010 22:26663887-26663909 GGCTGGGACTGGGGCTGAGAGGG - Intergenic
1181978621 22:26750650-26750672 GCCTGAGTCTGTGGATGAGAAGG - Intergenic
1181991951 22:26843771-26843793 GCCTGGGGTTGGGGTTGAGATGG + Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182368348 22:29793505-29793527 GCATGGGTCTGGGGGGCTCAGGG + Intronic
1182679708 22:32069252-32069274 ACCAGGGTCTGGGGGTGAGCGGG + Intronic
1183520166 22:38292323-38292345 GCCAGGCTCTGGGGCCCAGAGGG - Intronic
1183540481 22:38426780-38426802 GGCCGGGCCTGGAGGTCAGATGG + Exonic
1183708654 22:39489855-39489877 AGCTGGGACTGGGTGTCAGAAGG - Exonic
1183736172 22:39646063-39646085 GCCAGGGCCTAGGGGTCTGAGGG + Intronic
1183832328 22:40424933-40424955 GCCTGGCTCTGGGCTTCAGATGG + Intronic
1184694760 22:46133159-46133181 TGCTGGGGCTGGGGGTCCGAAGG + Intergenic
1184855626 22:47144926-47144948 TCCTGGGTCTTGGGGTCTGGAGG + Intronic
1184977139 22:48070290-48070312 GTCTGGGTCTGGGGGAGAGTAGG - Intergenic
1185172879 22:49303895-49303917 GCCTGGGCCTGGCGGGCAGGAGG - Intergenic
1185363652 22:50424242-50424264 GCCTGGCTCTGGGGCTCTGCTGG + Intronic
949505092 3:4719905-4719927 GGCTGGGGCAGGGGGACAGATGG + Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950467259 3:13162851-13162873 GCTAGGGTCTGGGGATCCGAGGG - Intergenic
950574625 3:13824629-13824651 GCATGGGCCTGGGGGCCAGGAGG - Intronic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950639347 3:14338582-14338604 GCCAGGGCATGGGGGTCAGGAGG + Intergenic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
951027791 3:17847876-17847898 TCATGGGTCTGAGGGTCAGTTGG + Intronic
951259971 3:20495872-20495894 GCCTGGGGTTGGGGGAGAGATGG + Intergenic
951674612 3:25223164-25223186 GCCTAGGGCTGGGGGCCAGTTGG - Intronic
953422642 3:42766251-42766273 GGGTGGGTCTGGGGTTCAGAAGG + Intronic
953449900 3:42997269-42997291 TGCTGGGTCTGAGGGTGAGAAGG + Intronic
953914056 3:46906675-46906697 GCCCTGCTCTGGGGGTCTGAGGG + Intergenic
954196887 3:49002296-49002318 GCCGGGGGCTGGGGGTCAAGAGG - Intronic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
954374666 3:50188010-50188032 CCCTGGGGCTGGGGGGCACATGG - Exonic
954385166 3:50240312-50240334 GCCAGGCACTGGGGGTCAGAGGG + Intronic
954512661 3:51140259-51140281 GCCTAGGGCTGGGGGTCTGGAGG - Intronic
954703196 3:52463116-52463138 GCCAGGGGCTGGGGGACAGAGGG - Intronic
954713427 3:52515918-52515940 CCCTGGGACTGGGGTTCTGAGGG + Intronic
955113245 3:55971156-55971178 GCCAGGGGCTGGGGGAAAGAGGG + Intronic
955370622 3:58348345-58348367 GTCTGGTTCTGTGGTTCAGAAGG - Intronic
955387819 3:58492814-58492836 GGCTGTGTCTGGGGGTGGGACGG + Intronic
958895687 3:99827272-99827294 GCTTGAGTCTGGGAGGCAGAGGG - Intronic
960221749 3:115120011-115120033 GCCAGGGGCTGGGGGAGAGAGGG + Intronic
960943456 3:122949789-122949811 TCCTGGGTCGGGGGGCCACAAGG - Intronic
961479983 3:127173415-127173437 GTCTGGGTCTGGGTGGCAGGGGG - Intergenic
961501591 3:127340209-127340231 GGCTGGGTCTGGGAGTCATGGGG - Intergenic
961720528 3:128892117-128892139 GCCTGGGGATGGTGGACAGATGG + Intronic
961769827 3:129240865-129240887 GCCCTGGTCTGGGGATCTGAGGG - Intergenic
962362047 3:134750651-134750673 GCATGGGTCTGGGGAACAAAGGG + Intronic
965784882 3:172324981-172325003 GCCAGGGCCTGGGAGTCAGCTGG - Intronic
966217285 3:177516851-177516873 GCCTGGGGCTGCAGGTCAGTGGG + Intergenic
966217421 3:177517986-177518008 GCCTGGGTCTGCAGATTAGATGG + Intergenic
966463470 3:180203302-180203324 ACCTGGGTTTGGGGGGCACATGG + Intergenic
967959963 3:194912542-194912564 TCCTGGGTCAGGGGAGCAGAGGG + Intergenic
968084097 3:195866978-195867000 GGCTGGGTCTGCGGCCCAGAGGG - Exonic
968674057 4:1867707-1867729 GGCTGGGTGTGTGGGTGAGAAGG - Intergenic
968897269 4:3411940-3411962 GCCTGCGGCTGGGGCTCACACGG - Intronic
968955171 4:3715396-3715418 TCCTGGGTCTGGGGGCCGGTGGG + Intergenic
969494876 4:7520756-7520778 GGCTGAGTCTGGGGGTGAGGTGG + Intronic
969615648 4:8251187-8251209 GCCTGGGGCTGGGGTTTGGAAGG + Intergenic
969630255 4:8331779-8331801 GCCTGGGTCAGATGGGCAGAGGG - Intergenic
969657577 4:8507078-8507100 GCCTGGGCCTGGAGGCCAGCAGG + Intergenic
969849573 4:9945651-9945673 CCCTGAGTCTGGTGGTCTGATGG - Intronic
972455891 4:39254785-39254807 ACCAGGGTCTGGGGGAAAGAGGG - Intronic
973919155 4:55667134-55667156 GCCAGGGGCTGGGGGGCAGGAGG - Intergenic
974258436 4:59492447-59492469 TCCAGGGACTGGGGGTCAGGAGG + Intergenic
977571289 4:98632340-98632362 TCCAGGGTCGGGGGGTCAGAGGG - Intronic
978195671 4:105969088-105969110 GAGTGGGTCAGTGGGTCAGAAGG + Exonic
978822541 4:112981914-112981936 TCCTGGGTGTGGGGGTATGAAGG + Intronic
979641127 4:123013139-123013161 GCAGGGGTCAGGGGGTCACAGGG + Intronic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981871149 4:149487385-149487407 GCCTGGGATTGGGGGAGAGATGG + Intergenic
982671521 4:158325485-158325507 CCCTGGGTCTGGGGGTGCAATGG - Intronic
982899582 4:160981250-160981272 GCCTGGGTTTGGGGGACAGGAGG + Intergenic
984285022 4:177718308-177718330 GCCTAGGACTGGGGGTATGAAGG + Intergenic
984658155 4:182342448-182342470 GCCTAGGGCTGGGGGTGGGAGGG + Intronic
985682519 5:1264020-1264042 CCCAGGGTCTCGGGTTCAGAGGG + Intronic
985875603 5:2591624-2591646 GGCTGGGCCTGGGGGTGTGAGGG + Intergenic
985980817 5:3461623-3461645 ACAGGGGACTGGGGGTCAGAGGG + Intergenic
986000508 5:3627404-3627426 GTCTGGCTCTGGTGGTCAGCTGG - Intergenic
986557385 5:9025381-9025403 GCCTGGGTATGGGGTGAAGAGGG + Intergenic
986740809 5:10703765-10703787 GCCTGGGTGTGGGGGGCACAGGG + Intronic
988340053 5:29959825-29959847 GCCTGGGTCTGGGGGAGGGCTGG - Intergenic
988483445 5:31648560-31648582 GCATGGGTCCAGGGGTGAGATGG - Intronic
988966605 5:36424939-36424961 GCCTGGGGATGGGGACCAGAGGG - Intergenic
989132401 5:38120292-38120314 GCAAGGGGCTGGGGGTCAGCAGG - Intergenic
990482980 5:56229605-56229627 GCCAGGGTCTTGGTGACAGATGG - Intronic
992251747 5:74882962-74882984 GGCTGGGGCGGGGGGTCACAAGG + Intergenic
993416180 5:87635411-87635433 CCCTGGTTCTGGGGGTCAATGGG + Intergenic
994629667 5:102268950-102268972 GCAGGGGTCTGGGGGTGGGAGGG - Intronic
997301320 5:132807686-132807708 GCCTAGGCATGGGGTTCAGAGGG + Intergenic
997698230 5:135878233-135878255 GCCCGGGGCTGTGGGACAGAAGG + Intronic
997826643 5:137112454-137112476 GCCATGGTCTGCGGCTCAGATGG - Exonic
999088557 5:148914702-148914724 GCCTGGGGCTGGAAGTCAGGAGG - Intergenic
999298147 5:150473306-150473328 GCCTGGATAGAGGGGTCAGAGGG + Intergenic
999329082 5:150660637-150660659 GCCTGGGGTGGGGGGTGAGAAGG - Intergenic
999394332 5:151217400-151217422 ACTTGGGGCTGGGGGTGAGAGGG + Intronic
999413979 5:151378854-151378876 ACCTGGGCCTGAGGGCCAGAAGG + Intergenic
999800082 5:155025497-155025519 GCCTGGAGCTGGGGGTGATATGG - Intergenic
1001122606 5:168992676-168992698 GACTGGGGCAGGGGGACAGATGG - Intronic
1001401095 5:171446826-171446848 GCCTGGGGCTGGGGCTCACCGGG - Intronic
1001454274 5:171848702-171848724 GCCTGGCTCTGGAGGGCACATGG - Intergenic
1001872707 5:175170685-175170707 CCCTGGTTCTGTGGGTGAGAGGG - Intergenic
1001906749 5:175479071-175479093 TCCTGGTGCTGGGGGTCGGAGGG + Intronic
1002061043 5:176626366-176626388 GCCTGCATGTGCGGGTCAGAAGG + Intronic
1002521222 5:179794191-179794213 ACCTGGGCCTAGGGGGCAGAGGG - Intronic
1002538927 5:179893529-179893551 GGATGGGTCTGGGGTACAGATGG - Intronic
1002846449 6:949339-949361 GCCTAGGGCTGGGGGCCAGTGGG - Intergenic
1003412499 6:5877882-5877904 GTCTTGGTCTGGGGTTTAGAAGG - Intergenic
1003857922 6:10294512-10294534 GCCTCAGCCTGGGGGACAGAAGG + Intergenic
1004724150 6:18294907-18294929 GCCTGGGTCTCAGAGTGAGAAGG - Intergenic
1005801352 6:29428368-29428390 GCCTGGGGTTGTGGGGCAGAAGG + Intronic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006152493 6:31996900-31996922 GCCTGGGGCATGGGGTCGGATGG - Exonic
1006158799 6:32029637-32029659 GCCTGGGGCATGGGGTCGGATGG - Exonic
1006444090 6:34069226-34069248 GCCTGGCTTTGGAAGTCAGAAGG - Intronic
1006635046 6:35456007-35456029 GGCTGGGCCTGGGGGGCAGGAGG + Exonic
1006700810 6:35971717-35971739 GCCTGGATTTTGGAGTCAGATGG - Intronic
1006747326 6:36352478-36352500 GACTGGGGTTGGGGGTGAGAGGG - Intergenic
1007403014 6:41615326-41615348 GCCTGGGACAGAGGTTCAGATGG - Intergenic
1007502157 6:42306553-42306575 GCCTGAGGCTGGGGAGCAGATGG - Intronic
1008280295 6:49588362-49588384 GCCTGGGCCGGGGTGACAGAAGG + Intergenic
1008598498 6:53065859-53065881 GCCTAGGGCTGGGGGTCGGCGGG + Intronic
1008810563 6:55492817-55492839 GCCTGGGACTCTGGGGCAGAAGG - Intronic
1008927381 6:56901146-56901168 GTATGGGTTTGGGCGTCAGATGG + Intronic
1010966876 6:82220670-82220692 TCTTGTGTCTGGGGGTCATATGG - Exonic
1013771642 6:113634511-113634533 GCCTGGGTCCGGGTGTTAAATGG + Intergenic
1015908759 6:138145668-138145690 GCCTGGGTATAGAAGTCAGAGGG - Intergenic
1017186330 6:151604384-151604406 GCATGCTCCTGGGGGTCAGATGG + Intronic
1017407337 6:154134533-154134555 GCCTCGGCCTGGGGATTAGAGGG - Intronic
1017672405 6:156779277-156779299 GCCTGGGACTGGGGCTGCGACGG - Exonic
1017715808 6:157212224-157212246 GCGTGGGGCTTGGGGTCAGGAGG - Intergenic
1017784826 6:157746909-157746931 GGGTGGGTCGTGGGGTCAGAGGG + Intronic
1018933713 6:168259785-168259807 GCCCGGGTCTGTGGGTCACCAGG + Intergenic
1019340477 7:506679-506701 GCTTGGGTCTGGGGGAGAGTCGG + Intronic
1019382008 7:728705-728727 GCTTGGGGCTGGGGCACAGATGG - Intronic
1019506887 7:1395853-1395875 CCCTGGGTCTGGGTCCCAGACGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1022275735 7:28854059-28854081 CCCTGGGTCTGAGAGTAAGAGGG + Intergenic
1022474225 7:30699776-30699798 GCCTGGGTGAGGGGGTCTCAGGG - Intronic
1022519271 7:30995344-30995366 ACCTGGCTCTGTGGGGCAGAAGG + Intergenic
1022863536 7:34392983-34393005 GCCTGGGTCTATAGGTCAGATGG + Intergenic
1022995509 7:35751068-35751090 GCCTGGGTTTGAGGGGCTGATGG + Intergenic
1023874462 7:44279209-44279231 CCCAGGGTCTGGGGCCCAGATGG + Intronic
1024473078 7:49783307-49783329 GCTTGGGTCAGGGGGTCAAGGGG + Intronic
1024526656 7:50355050-50355072 GCCTGGGTCTTGGGGGAAGGTGG + Intronic
1025261984 7:57425850-57425872 GGCTCGGTGTGGGGGCCAGACGG - Intergenic
1026287041 7:68972405-68972427 GCCTTGCTCTGGGGGACAGGAGG - Intergenic
1026776012 7:73231557-73231579 ACCTGGGTGTAGGGGGCAGAGGG + Intergenic
1026841064 7:73670117-73670139 GGCTGGGGCTGGGGGCCAGGAGG + Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027016869 7:74784928-74784950 ACCTGGGTGTAGGGGGCAGAGGG + Intronic
1027071158 7:75161008-75161030 ACCTGGGTGTAGGGGGCAGAGGG - Intergenic
1027192285 7:76003703-76003725 GCCTGTGTCTGGGAAGCAGAGGG - Intronic
1027265933 7:76495297-76495319 CCCTGGCCCTGGGTGTCAGAAGG + Intronic
1027317307 7:76993414-76993436 CCCTGGCCCTGGGTGTCAGAAGG + Intergenic
1030096642 7:105906518-105906540 GCCAGTGTTTGGGGGACAGAAGG + Intronic
1032572232 7:133012679-133012701 GCTTGAGTCTGGGAGACAGAGGG + Intronic
1034026352 7:147708492-147708514 GCCTAGGGCTTGGGGGCAGAGGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034484600 7:151351079-151351101 GCCAGGGGCTGGGGGGCAAAGGG + Intronic
1034628968 7:152515881-152515903 GGCTGGGCCTGTGGGTCAGATGG - Intergenic
1034859579 7:154583945-154583967 GCCTGGGCCAGGGAGACAGAAGG - Intronic
1035056407 7:156039451-156039473 GCCTGGGTCTGGCGATCTCAGGG - Intergenic
1035262699 7:157671830-157671852 GCCAGGGTCTGGGGGCCTGCTGG + Intronic
1035280523 7:157775630-157775652 GCCTGGGTGTGGGGCTGAGGCGG + Intronic
1035387934 7:158486933-158486955 GCCAGGGGCTGGGGGACAGTTGG - Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1035625393 8:1067215-1067237 CCCAGGAACTGGGGGTCAGATGG - Intergenic
1035659760 8:1338466-1338488 GCCTGGGTCTGGGGGCAGGAAGG + Intergenic
1035740972 8:1928577-1928599 GCCGGGGTCTCGGGGTCCGGGGG - Exonic
1035900857 8:3457101-3457123 GCCTGGGTGAGGGATTCAGAGGG - Intronic
1037831813 8:22194306-22194328 GCCTGGGACTGGGGGTTTGGTGG + Intronic
1038411350 8:27362026-27362048 GACTGGGTCTGTGGGTGACAAGG + Intronic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1040928941 8:52714301-52714323 GTCTGGGGCCGGGGGACAGAAGG + Exonic
1043475105 8:80598359-80598381 GACTGGGTCTGAGGATTAGACGG - Intergenic
1043731952 8:83694214-83694236 GCCTGGGGCTGGCGGTCGGCGGG + Intergenic
1044820469 8:96152824-96152846 GCCTGGGTCTGGAGGCCTGAGGG - Intronic
1044836215 8:96297966-96297988 ACCAGGTTCTGGGGGTGAGATGG - Intronic
1045108852 8:98920459-98920481 GGCTGGGTCTGGGAGCCAGTGGG + Intronic
1045601584 8:103723435-103723457 GCTGGAGTCTGTGGGTCAGATGG + Intronic
1046557234 8:115790281-115790303 GCCTGGGGTTGGGGGAAAGATGG - Intronic
1046666114 8:117005184-117005206 GCCTAGAACTGGGAGTCAGAGGG - Intronic
1046768746 8:118098041-118098063 CCCTGGGGCTGGGGATGAGAAGG + Intronic
1047424377 8:124731840-124731862 GCCTAGGCCTGGGGGACAGCTGG + Intergenic
1047526180 8:125636169-125636191 GCCTGGGGCTGGGGGTGACAGGG + Intergenic
1047606490 8:126479883-126479905 GCCTGGGTCATGGAGTGAGATGG - Intergenic
1048118881 8:131556196-131556218 GCCTGGAGCTGTGGGTCAGGTGG - Intergenic
1048334446 8:133492195-133492217 GCCTGTCCCTGGGGGTCAGGAGG + Intronic
1049252952 8:141598925-141598947 GGCAGGGTCTAGGGGTCAGGTGG - Intergenic
1049254206 8:141605248-141605270 GCCCGAGTCAGGGGGCCAGAAGG + Intergenic
1049334187 8:142073899-142073921 TCCTGGGGTTGGGGGACAGATGG - Intergenic
1049340619 8:142110550-142110572 TGCTGGGTCTGCTGGTCAGAGGG - Intergenic
1049352454 8:142171458-142171480 GCCAGGGCCTGGGGGGCAGCTGG + Intergenic
1049354788 8:142182333-142182355 GCCTGGGCCTGGGGGTGGCAGGG + Intergenic
1049406020 8:142452192-142452214 GCCTCGATCTGGGGGGCAGAAGG + Intronic
1049797410 8:144503051-144503073 GCCCCGGCCTGGGGGCCAGAGGG + Intronic
1050052699 9:1619805-1619827 GACGGGGTCTGGGGGGCAGTGGG + Intergenic
1050687850 9:8191316-8191338 GCCTGGGTGAGGGGGCAAGATGG - Intergenic
1052459720 9:28747130-28747152 TCCTGGGTCTGGGGTTTATATGG - Intergenic
1053013862 9:34650891-34650913 GCCTGGGCCTGAGGGTTTGATGG + Exonic
1054924670 9:70577339-70577361 GCGTGGGTCTAGAAGTCAGATGG + Intronic
1055490899 9:76804554-76804576 GCCTGGCTCTGGAGGGCACATGG - Intronic
1055593654 9:77843886-77843908 GGATGGGTCTGTGGCTCAGAGGG + Intronic
1055940821 9:81647786-81647808 GCATGGGCCTTGGGATCAGATGG - Intronic
1056399014 9:86209112-86209134 GCCTGGGGCTGGAACTCAGAAGG - Intergenic
1056446859 9:86674768-86674790 ACATGGGTCTGGGGGTCAGCTGG - Intergenic
1057441866 9:95089213-95089235 ACCGGGGTCTCGGGGTCAGTAGG + Intergenic
1057739128 9:97696882-97696904 GCCCGGGGCTGGGGGTCAGGAGG + Intronic
1057905045 9:98976720-98976742 GCCTGGGTGTGGGGGAGACAGGG + Intronic
1057943200 9:99302836-99302858 TCCTGGTTCCTGGGGTCAGAGGG - Intergenic
1058485095 9:105435668-105435690 GCCTGTATGTGTGGGTCAGAGGG + Intronic
1060251545 9:121990245-121990267 GCATGGGTGTTGGAGTCAGATGG + Intronic
1060508686 9:124216751-124216773 GCCGTGGGCTGGGGCTCAGAGGG + Intergenic
1060810013 9:126606363-126606385 GCCTGGGTCTGGATGCCCGAGGG + Intergenic
1061289105 9:129640829-129640851 CCCTGGCTCTGTGGGTCACAGGG + Intronic
1062283892 9:135764628-135764650 GCCTATGTCTGGGGGGCAGGTGG - Intronic
1062578891 9:137221187-137221209 GCCTCGGGCCCGGGGTCAGAGGG + Exonic
1202794661 9_KI270719v1_random:110478-110500 GCCTGGGTCACAGGGTGAGACGG - Intergenic
1186602203 X:11049982-11050004 GCCTGGGTTTGGGGATGAGGTGG + Intergenic
1189743049 X:44141655-44141677 TCCTGGGTCTTTGGGTCTGAAGG - Intergenic
1190333017 X:49247490-49247512 GCCTGGGCCTGGGGCTCCTAAGG - Exonic
1190341580 X:49300570-49300592 GCTTGAGCCTGGGAGTCAGAGGG - Intronic
1190750723 X:53359295-53359317 GCCTGGGTTTGGGAATCTGATGG - Intergenic
1194012793 X:88583158-88583180 GCCTGGGTCATGGGGGAAGAGGG + Intergenic
1194388976 X:93292812-93292834 GCCTGGGGCTGGAGGACAGGTGG - Intergenic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1197837197 X:130707814-130707836 GCATTGGTCTGGGAGTCAGATGG + Intronic
1198936219 X:141904324-141904346 GCCTTGTTCTGGGGGTCCCATGG + Intronic
1198960134 X:142174754-142174776 GCCTTGGTCTGGGGGTCCCATGG - Intergenic
1198963360 X:142204851-142204873 GCCTTGGTCTGAGGGTCCCATGG - Intronic
1199346156 X:146743589-146743611 GCCTTGGTCTGGGGGAGAAATGG + Intergenic
1199787773 X:151120152-151120174 GCCTGGGCCTGGGGCTCTGAAGG - Intergenic
1200086904 X:153611454-153611476 GCCAGGGTGAGGGGGTGAGAGGG + Intergenic
1200212460 X:154352815-154352837 GCCTGGCTCTGTGGGGCAGTAGG + Exonic
1200937418 Y:8750367-8750389 GCCTTGGCCTGGTGTTCAGATGG - Intergenic
1200954431 Y:8929924-8929946 ACCTGGGTCTGGGGGAGGGATGG - Intergenic