ID: 1132846229

View in Genome Browser
Species Human (GRCh38)
Location 16:2002080-2002102
Sequence GCTCCAGCCTGGCCGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 476}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132846216_1132846229 21 Left 1132846216 16:2002036-2002058 CCCTGAGGGAGCAAGAGCTCCTG 0: 1
1: 0
2: 0
3: 56
4: 277
Right 1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG 0: 1
1: 0
2: 0
3: 37
4: 476
1132846214_1132846229 28 Left 1132846214 16:2002029-2002051 CCCGAGACCCTGAGGGAGCAAGA 0: 1
1: 0
2: 3
3: 27
4: 308
Right 1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG 0: 1
1: 0
2: 0
3: 37
4: 476
1132846222_1132846229 2 Left 1132846222 16:2002055-2002077 CCTGGCACACAAGGGGTGCTCGG 0: 1
1: 0
2: 8
3: 61
4: 497
Right 1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG 0: 1
1: 0
2: 0
3: 37
4: 476
1132846217_1132846229 20 Left 1132846217 16:2002037-2002059 CCTGAGGGAGCAAGAGCTCCTGG 0: 1
1: 0
2: 0
3: 26
4: 332
Right 1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG 0: 1
1: 0
2: 0
3: 37
4: 476
1132846215_1132846229 27 Left 1132846215 16:2002030-2002052 CCGAGACCCTGAGGGAGCAAGAG 0: 1
1: 1
2: 1
3: 29
4: 269
Right 1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG 0: 1
1: 0
2: 0
3: 37
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132846229 Original CRISPR GCTCCAGCCTGGCCGGAGGG TGG Intronic
900397731 1:2460115-2460137 GCTCTAGCCTGGCCTAAGGGAGG + Intronic
900422677 1:2562395-2562417 GCTGCCGCCTGGCTGGAGGATGG - Intronic
901882814 1:12204066-12204088 GCTCCACCCTGGCCCAAGGAGGG - Intronic
902409833 1:16206328-16206350 GCTCAAACTTGGCCTGAGGGAGG + Exonic
903082344 1:20820539-20820561 GGTCCTCCCTGGCCTGAGGGTGG - Intronic
903311916 1:22465516-22465538 GCCCCTGCCTGGCCTGAAGGAGG + Intronic
903389587 1:22954422-22954444 GCTACAGCCTGGAAGAAGGGAGG - Intronic
903420822 1:23217114-23217136 GGACCTGCCCGGCCGGAGGGAGG - Intergenic
903770118 1:25758541-25758563 GAGCCAGCCTGGCCAAAGGGGGG + Intronic
904251007 1:29224284-29224306 GCTCCTGTCTGGCTGGAGGCTGG + Intronic
904622757 1:31785117-31785139 TCCCCAGCCTGGCCAGATGGTGG - Intergenic
905170147 1:36105086-36105108 GACCTAGCCTGGCCTGAGGGAGG - Intronic
905538175 1:38740268-38740290 GCTACAGCTTGGAGGGAGGGTGG - Intergenic
905647237 1:39633160-39633182 GCTGCAGGCGGGGCGGAGGGCGG - Intronic
907305676 1:53511776-53511798 GCTGGGGCCTGGCCGGAGAGTGG + Intronic
910416476 1:87004356-87004378 GCTCCAGCCTGGGCGATGGAGGG + Intronic
910601194 1:89034266-89034288 GCAGCAGCCTGGCAGGAGGAGGG - Intergenic
911700773 1:100949727-100949749 GCTGCAGCCTGGCTGGGGGAGGG - Intronic
912410930 1:109480295-109480317 GCCCCAGCCTGGTGGGTGGGAGG - Exonic
912636203 1:111295989-111296011 GCAGCAGCCTGGCAGGAGGAGGG + Intronic
913680575 1:121185154-121185176 GCTCCAGCCCGGCGGCCGGGAGG - Intronic
914032406 1:143972796-143972818 GCTCCAGCCCGGCGGCCGGGAGG - Intergenic
914157039 1:145095171-145095193 GCTCCAGCCCGGCGGCCGGGAGG + Intronic
914871524 1:151478864-151478886 GCCCAAGCCTTACCGGAGGGAGG - Intergenic
915492455 1:156258760-156258782 GCTCCAGCCTGGCAACAGAGTGG + Intronic
917041602 1:170811151-170811173 GCTGCAGCCTGGCAGGGGGAGGG + Intergenic
917930300 1:179818083-179818105 GCTCCAGCTGGGGAGGAGGGTGG + Intergenic
918309079 1:183272740-183272762 GTTCCAGCCTGGCTGGAGGCCGG + Intronic
918616571 1:186551024-186551046 GCTGCAGCCGGGCCGGGGGAGGG - Intergenic
919905590 1:202076149-202076171 TCTCCAGCCTGGCGTGAGGAAGG - Intergenic
919912255 1:202118831-202118853 GCTCCAGCTTGTCCAGAGAGAGG + Intergenic
920314271 1:205066359-205066381 GCTCAAGCCTGGCTGGGAGGAGG + Intronic
920376690 1:205512562-205512584 GGCCCAGCCTGGTGGGAGGGAGG + Intronic
920467884 1:206203680-206203702 GCTCCAGCCCGGCGGCCGGGAGG - Intronic
921269272 1:213452736-213452758 CCGCCAGCCTGGGAGGAGGGTGG - Intergenic
922612995 1:226943932-226943954 GGTCCTGCCTGGCCTGAGTGTGG + Intronic
922685332 1:227634378-227634400 GCACCAGCTTGGCCACAGGGAGG + Intronic
923168703 1:231392964-231392986 GCTCAAGCCTGGCCAGAAGTTGG + Intronic
923251165 1:232180664-232180686 GCTACAGCCTGGCCCGTGGGAGG + Intergenic
1062785554 10:261698-261720 ACTCCAGCCTGGCAACAGGGTGG + Intergenic
1062895172 10:1097669-1097691 GCCCCAGCATGCCTGGAGGGTGG + Intronic
1062906736 10:1184640-1184662 GCTCCAGCCTGGTCTGGGGGCGG + Intronic
1066086833 10:31979329-31979351 GCCCCCGCCTGGCAGGAGGGAGG - Intergenic
1066255566 10:33675433-33675455 GCTGCAGCCTGGCCAGAGACAGG - Intergenic
1066977655 10:42384348-42384370 GCGTCTTCCTGGCCGGAGGGAGG + Intergenic
1067045559 10:42983312-42983334 GCTGCAGCTGGGCCAGAGGGAGG - Intergenic
1067732265 10:48820749-48820771 GCTGGAGCCTGGCCCAAGGGGGG + Intronic
1067809666 10:49417386-49417408 CCTCAAGCCTGGCCTGGGGGTGG - Intergenic
1069452260 10:68527241-68527263 GCTCCTTTCTGGCCGGAGGTGGG - Exonic
1069692494 10:70363221-70363243 ACTCCAGCCTGGGCAAAGGGAGG + Intronic
1069814787 10:71186895-71186917 GCTCTGGCCTGGGCGGAGGTGGG + Intergenic
1069898560 10:71694291-71694313 GCAGCAGCCTGGCCGGCGAGGGG - Intronic
1070064693 10:73021919-73021941 GTTGCAGCCTGGCTGGAGGAGGG + Intronic
1070757990 10:79005407-79005429 GCTCCTGTCTGGCCGGGGGCAGG - Intergenic
1070804901 10:79265218-79265240 GGTCCAGTCTGGCCTGAGAGAGG - Intronic
1071066717 10:81644682-81644704 GCTGCAGCCTGGCGGGGGAGTGG - Intergenic
1071096299 10:81979154-81979176 ACTCCAGCCTGGCGACAGGGCGG + Intronic
1071693195 10:87844350-87844372 CCTCCAGTCTGGCAGGAAGGGGG - Intergenic
1072000775 10:91193607-91193629 CCTCCACCCTGGATGGAGGGTGG + Intronic
1073154944 10:101338948-101338970 ACTCCAGCCTGGGCGATGGGAGG - Intergenic
1075728615 10:124623309-124623331 GCTGCAGCCTGGCGGGACCGCGG - Exonic
1075808737 10:125209023-125209045 GCCCCAGCTCGGCGGGAGGGTGG + Intergenic
1076251093 10:128984413-128984435 GCTCCAGCCTGGCTGCACTGGGG + Intergenic
1076621582 10:131792454-131792476 GCTCCAGGCTGCCCCGGGGGAGG + Intergenic
1077282620 11:1752567-1752589 GCTCCAGCCTGGTCGGCCAGCGG - Intronic
1077358674 11:2130184-2130206 GCTCCTGGCTGGCCTGAGGCTGG - Intronic
1078175740 11:8968384-8968406 ACTCCAGCCTGGGCGCATGGTGG + Intergenic
1078411414 11:11122839-11122861 GCTCCAGCATGACCTCAGGGAGG + Intergenic
1078690015 11:13570247-13570269 GCTGCAGCCTGGCGGGGGAGGGG + Intergenic
1079592016 11:22192944-22192966 GAGCCAGCCGGGCCGGGGGGCGG + Intergenic
1079653986 11:22965625-22965647 GCTGCAGCCTGGCAGGGGGAGGG - Intergenic
1080033602 11:27688251-27688273 GCTCCAGCTTGGTCGGGGGAGGG - Intronic
1080346847 11:31335116-31335138 GCAGCAGCCTGGCAGGAGGAGGG - Intronic
1080641712 11:34162299-34162321 GCTCCAGCCAGGCAGGGTGGAGG + Intronic
1081561981 11:44226176-44226198 GCTCCAGTCTGGCTAGAGGTTGG - Intronic
1083402505 11:62433693-62433715 GCTCCAGCCAGGCCAGACCGAGG - Intronic
1083624060 11:64062943-64062965 GCTCCAGCATGGCCTGGGGCTGG + Intronic
1084153198 11:67300779-67300801 GCCCCAGCCTGGGCCCAGGGAGG + Intronic
1084386260 11:68844230-68844252 GCTGCAGCGTGGTCGGCGGGAGG - Intronic
1084617507 11:70246361-70246383 GTTCCTGCCTGGCCAGTGGGTGG + Intergenic
1084776479 11:71380315-71380337 GCTCCAGCCTTGACTGTGGGTGG + Intergenic
1085155048 11:74285898-74285920 GCTCCAGCCCATCCGGAAGGAGG - Exonic
1085280402 11:75326183-75326205 GCTCCAGGCTGGGAGGAGGAGGG + Intronic
1085641751 11:78197173-78197195 GGGTCAGCCTGGCCGGAGGGAGG + Intronic
1087311159 11:96545411-96545433 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1090216298 11:124968370-124968392 GCAGCAGCCTGGCTGGAGGAGGG - Intronic
1090273150 11:125401863-125401885 GCACCAGCCTGGCCTGGGGAGGG + Intronic
1090467160 11:126944737-126944759 GCTCCAGCCTAGACTGAGAGAGG - Intronic
1090517890 11:127448183-127448205 GCTCCAGGCAGGCCGGACGGAGG - Intergenic
1091205656 11:133819094-133819116 GCTCCAGCCTTGCTGGATGAGGG + Intergenic
1091316686 11:134618852-134618874 GCTGCTGCCTGGTGGGAGGGAGG + Intergenic
1091360667 11:134976562-134976584 GTTCTAGCCTGGGTGGAGGGAGG - Intergenic
1091645707 12:2270869-2270891 CCTCCAGCCTGGCCAGAGAGGGG - Intronic
1091786133 12:3244397-3244419 GCTCCACCCCAGCCGGAAGGAGG + Intronic
1091829122 12:3536688-3536710 GCCCCAGCCAGGCTGGATGGAGG + Intronic
1093367948 12:18326616-18326638 GCTCCAGCCTGGTCTGAGTCTGG + Intronic
1093745104 12:22731426-22731448 TCTCCAGGCTGACAGGAGGGAGG - Intergenic
1093900416 12:24625334-24625356 GCTGCAGCCTGGCGGGGGGAGGG - Intergenic
1094430745 12:30367069-30367091 GCTGCAGCCTGGCGGGGGGAGGG - Intergenic
1094482318 12:30894763-30894785 GCTGCAGCCTGGCGGGGGGAGGG - Intergenic
1094759980 12:33521143-33521165 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1095206282 12:39443336-39443358 TCCCCAGCCTGGCCGCTGGGAGG - Intronic
1096245266 12:49981382-49981404 GCTCCAGCCAGGCCAGCGTGTGG + Intronic
1097148541 12:56958647-56958669 GCAGCAGCCTGGCAGGAGGAGGG + Intronic
1097177129 12:57149730-57149752 GCTCCAGACTGGCTGGTGGAAGG + Intronic
1098176021 12:67792346-67792368 GCTGCAGCCTGGCAGGGGGAGGG - Intergenic
1098230148 12:68365137-68365159 GGCCCAGCCAGGCCGTAGGGAGG + Intergenic
1099410088 12:82314577-82314599 GCTGCAGCCTGGCGGGAGGAGGG - Intronic
1101009544 12:100435353-100435375 ACTCCAGCCTGGCCACAGAGTGG - Intergenic
1101706329 12:107224577-107224599 ACTCCAGCCTGGCAGGAGTGAGG - Intergenic
1102045041 12:109824434-109824456 GCTCCAGCCCAGGAGGAGGGAGG + Intronic
1102058001 12:109911119-109911141 GCTCCCGCCTGGCCAGGTGGAGG - Exonic
1102810246 12:115818167-115818189 TCTGCATCCTGGCCGTAGGGAGG - Intergenic
1103091966 12:118103977-118103999 GCTCCCGCCTGGCTGGGAGGCGG - Intronic
1103120607 12:118376716-118376738 GCTCCAGCCTGGGCCGGGGCCGG - Exonic
1103929243 12:124440421-124440443 GGCCCACCCTGGCCGGGGGGCGG - Intronic
1104946686 12:132417763-132417785 GCTCCAGCTGGGCAGGAGGCTGG - Intergenic
1106630598 13:31467911-31467933 GCCCCAGCCTGGCAGAAGGCTGG - Intergenic
1107281974 13:38746943-38746965 GCTCCAACCTGGCCGGTGTTTGG - Intronic
1107430748 13:40338212-40338234 GCTCCAGCCTTGCAGGTGGGTGG + Intergenic
1107862983 13:44678472-44678494 GCTCCTGCCTGGCTGCAGAGGGG - Intergenic
1108615627 13:52129096-52129118 GCTCCGCCCCGGCCGCAGGGAGG - Intergenic
1110071560 13:71184690-71184712 GCAGCAGCCTGGCTGGAGGAGGG + Intergenic
1111589278 13:90322880-90322902 GCTCCAGCCTGGCCAACAGGTGG + Intergenic
1113808233 13:113122264-113122286 GTGCCAGCCTGGCCTGTGGGAGG + Intergenic
1114259100 14:21024966-21024988 GCGCCAGCCGGGCCGGCGGGCGG - Intronic
1114981297 14:28168388-28168410 GCTGCAGCCTGGCTGGGGGATGG + Intergenic
1115843669 14:37502026-37502048 GCTGCAGCCTGGCAGGGGGAGGG + Intronic
1115993213 14:39170553-39170575 GCTCCCGCCTGGCCCGGGCGCGG + Intergenic
1116489818 14:45492521-45492543 GTTCCAGCTTGGCCATAGGGCGG - Intergenic
1116821959 14:49634892-49634914 GCACCAGCCTGGACGGGGCGCGG - Exonic
1117286651 14:54291918-54291940 GCTGCTGCCTGGGAGGAGGGAGG - Intergenic
1117887654 14:60382028-60382050 GCAGCAGCCTGGCTGGAGGAGGG + Intergenic
1117892662 14:60443451-60443473 GCTGCAGCCTGGCAGGGGGAGGG + Intronic
1118559871 14:67067668-67067690 GCTGCAGCCTGGCGGGGGGAGGG - Intronic
1119326133 14:73760457-73760479 GCGCCAGCCTGGGCGGGGGATGG - Intronic
1122379005 14:101288260-101288282 GCTCCAGCCTGGCTCCAAGGAGG - Intergenic
1122451697 14:101813787-101813809 GCTCCAGCCTGGTGGGATGTTGG + Intronic
1122780594 14:104141815-104141837 GCTGCCTCCTGGCAGGAGGGTGG - Intronic
1123705657 15:22949231-22949253 GGACCAGGCAGGCCGGAGGGCGG + Intronic
1124109359 15:26772612-26772634 GCGGCGGCCTGGGCGGAGGGAGG - Intronic
1124937563 15:34186849-34186871 GGTCCTCCCTGGCCTGAGGGTGG - Intronic
1127193733 15:56561817-56561839 GCTGAAGCCTGGCCGGGGGAGGG + Intergenic
1127339554 15:58026797-58026819 GCTGCAGCCTGGTCGGAGGAGGG + Intronic
1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG + Exonic
1128177110 15:65565588-65565610 GCTCCAGCCTTGGCTGAGAGGGG - Intronic
1129150159 15:73683711-73683733 GCTCCAGCCTGGGAGGAGATGGG - Intergenic
1129169170 15:73797459-73797481 TCTGCAGCCTGTCCTGAGGGAGG + Intergenic
1129356307 15:74994451-74994473 GCTCCATCCTGCCAGGAGTGGGG - Intronic
1129711009 15:77820165-77820187 GCTCCGGCCTGGCGCTAGGGTGG + Intronic
1129712336 15:77826691-77826713 GCCCCAGGCTGGCTGGAGGTGGG + Intergenic
1130716475 15:86339931-86339953 CCTCCAGCCTGGCGACAGGGCGG + Intronic
1131990459 15:98088533-98088555 GCGCCAGCCTAGCCCGAGGATGG - Intergenic
1132099685 15:99014764-99014786 GCGCCAGCCTAGCCCGAGGATGG + Intergenic
1132147563 15:99437610-99437632 GCTCCAGCCTGGGAGGATTGGGG + Intergenic
1132390367 15:101434260-101434282 GGCTCAGCCTGGCAGGAGGGCGG - Intronic
1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG + Intronic
1132884794 16:2177908-2177930 CCTCCACTCTGGCCGGAGGAAGG + Exonic
1133220363 16:4316888-4316910 GGTCCATACTCGCCGGAGGGCGG + Intronic
1133220427 16:4317108-4317130 CGCCCAGCCTGGCCAGAGGGTGG + Intronic
1134366157 16:13581251-13581273 GCTCCAGTCTGGCTGTAAGGAGG - Intergenic
1135702803 16:24647642-24647664 ACTCCAGCCTGGGCGAAAGGGGG - Intergenic
1136028822 16:27488139-27488161 GCTCAGGCCTGGCTGGAGTGAGG + Intronic
1136779260 16:32886460-32886482 GCTGCAGCCTGCCAGGAGCGGGG - Intergenic
1136891357 16:33975058-33975080 GCTGCAGCCTGCCAGGAGCGGGG + Intergenic
1137391132 16:48082327-48082349 GCCCAGGCCTGGCCGGAGGAGGG + Intergenic
1138429657 16:56960731-56960753 CCTCCAGCCTGATCGGAGGACGG + Intergenic
1138706449 16:58920484-58920506 GCTCCAGCTTGGTGGGAGGAGGG - Intergenic
1139013275 16:62659369-62659391 GCTCCAGCCTGGGCGACAGGGGG + Intergenic
1139778368 16:69330882-69330904 GGCCCAGCCTGCCCGGAGGGAGG - Exonic
1140899048 16:79351411-79351433 GCTCCAGGCTTGCGGGAGAGAGG + Intergenic
1140928145 16:79601592-79601614 GCTCCTGACTGGCCGGAGTTTGG + Intergenic
1141178867 16:81738976-81738998 GCCCCAGCCTGGCAGGGGGAGGG + Intergenic
1203081676 16_KI270728v1_random:1148548-1148570 GCTGCAGCCTGCCAGGAGCGGGG - Intergenic
1142711076 17:1724513-1724535 GCTCCAGCCGGGCCCGGCGGAGG - Intronic
1143112586 17:4560587-4560609 GCCCAAGCCTGGCAGGTGGGAGG + Exonic
1145370749 17:22304460-22304482 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
1146009190 17:29180225-29180247 GCTCCGGCCGGGAGGGAGGGCGG - Intronic
1146621578 17:34402486-34402508 GCTCAGGCCTGGCCTGAGGCCGG + Intergenic
1147865100 17:43546488-43546510 CGTCCGGCCTGGCCGGGGGGCGG + Intronic
1147951165 17:44108900-44108922 GGTCCATGCTGGCAGGAGGGAGG - Intronic
1147966076 17:44194889-44194911 GCTCCTGCCTTGCCGAGGGGAGG - Intronic
1148092724 17:45032331-45032353 GCTCCAGCCCGGACGGGAGGGGG + Intronic
1148821382 17:50361724-50361746 GCTGCAGCCTGGCCTGGTGGTGG - Intronic
1148870929 17:50658511-50658533 CCACCAGCCAGGCCAGAGGGAGG + Intronic
1149255429 17:54821056-54821078 GCTGCAGCCTGGCAGGGGGAGGG + Intergenic
1149531945 17:57402537-57402559 CCTTCAGCCTGGCCAGTGGGTGG - Intronic
1149557031 17:57580588-57580610 GCTTTAGCCTGGCCTGATGGTGG - Intronic
1149974531 17:61252506-61252528 GCTCCAGAGGGGCCGGAGGCAGG + Intronic
1150286951 17:63960125-63960147 GCTGGTGCCTGGCAGGAGGGGGG - Intronic
1151305896 17:73262473-73262495 TCGCCAGCTTGGCGGGAGGGCGG + Intergenic
1151471437 17:74320713-74320735 GAGCCAGCTTGGCCGGAGGCAGG + Intergenic
1151534542 17:74731253-74731275 GCTACAGCCTGGCCAGCGGCAGG - Intronic
1152041320 17:77905740-77905762 ACTCCAGCCTGGCGACAGGGCGG + Intergenic
1152117708 17:78398901-78398923 GCTCCTGACTGGCCTGACGGTGG + Intronic
1152548929 17:81019666-81019688 GCTCCCGCCTCCCCGGAGTGGGG - Intergenic
1152580432 17:81163366-81163388 GGTCCAGGCTGGCAGGAAGGGGG - Intronic
1152740734 17:82017229-82017251 GCTTCAGCCGGGCTGGTGGGCGG + Intronic
1152850709 17:82633128-82633150 ACTCCAGCCTGGGCGAAGGAGGG + Intronic
1154494626 18:14946382-14946404 GTTCTAGCCTGGGTGGAGGGAGG + Intergenic
1155006692 18:21735672-21735694 GCTCAAGCTTGGTCGGGGGGAGG + Intronic
1155570331 18:27185321-27185343 GCCCCAGCCGGGCCGGACGCGGG - Intergenic
1159511692 18:69402725-69402747 GCTCCAGGCTGGAGGAAGGGGGG - Intronic
1160400004 18:78603282-78603304 GCACCAGCGTGTTCGGAGGGTGG + Intergenic
1160511217 18:79454548-79454570 GCTCCAGCAGGGCAGGAGGAGGG + Intronic
1160512453 18:79460173-79460195 GCTGCTGCCTGGGTGGAGGGTGG - Intronic
1160765408 19:805397-805419 GCCCCAACCCGGCCGGCGGGCGG - Intronic
1161027450 19:2043091-2043113 GCTCCAGGCTGTGAGGAGGGAGG - Intronic
1161090671 19:2358440-2358462 CCTGCAGCCTGACAGGAGGGTGG + Intergenic
1161119654 19:2518315-2518337 CCCCCAGCCCGGGCGGAGGGCGG - Intronic
1161590511 19:5127220-5127242 TCACCTGCCTGGCCTGAGGGAGG - Intronic
1161980319 19:7626850-7626872 GCACCAGCCGGGCGGGAGTGGGG - Intronic
1162176383 19:8832871-8832893 GCTCCGGGCCGGGCGGAGGGCGG + Intronic
1162289979 19:9771799-9771821 ACTCCAGCCTGGCAGCAGAGTGG - Intronic
1162621486 19:11847810-11847832 GCTCCAGACTGGCCTCAGCGTGG - Intergenic
1162647371 19:12059672-12059694 GCTCCAGGCTGGCCTCAGCGTGG - Intergenic
1162701081 19:12515112-12515134 GCTCCAGACTGGCCTCAGGTTGG + Intronic
1162797811 19:13095628-13095650 GCTGGGGCCGGGCCGGAGGGTGG + Exonic
1162948427 19:14057200-14057222 GTTCCAGCTTGGCCGGGGCGGGG - Intronic
1163117991 19:15199969-15199991 GCGCGAGGCCGGCCGGAGGGAGG + Intronic
1163574194 19:18100979-18101001 GATCCGGCCTGGCCCGCGGGCGG + Intronic
1163602037 19:18255107-18255129 GGACCAGCGTGGCCTGAGGGAGG + Intronic
1163714684 19:18866787-18866809 GCTGCGGCCAGGGCGGAGGGAGG + Exonic
1164072139 19:21778024-21778046 GCTCCAGGCTGGGCAAAGGGTGG + Intergenic
1164623575 19:29712371-29712393 ACTCCAGCCTGGCAGCAGAGTGG + Intronic
1165096529 19:33412781-33412803 GCTCCATCCTGGCCGGGCAGGGG + Intronic
1165509353 19:36257210-36257232 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
1165510890 19:36266188-36266210 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
1165511395 19:36268608-36268630 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165511943 19:36271131-36271153 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165512495 19:36273632-36273654 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165513042 19:36276173-36276195 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165513598 19:36278728-36278750 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165514148 19:36281262-36281284 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165514700 19:36283799-36283821 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165515252 19:36286332-36286354 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165515802 19:36288868-36288890 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165516353 19:36291405-36291427 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165516905 19:36293931-36293953 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165517458 19:36296454-36296476 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165518010 19:36298989-36299011 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165518561 19:36301524-36301546 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165519110 19:36304056-36304078 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165519660 19:36306571-36306593 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165520209 19:36309099-36309121 GCTCCTGCCAGGAAGGAGGGAGG + Intergenic
1165623858 19:37269483-37269505 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165624403 19:37272023-37272045 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165624948 19:37274550-37274572 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165625484 19:37277088-37277110 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165626020 19:37279613-37279635 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165626564 19:37282140-37282162 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165627103 19:37284665-37284687 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165627646 19:37287189-37287211 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165628181 19:37289713-37289735 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165628722 19:37292238-37292260 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165629263 19:37294764-37294786 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165629805 19:37297289-37297311 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165630348 19:37299817-37299839 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1165630884 19:37302355-37302377 GCTCCTGCCAGGAGGGAGGGAGG - Intergenic
1166066928 19:40365703-40365725 GCTCCAGCCTGGCCGGGTTGGGG - Exonic
1166109870 19:40615132-40615154 GCTCCAGCGAGGCAGGAGGGTGG + Intronic
1166205232 19:41264950-41264972 GCCCCAGCACGACCGGAGGGTGG + Intronic
1166369285 19:42292352-42292374 GTTCCAGCCTGGCTGGACGCAGG - Exonic
1166431045 19:42728496-42728518 CCTGCAGCCTGGCCCGGGGGAGG + Intronic
1166444048 19:42843736-42843758 CCTGCAGCCTGGCCCGGGGGAGG + Intronic
1166451483 19:42906289-42906311 CCTGCAGCCTGGCCCGGGGGAGG + Intronic
1166469882 19:43071072-43071094 CCTGCAGCCTGGCCCGGGGGAGG + Intronic
1166481018 19:43174587-43174609 CCTGCAGCCTGGCCCGGGGGAGG + Intronic
1166490596 19:43257574-43257596 CCTGCAGCCTGGCCCGGGGGAGG + Intronic
1166688597 19:44810002-44810024 GCCCCAGCCTGTCCCCAGGGAGG - Intronic
1166885113 19:45955823-45955845 ACTCCAGCCTGGCGGCAGAGCGG + Intronic
1167013769 19:46826240-46826262 GCTCCAGCCTGGGCGATGGAGGG + Intergenic
1167332802 19:48866891-48866913 GCTCCATCCGGGCAGGATGGAGG - Intronic
1167396298 19:49231683-49231705 GTTCCAGTCTGGCCAGTGGGTGG - Intergenic
1167577713 19:50325716-50325738 GGGCCAGCCGGGCCGGGGGGCGG + Intronic
1167792982 19:51692293-51692315 AGGCCTGCCTGGCCGGAGGGAGG + Intergenic
926427752 2:12754845-12754867 TCTGCAGCCAGGGCGGAGGGAGG - Intergenic
927027952 2:19089665-19089687 GCTGCAGCCTGGCGGGGGTGGGG + Intergenic
927154014 2:20211611-20211633 GGTCCAGCCGGGCCGGCTGGTGG - Intronic
927963281 2:27254227-27254249 GCCTCAGGCTGGCTGGAGGGAGG - Intronic
929051333 2:37839395-37839417 GCTCCAGCCTGGGGGAAGGAGGG + Intergenic
930840187 2:55837258-55837280 GCTGCAGCCTGGCGGGGGGAGGG - Intergenic
932278966 2:70473098-70473120 ACTCCAGCCTGGCCTCAGGGTGG - Intronic
932323956 2:70842598-70842620 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
932343119 2:70979005-70979027 GCCCCCGCCTGGCTGGTGGGCGG - Intronic
932377552 2:71251138-71251160 GCTGCAGCCTGGCGGGGGGCAGG - Intergenic
933554903 2:83820245-83820267 ACTCCAGCCTGGGCGGAAGAGGG - Intergenic
933907977 2:86914068-86914090 GCCCCGGCCTGGCCGGGCGGCGG + Intronic
933907997 2:86914117-86914139 GCCCCGGCCTGGCCGGGCGGCGG + Intronic
933908016 2:86914166-86914188 GCCTCGGCCTGGCCGGACGGCGG + Intronic
934657087 2:96122055-96122077 GCCCCAGCCTGGGTGGTGGGAGG - Intergenic
935109626 2:100080712-100080734 GCTGCATCCTGGCCGGGGGTGGG - Intronic
936516599 2:113185211-113185233 GCTCCAGCCTGGGTGGGAGGAGG + Intronic
937558463 2:123189992-123190014 ACTCCAGCCTGGGCGGAAGAGGG + Intergenic
938319803 2:130355540-130355562 GCTCCAGCCGGGCCCAAGGGAGG - Intergenic
943233617 2:185290247-185290269 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
945716099 2:213359489-213359511 GCTGCAGCCTGGTGGGAGGAGGG - Intronic
945776677 2:214114515-214114537 GCTTCAGCCTGGCAGGGGGAGGG - Intronic
946258696 2:218467190-218467212 ACTCCAGCCTGGGCAGGGGGAGG - Intronic
946794075 2:223330913-223330935 GCTGCAGCCTGGCGGGGGGAGGG + Intergenic
947794628 2:232886488-232886510 GCTGCAGCCTGTCGGCAGGGAGG + Intronic
948137526 2:235647904-235647926 GCTCTCACCTGGCCAGAGGGGGG - Intronic
948348845 2:237321960-237321982 CCTCCAGCCTGGCCCGTGGAAGG - Intergenic
948768045 2:240233495-240233517 GCTGCAGCCGGGGAGGAGGGAGG - Intergenic
949005357 2:241643700-241643722 ACTCCAGCCTGGACGACGGGGGG - Intronic
949045585 2:241871352-241871374 GCTCCAGCCTGGCCTCCGTGAGG - Intronic
1169435471 20:5583513-5583535 ACTCCAGCCTGGGCGGGTGGGGG + Intronic
1170206701 20:13806474-13806496 ACTCCAGCCTGGGCGCTGGGTGG + Intronic
1170585209 20:17729270-17729292 GCTCCAAGTTGGCAGGAGGGTGG - Intronic
1171247179 20:23621048-23621070 GCTGCAGCCTGGCAGGGGGAGGG - Intergenic
1171277180 20:23867378-23867400 GCCCCAGCCTAGGCGGATGGAGG - Intergenic
1172683530 20:36735939-36735961 ACTCCAGCCTGGGCAGAGCGAGG + Intronic
1174811801 20:53651739-53651761 ACTCCAGCCTGGCGACAGGGCGG + Intergenic
1176705923 21:10119973-10119995 GCTCCACCCAGGAAGGAGGGAGG - Intergenic
1178924253 21:36761831-36761853 GCCCCTGCCTCGCCGGCGGGAGG + Intronic
1179901696 21:44397527-44397549 GCTCCTGCGTGGCCTGTGGGAGG - Intronic
1180003157 21:45004215-45004237 GGCCCAGCCTGGCCTGAGAGGGG - Intergenic
1180009897 21:45042723-45042745 GCTACAGCCTGGCTGAAGGTTGG + Intergenic
1181439594 22:22928916-22928938 GCTGCAGCCTGGGCTGAGGGAGG + Intergenic
1181621163 22:24092173-24092195 CCTGTAGCCTGGCAGGAGGGAGG + Intronic
1181685987 22:24528609-24528631 GCTATAGCCTGGCAGGAAGGTGG - Intergenic
1182417865 22:30232950-30232972 GCTGCAGCCAGGCCGGGGGGAGG - Intergenic
1183929687 22:41228815-41228837 ACTCCAGCCTGGGCGGAAGAGGG + Intronic
1184251725 22:43264445-43264467 GGTCCAGCCAGGCCCCAGGGAGG - Intronic
1184477477 22:44729446-44729468 GCTCCAGCCTGGCAGTAGCAGGG - Intronic
949529027 3:4935439-4935461 GCACCAGACAGGCTGGAGGGAGG - Intergenic
949594588 3:5530817-5530839 GCTCCAGCTTGGTGGGGGGGAGG - Intergenic
952383474 3:32821823-32821845 GCTCCGGGCTGGCCGGGCGGCGG - Intronic
953219048 3:40950985-40951007 GCTGCAGCCTGGCAGGGGAGGGG - Intergenic
953853623 3:46484591-46484613 GTTCCAGCATGGGAGGAGGGTGG - Intronic
954977874 3:54713765-54713787 GCCCCAGCCAGGCAGGAGAGTGG - Intronic
956373240 3:68586858-68586880 GCTGCAGCCTGGCAGGGGGAGGG - Intergenic
957917849 3:86709081-86709103 GCTGCAGCCTGGCGGGGGGAGGG - Intergenic
958694564 3:97511032-97511054 GCTCCAGCTTGGTGGGGGGGAGG - Intronic
959059765 3:101605522-101605544 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
960565818 3:119130486-119130508 GCTGCAGCCTGGCGGGGGGAGGG + Intronic
960890532 3:122443232-122443254 GCTGCAGCCTGGCGGGGGGAGGG + Intronic
961604461 3:128083428-128083450 GCTTCAGCCTTCCAGGAGGGAGG + Intronic
961668666 3:128510352-128510374 GCTGCAGGCTGGCGGGAGGGAGG + Intergenic
961821029 3:129575731-129575753 ACTCCAGCATGGGCGGAGGGCGG - Intronic
963799107 3:149658884-149658906 GCTCCAGGCTCCCCGGAGGGCGG - Intronic
964006798 3:151839574-151839596 GCTCCAGCCTGGGCTGAGAGAGG + Intergenic
966182349 3:177197986-177198008 GCTCCCGCGTGTCCGGGGGGCGG + Intergenic
966866044 3:184259797-184259819 AGACCAGACTGGCCGGAGGGGGG + Exonic
967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG + Intronic
967815606 3:193795891-193795913 ACTCCAGCCTGGGCGGAAGAGGG - Intergenic
968148339 3:196318248-196318270 GCTTCAGCGAGGCGGGAGGGCGG - Exonic
968441036 4:624740-624762 GCGCCGGCCTGGCGGGCGGGTGG - Intergenic
968483052 4:845307-845329 GCTCCACCCAGGCCTGTGGGTGG + Intergenic
968540339 4:1165143-1165165 GGGGCCGCCTGGCCGGAGGGTGG - Intergenic
968620781 4:1602670-1602692 GCTCCTGCCTGGCGGGGAGGGGG - Intergenic
968971638 4:3798736-3798758 GCTCCTGCCTGGCCAGAGCCTGG + Intergenic
969046304 4:4339186-4339208 GATTCTGTCTGGCCGGAGGGAGG - Intergenic
969251537 4:5971433-5971455 GCTCCAGGCTGGCTGCAGTGTGG - Intronic
969285383 4:6199563-6199585 GCGCCGGCCCGGCAGGAGGGTGG + Intronic
969446353 4:7246911-7246933 GGTAGAGCCTGGACGGAGGGAGG - Intronic
969696612 4:8738607-8738629 GCTCCAGCCTTGCGGGACAGAGG - Intergenic
970404306 4:15747700-15747722 GCTCCAGCCTGGGAGAAGGTAGG - Intergenic
970917480 4:21352555-21352577 GCTGCAGCCTGGCAGGGGGAGGG + Intronic
971227567 4:24769132-24769154 CCTCCAGCCTGACCTCAGGGAGG - Intergenic
974115245 4:57571139-57571161 GCGGCAGCCTGGCTGGCGGGGGG - Intergenic
976215554 4:82712348-82712370 ACTCCAGCCTGGGCGGAGCCTGG - Intronic
976477935 4:85506459-85506481 GCTGCAGCCTGGCTGGGGGAGGG - Intronic
976580510 4:86730521-86730543 GCTGCAGCCTGGTCGGGGGAGGG - Intronic
977253215 4:94711490-94711512 GCTCCAGCCTGGCGATAGAGTGG - Intergenic
978928955 4:114287439-114287461 GCTGCAGCCTGGCGGGGGGAGGG + Intergenic
979272855 4:118782817-118782839 GCAGCAGCCTGGCAGGGGGGAGG - Intronic
979659577 4:123238105-123238127 GCTGCAGCCTGGCAGGGGGAGGG + Intronic
979965974 4:127077182-127077204 GCTCCAGCTTGGTGGGTGGGAGG - Intergenic
980354461 4:131724569-131724591 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980354995 4:131727075-131727097 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980356083 4:131732053-131732075 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980356618 4:131734541-131734563 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980357154 4:131737029-131737051 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980357696 4:131739524-131739546 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980358234 4:131742010-131742032 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980358766 4:131744504-131744526 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980359306 4:131746977-131746999 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980360389 4:131751940-131751962 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980360930 4:131754412-131754434 GCTCCACCCAGGATGGAGGGAGG + Intergenic
980361472 4:131756895-131756917 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980362013 4:131759367-131759389 GCTCCACCCAGGATGGAGGGAGG + Intergenic
980362555 4:131761850-131761872 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980363099 4:131764329-131764351 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
980558722 4:134442862-134442884 GCTGCAGCCTGGCAGGGGGAGGG - Intergenic
980593995 4:134928780-134928802 GCTGCAGCCTGGCTGGGGGAAGG - Intergenic
980830903 4:138128474-138128496 ACTCCAGCCTGGCGACAGGGCGG - Intergenic
985538889 5:478739-478761 CCTGGAGCCTGGCTGGAGGGTGG - Intronic
987086594 5:14475286-14475308 GCTCCACCCTGAGCAGAGGGAGG - Intronic
987838017 5:23186535-23186557 GCTGCAGCCTGGCAGGGGGGAGG + Intergenic
988822764 5:34903996-34904018 ACTCCAGTCTGGCAGGAGAGTGG - Intergenic
991945105 5:71892045-71892067 GCTCGTGCCTGGCCAGAGGCAGG + Intergenic
994043439 5:95284047-95284069 GCCCCAGCCTCCCCCGAGGGGGG - Exonic
997195600 5:131977183-131977205 TCTCCAGCCTGGCCTGAGCCTGG - Intronic
997265187 5:132491026-132491048 GCTCCGGCTTGCCCGGAGGAGGG + Intergenic
997560013 5:134838246-134838268 GCTTCAGCCTGGCCCAAGGTAGG - Intronic
997647232 5:135489497-135489519 GCCCCTGTCCGGCCGGAGGGAGG + Intergenic
998508727 5:142693692-142693714 GCTTAGGCCTGGCAGGAGGGAGG - Intronic
999258372 5:150222470-150222492 GCCCCAGCCTGGCAGGGGAGAGG + Intronic
999687723 5:154117533-154117555 ACTCCAGCCTGGTTGGAGGCAGG - Intronic
999963507 5:156783218-156783240 GCCCCAGCTTGGCCGGGGGAGGG + Intergenic
1000996100 5:167960540-167960562 GCTCCAGCTTGGTGGGAGGGAGG - Intronic
1001484579 5:172110638-172110660 GACACAGCCTGGCCGGAAGGAGG + Intronic
1001639257 5:173233705-173233727 GCTCCAGCCTGGCCGCAGCAGGG + Intronic
1001885953 5:175290522-175290544 GCTTCAGGCTGGACGGTGGGAGG + Intergenic
1002169298 5:177366415-177366437 GCTTCAGGCTGGCCAGAGTGGGG + Intronic
1002427354 5:179184138-179184160 GCTGCAGTCTGGCCTGTGGGAGG - Intronic
1002652277 5:180707633-180707655 ACTCCAGCCTGGGCGGAAGAGGG + Intergenic
1003647512 6:7926096-7926118 GCTGCAGCCTGGCTGGGGGAGGG + Intronic
1003937700 6:10992753-10992775 ACTCCAGCCTGGCGACAGGGCGG + Intronic
1004190096 6:13456205-13456227 ACTCCAGCCTGGCATGAGAGAGG - Intronic
1005344872 6:24879311-24879333 ACTCCAGCCTGGCGAGAGTGGGG + Intronic
1006337984 6:33431096-33431118 GCTACAGGCTGGAAGGAGGGGGG - Intronic
1006581815 6:35081720-35081742 GCTCCAGCCCTGGCGGAGGTGGG + Intronic
1006582891 6:35086860-35086882 GCCACAGCCTGGCCTGGGGGTGG + Intronic
1006746429 6:36346056-36346078 GTTCACGCCTGGCTGGAGGGTGG - Intergenic
1006751113 6:36377771-36377793 GAACCAGGCTGGCAGGAGGGAGG + Intronic
1007169175 6:39850358-39850380 GGTCCAGCCTGGGAGGTGGGGGG - Intronic
1008425221 6:51349150-51349172 GCTCCAGCTTGGTGGGAGGAGGG - Intergenic
1012973460 6:105755475-105755497 GCTCCAGTCTGGCTGGATAGAGG + Intergenic
1013246799 6:108294803-108294825 GCTCCAGTCTGGGCAGTGGGAGG - Intergenic
1013578303 6:111507438-111507460 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1014097765 6:117479143-117479165 ACTCCAGCCTGGGCGAAGAGCGG - Intronic
1014924580 6:127255463-127255485 GCAGCAGCCTGGCAGGAGGAGGG + Intergenic
1015935682 6:138404354-138404376 TCTCCAGCCCGGCCGGGAGGAGG + Exonic
1016655638 6:146515401-146515423 GCTGCAGCCTGGCGGCAGGAGGG - Intergenic
1018001679 6:159584400-159584422 GCTCCAGTGTGGCTGGAAGGAGG - Intergenic
1018908480 6:168088640-168088662 GCTGCAGCCAGGCAGGTGGGAGG + Intergenic
1019587294 7:1812552-1812574 TCTCCAGCCTGCCGGGAGGCTGG + Intergenic
1019640237 7:2099565-2099587 GCTCCCGCCTGGCCTCTGGGTGG - Intronic
1020118779 7:5491442-5491464 GCTCCAGCCTGCGGGGAGAGAGG + Exonic
1020774136 7:12432065-12432087 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1021238732 7:18175172-18175194 GCAGCAGCCTGGCAGGGGGGAGG - Intronic
1021306624 7:19039963-19039985 GCTGCAGCCTGGCAGGGGGAGGG - Intronic
1022018586 7:26376746-26376768 GCTCGCGCCCGGCCGGAGGAGGG + Intergenic
1022465945 7:30653325-30653347 TCTCCAGCCTGGCAGGAAAGAGG - Exonic
1022775034 7:33518281-33518303 ACTCCAGCCTGGCGACAGGGTGG - Intronic
1023651188 7:42371156-42371178 GCTACAGCCTGGCTGGGGGAGGG - Intergenic
1024538366 7:50457352-50457374 GATCCAGCCAGTTCGGAGGGAGG + Intronic
1024638362 7:51309275-51309297 GTTCCAGCCTGGCCTGAGGAGGG - Intronic
1025296043 7:57775959-57775981 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
1026009959 7:66628945-66628967 GCTGCGGGCTGGCCGGAGGGGGG - Exonic
1026398316 7:69982448-69982470 GCTCCAGGCTATCCTGAGGGGGG + Intronic
1027009028 7:74725645-74725667 GCTCCAGCCTGGGTGAAGGAGGG + Intronic
1027982977 7:85250272-85250294 GCGGCAGCCAGGCCGGGGGGGGG + Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029640549 7:101816784-101816806 GCTCCGGCCAGGCGGGCGGGTGG + Intronic
1032378716 7:131452581-131452603 ACTCCAGCCTGGCGACAGGGCGG - Intronic
1032825208 7:135561948-135561970 ACTCCAGCCTGGGCAGAGTGAGG - Intronic
1033214345 7:139483056-139483078 GCTGCAGCCCGGACGGAGAGCGG - Exonic
1034285120 7:149879197-149879219 GCCCTAACCTGGACGGAGGGAGG + Intronic
1034406176 7:150903745-150903767 GCTCCAGCCAGGGCCCAGGGTGG + Intergenic
1034414896 7:150959248-150959270 GCTCAAGCCAGGCTGGAGAGAGG + Intronic
1034982444 7:155487734-155487756 GTTCCAGCATGATCGGAGGGAGG - Intronic
1035225766 7:157431285-157431307 GCTCCAGCCTGGGGGCAGCGAGG + Intergenic
1036258373 8:7222231-7222253 GGTCCAACCTGGCCGGGGTGGGG - Intergenic
1036640462 8:10580217-10580239 GCTCCAGCTTGGCGGGAGTGGGG + Intergenic
1036788136 8:11701560-11701582 GCTCCCGCTTGGCCCAAGGGAGG + Intronic
1037806267 8:22059373-22059395 GGTCCAGCCAGGCTGGAGGCCGG - Exonic
1039907638 8:41798200-41798222 GCTCCAGCCTCCCCGGGGGGCGG - Intronic
1041110293 8:54476960-54476982 CCTCCAGCCCGGCCTGAGGGAGG - Intergenic
1041630567 8:60082777-60082799 GCTCCAGCTTGGTCGGGGGAGGG - Intergenic
1042526702 8:69771931-69771953 GCTCCAGCCTGGCCCTGGGGAGG + Intronic
1042594342 8:70429903-70429925 ACTCCAGCCTGGGCTGACGGAGG - Intergenic
1042945931 8:74154425-74154447 GTTCCAGCATGGCCCAAGGGGGG + Intergenic
1045185175 8:99830442-99830464 GCTCCAGCTTGGTGGGAGGAGGG - Intronic
1045515363 8:102854562-102854584 ACTCCAGCCTGGGCGAAAGGAGG + Intronic
1048271676 8:133033339-133033361 CCTCCAGCCTGGCCTCAGGACGG - Intronic
1048461723 8:134626718-134626740 GCTCCAGCATGCCCAGAGGTGGG - Intronic
1049356930 8:142193638-142193660 GATCCAGGCTGGCGGGAGGCGGG - Intergenic
1049536765 8:143186130-143186152 GCTCCGGCCTGGGCGTCGGGAGG + Intergenic
1049611567 8:143558469-143558491 GCTCCAGCCAGGCCGGGGGAGGG - Intronic
1052063781 9:23992098-23992120 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1053372733 9:37576268-37576290 GCTCCAGCGGGGGCGGCGGGTGG - Intronic
1053643203 9:40107091-40107113 GCTCCACCCAGGAAGGAGGGAGG - Intergenic
1053762947 9:41358399-41358421 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
1054324056 9:63704319-63704341 GCTCCACCCAGGAAGGAGGGAGG - Intergenic
1054541552 9:66269512-66269534 GCTCCACCCAGGAAGGAGGGAGG + Intergenic
1054889133 9:70232794-70232816 GCTCCAGCTTGGTGGGAGGAGGG + Intergenic
1056505606 9:87255408-87255430 GCTCCATCCTGTCAGGAGGAAGG - Intergenic
1056668086 9:88597723-88597745 GCTGCAGCCTGGCAGGGGGAGGG + Intergenic
1056689308 9:88793099-88793121 GCTCCAGCATGGCCTCAGGCAGG + Intergenic
1057220786 9:93256741-93256763 GCTCCAGGCTGGCTGGAGTTTGG + Intronic
1057277669 9:93684614-93684636 GGCCCAGCCTGGCCGGCGGGAGG - Intergenic
1058210840 9:102167810-102167832 GCTCTAGCCTGGGTTGAGGGAGG + Intergenic
1060106467 9:120876415-120876437 CCTCCACCCTGGCCGGGCGGGGG + Intronic
1060218654 9:121753120-121753142 GCTCCACCCTGGTGGGAGGCAGG + Intronic
1061092405 9:128434033-128434055 GCTTCAGCGTGGAGGGAGGGGGG + Intronic
1061227907 9:129291365-129291387 GACCCAGCCTGGTGGGAGGGGGG + Intergenic
1061449732 9:130661513-130661535 GCTCCGGCCCGGCCGAGGGGAGG + Intergenic
1061681157 9:132243011-132243033 CCTGCAGCCTGGCCGCGGGGTGG - Exonic
1061843733 9:133375647-133375669 GCCCCGGGCTGGCTGGAGGGTGG + Intronic
1062147399 9:134997248-134997270 GCTCAGGCCTGGCCAGAGGGCGG + Intergenic
1062165524 9:135105556-135105578 GCTCCAGGCTGGCCCCCGGGAGG - Intronic
1062184595 9:135211304-135211326 GCTCCTGCCTGCTCGGTGGGGGG - Intergenic
1062421914 9:136486736-136486758 CCACCAGGCTGGCCAGAGGGTGG + Intergenic
1202790957 9_KI270719v1_random:90061-90083 GCTCCACCCAGGAAGGAGGGAGG - Intergenic
1186370011 X:8937234-8937256 GCTCCAGCTTGGTGGGAGGAGGG - Intergenic
1186888384 X:13937764-13937786 TCTCCAACCTGGCCCGAGGCTGG - Intronic
1188916716 X:35920137-35920159 GCTCCTGCCGGGATGGAGGGAGG + Intronic
1190322570 X:49187377-49187399 TCTCCAGCCTGGGCGGAGGCAGG + Intergenic
1190622260 X:52299128-52299150 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1190683407 X:52849273-52849295 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1192395902 X:70780735-70780757 GCTGCAGCCTGGCTGGGGGAGGG + Intronic
1192713483 X:73616076-73616098 CCTCCTGCCTGGGGGGAGGGGGG - Intronic
1192974970 X:76273532-76273554 GCTCCAGCTTGGCGGGGGAGGGG - Intergenic
1194762603 X:97812104-97812126 ACTCCAGCCTGGCCACAGAGCGG + Intergenic
1195031195 X:100929132-100929154 GCGCCAACCTGGCTGGACGGAGG + Intronic
1196012505 X:110904044-110904066 GCTGCAGGCTGGCTGGAGGAGGG - Intergenic
1196782884 X:119399249-119399271 GCCCTAGCCTGGCCCGAGGCTGG - Exonic
1199977927 X:152905262-152905284 GCTGCAGTCTGGCCGCAGAGAGG + Intergenic
1200100496 X:153687540-153687562 GCTGCAGCCTGCCAGGAGCGGGG + Intronic
1200737384 Y:6814257-6814279 GCTCCAGCCTGGCTGGGAGAGGG + Intergenic
1200840928 Y:7781157-7781179 ACTCCAGCCTGGGCGAAGGAGGG - Intergenic