ID: 1132849894

View in Genome Browser
Species Human (GRCh38)
Location 16:2020246-2020268
Sequence GCTCTGGGGCGCGCGGGCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132849894_1132849900 -8 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849900 16:2020261-2020283 CCCAGAGCCTGCGCTGGAACCGG 0: 1
1: 0
2: 1
3: 22
4: 252
1132849894_1132849906 17 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849906 16:2020286-2020308 TCCCTGGACTTCAGCGGAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1132849894_1132849903 1 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849903 16:2020270-2020292 TGCGCTGGAACCGGAGTCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 101
1132849894_1132849905 11 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849905 16:2020280-2020302 CCGGAGTCCCTGGACTTCAGCGG 0: 1
1: 0
2: 1
3: 7
4: 152
1132849894_1132849909 22 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849909 16:2020291-2020313 GGACTTCAGCGGAGCTGGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132849894 Original CRISPR GCTCTGGGGCGCGCGGGCTC CGG (reversed) Exonic
900387425 1:2416932-2416954 GCCCTGGGGCTCTGGGGCTCTGG + Intergenic
900418778 1:2546719-2546741 GCTCTCGGCGGCCCGGGCTCCGG - Intergenic
900583533 1:3421247-3421269 GCTCAGGGGCTCGGGGGCCCTGG + Intronic
901604618 1:10449440-10449462 GCCCTGGGGCAGCCGGGCTCTGG - Intronic
902618029 1:17634579-17634601 GCTCCGGGGCTCTGGGGCTCTGG + Intronic
902618033 1:17634587-17634609 GCTCTGGGGCTCTGGGGCTCTGG + Intronic
902618036 1:17634595-17634617 GCTCTGGGGCTCTGGGGCTCTGG + Intronic
903466418 1:23555058-23555080 GCGCTGCGGCGCCCGGGCTGGGG - Intergenic
905448340 1:38042099-38042121 GCTCTGGGCCGCGCAGGCGGCGG + Intergenic
911072924 1:93846739-93846761 GGCCCCGGGCGCGCGGGCTCGGG + Intronic
912776460 1:112509022-112509044 GGTCTGGGGCGCGCTGCCTGAGG - Exonic
913681109 1:121187294-121187316 GCTCCGTGGAGCGCGGGCTGCGG - Exonic
914032939 1:143974934-143974956 GCTCCGTGGAGCGCGGGCTGCGG - Intergenic
914156507 1:145093032-145093054 GCTCCGTGGAGCGCGGGCTGCGG + Exonic
914490000 1:148146127-148146149 GCCCTGGGGCCCGGGGGCGCGGG + Intronic
914908152 1:151763424-151763446 GCTCTGCTGCGGGCGGGCGCTGG - Exonic
915311918 1:155009288-155009310 CCTCTGGGGCTGGGGGGCTCAGG + Intronic
919712264 1:200739540-200739562 GCTCGGAGGGGCGCGGGCACGGG + Exonic
920468423 1:206205818-206205840 GCTCCGTGGAGCGCGGGCTGCGG - Intronic
921039597 1:211416877-211416899 GCGGCGGGGCGCGCGGGCTCCGG - Intergenic
922502883 1:226110046-226110068 GCTCCGGGGAGCGCGGGGGCGGG + Intergenic
922775524 1:228212783-228212805 GGTGCGGGGCGCGCGGGCCCAGG + Intronic
1064194640 10:13234884-13234906 GCTCTGGGACCCGCGGCCCCAGG - Intergenic
1064981932 10:21174030-21174052 GCTCTCGGGCTCGCAGGCGCTGG + Intronic
1065204387 10:23343847-23343869 GGGCCGGGGCGCGAGGGCTCCGG + Intronic
1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG + Exonic
1073063646 10:100746115-100746137 GCTGCGGGGCGCGCGGGGGCGGG - Exonic
1073363564 10:102918866-102918888 GCCCGGGGGAGCGCGGGCTGGGG + Exonic
1074833159 10:117263904-117263926 GCTCTGGGGTGCGAGGACTTAGG + Intronic
1075106360 10:119542559-119542581 CTTCGGGGGCCCGCGGGCTCGGG - Intronic
1075710278 10:124527047-124527069 GCTCTGTGGCGGGCAGGCTCTGG - Intronic
1076350941 10:129814850-129814872 GCTCTGGGGCTGGCAGGTTCAGG - Intergenic
1076371752 10:129959818-129959840 GCACGTGGCCGCGCGGGCTCGGG - Intronic
1076687629 10:132205191-132205213 GCACTGGGGTGCCTGGGCTCAGG - Exonic
1077016976 11:402161-402183 GGTCTGGGGTGAGCGGGGTCGGG - Intronic
1077183492 11:1226593-1226615 GCTGTGGGGAGCGCGGGATGAGG - Exonic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077469629 11:2751084-2751106 GCTGTGGGGTGCGGGGGCTGTGG - Intronic
1077575336 11:3378877-3378899 GCGCCGGGGCGCGCGGGGCCCGG + Intronic
1078246000 11:9573769-9573791 GCTCCGGGGCGCTCGGGCTGCGG - Exonic
1078549792 11:12272150-12272172 GCTCTGAGGCGTGGGGGCTGTGG + Intergenic
1079056165 11:17208114-17208136 GCGCTGGGGCGCACGGGCCCGGG + Intergenic
1079076239 11:17386985-17387007 GCGCAGGGGCCCGCGGGCTGAGG + Exonic
1081573329 11:44304519-44304541 CCTCTGAGCCGCGGGGGCTCCGG + Intronic
1081644092 11:44777926-44777948 GCTCTGGGGCAAGCTGGCTCAGG + Intronic
1081869886 11:46378546-46378568 GCCCTGGGGAGCGAGGCCTCTGG + Intronic
1083202707 11:61130092-61130114 GCCCTGGGGCGAGCGGGCAAGGG + Intergenic
1084146150 11:67266423-67266445 GCTCCGGGGCGCGGGCGCGCGGG + Exonic
1084906241 11:72350022-72350044 GCTCTGGAGAGCATGGGCTCTGG + Intronic
1088823515 11:113475410-113475432 GCTCTGCGGCGCCCGAGCGCGGG + Intronic
1089046089 11:115503500-115503522 GCTGTGGGGCGGGCGGGCTGCGG + Intronic
1089401425 11:118166664-118166686 GCTCTGGGACGTGTGGGCCCTGG - Exonic
1090095875 11:123741431-123741453 ACTCTGGGGGGCGGGGTCTCCGG + Intronic
1090671004 11:128945308-128945330 GCTCTGGGGCAGGTGGGCTGTGG - Intergenic
1091316608 11:134618341-134618363 CCTCTGGGGCAGGCGGGTTCTGG + Intergenic
1096552106 12:52379673-52379695 GCTCTGGGGAAGGCAGGCTCTGG + Intronic
1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG + Exonic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1101870573 12:108562433-108562455 TCTCGGGGGCGGGCGGGGTCGGG - Intergenic
1101910634 12:108857874-108857896 CCCCTGGGGCGTACGGGCTCCGG - Intergenic
1103562862 12:121801136-121801158 GCTCCGGGGCGCGCCTGCGCTGG - Intronic
1104127391 12:125861343-125861365 GCTCTGGGACTCGCGGGCTCTGG + Intergenic
1104256881 12:127146761-127146783 CCTCTGGGACTCGCAGGCTCTGG - Intergenic
1104568285 12:129903899-129903921 GCTCGGGCGCGCGCGCGCTCCGG + Intergenic
1105071415 12:133236141-133236163 GCTCTGCGGGGCGCGGGGTGCGG + Intergenic
1107939981 13:45374837-45374859 GCTTTGGGACCCGCTGGCTCAGG + Intergenic
1113910705 13:113839958-113839980 GCTCTGAGGGGCGCAGGCTGAGG + Intronic
1113939599 13:114011541-114011563 GCTCTGGGGCGCTGAGTCTCGGG + Intronic
1114224261 14:20723650-20723672 GCTCCAGGGCGGGCGCGCTCAGG - Intergenic
1115398545 14:32934787-32934809 GCTCTGGCTGGCGGGGGCTCGGG - Intergenic
1115906594 14:38209156-38209178 GCTCCGGGGTGCCCGGGCACAGG - Exonic
1119383018 14:74240503-74240525 GCCCGGGGACGCGCGGGCTCGGG + Intronic
1119410406 14:74426458-74426480 GCTCTGGGGTGCGCGGGAGGAGG - Intergenic
1121127681 14:91418184-91418206 GAGCTGGGGTGCGCGGGCACTGG + Intergenic
1122371957 14:101233922-101233944 GCTCTGGGGCTCTGGGGCTGTGG - Intergenic
1122371960 14:101233930-101233952 GCTCTGGGGCTCTGGGGCTCTGG - Intergenic
1122621264 14:103058551-103058573 CTTCTGGGGCGCGCGGGTGCAGG + Intergenic
1125051198 15:35299560-35299582 GCGCTGGGCGGCGCGGGGTCAGG + Intronic
1130010919 15:80152683-80152705 GACCTGGGGCTCGCGGGGTCGGG + Intronic
1131200043 15:90388408-90388430 GCTCCGCGGCGCGGGGGCTTCGG + Intronic
1132055859 15:98649768-98649790 GCTGTCGGGCCCCCGGGCTCGGG + Intronic
1132522265 16:397261-397283 GCGCTGCGGCCCGCGGGCCCCGG + Exonic
1132607962 16:801325-801347 GCTCTGGGGCACGCTGCCTCGGG + Intergenic
1132849894 16:2020246-2020268 GCTCTGGGGCGCGCGGGCTCCGG - Exonic
1133513442 16:6483296-6483318 GCTCTCGCGCCCGCGCGCTCGGG + Intronic
1133998209 16:10763172-10763194 GCTAAGGGGCTCGGGGGCTCAGG + Intronic
1136506452 16:30707258-30707280 CCTTTGGGGCGAGGGGGCTCTGG - Exonic
1136672717 16:31873064-31873086 CCTCTGGGCCGTGCTGGCTCAGG - Intergenic
1136779040 16:32885746-32885768 GCCCGGGGGCGCGCGGGCGTCGG + Intergenic
1136891578 16:33975772-33975794 GCCCGGGGGCGCGCGGGCGTCGG - Intergenic
1137728636 16:50673738-50673760 GCTCCAGGGCGCGCGGGTACTGG + Exonic
1137979185 16:53055293-53055315 GCTCTGGGAGGCGAGGGCTGGGG - Intronic
1139409979 16:66751437-66751459 GCCGTGGGGGGCGCGGCCTCTGG - Intronic
1140475179 16:75236223-75236245 GCTCTGGGACGAGCCGGCTCTGG + Intronic
1140926573 16:79589821-79589843 GCCCTGGGGCGCGCTGGGTGTGG + Intronic
1141668882 16:85481034-85481056 TCTCTGGGCCGCTCGGCCTCCGG + Intergenic
1142209788 16:88803650-88803672 GCGCTGGTGGGCGCGGGCACCGG - Exonic
1142271876 16:89094047-89094069 GCTCTCGGGGGCGCGGGCTCCGG + Intronic
1142293222 16:89202002-89202024 GCCCGGGGGCGCGCGGGCTCCGG + Intergenic
1203081453 16_KI270728v1_random:1147835-1147857 GCCCGGGGGCGCGCGGGCGTCGG + Intergenic
1142474075 17:179766-179788 GCCCTGGGGCGTGGGGGCTGGGG - Intronic
1142623549 17:1179433-1179455 GGTCTGGGGGGCGCGGGCGGGGG - Intronic
1143171647 17:4933897-4933919 GCTCTGGGGTGGTCGGGCTGGGG - Exonic
1143500649 17:7336700-7336722 GCTGTGGGGCCAGCGGGCCCTGG - Exonic
1144627154 17:16849854-16849876 GTTCTGGGAGGCGAGGGCTCAGG - Intergenic
1144879283 17:18422858-18422880 GTTCTGGGAGGCGAGGGCTCAGG + Intergenic
1145190606 17:20840778-20840800 GCCCTGGGGCCCGGGGGCGCGGG + Intronic
1145941077 17:28743782-28743804 TCCCCGGGGCCCGCGGGCTCTGG + Intergenic
1146022703 17:29293110-29293132 GCTCTGGGGGGAGCGGGCGCGGG + Intronic
1146463682 17:33067974-33067996 GCTCTGGAGAGAGAGGGCTCCGG + Intronic
1147210380 17:38869779-38869801 CATCTGGGGCGCCCGGGCTGCGG - Intergenic
1147617021 17:41835833-41835855 CCTCTGGGGCGTGCGGGGGCCGG - Intronic
1148804807 17:50258814-50258836 GCTCAGGGGCTCCCGGGCCCTGG - Intergenic
1149661812 17:58338119-58338141 GCTCTGGGGCTCTGGGGCCCTGG - Intergenic
1149661815 17:58338127-58338149 GCTCTGGGGCTCTGGGGCTCTGG - Intergenic
1150009144 17:61488399-61488421 CCTCTGGGGCAGGAGGGCTCAGG + Intergenic
1152070493 17:78131680-78131702 GCTCTGGGACGCCCGTGCGCGGG + Exonic
1152262266 17:79273564-79273586 GCTCTGGGGGGGGCGGGGGCGGG + Intronic
1152356499 17:79810123-79810145 GGGCTGCGGCGCGCGGGCCCCGG - Intergenic
1153997516 18:10454799-10454821 GCTGCGGGGCGCGCGCTCTCTGG - Exonic
1155113272 18:22737422-22737444 TCTCTGGGGCTCGTTGGCTCTGG - Intergenic
1157384169 18:47247865-47247887 GCCCTGGGGGGCGCGGGCGCAGG - Intronic
1160765535 19:805985-806007 GCACTGGGGCGGCCGGGCCCCGG - Intronic
1160830977 19:1104732-1104754 GGTATGGGCCGCGCGGGCGCAGG + Intronic
1160905562 19:1450219-1450241 GCCTCGGAGCGCGCGGGCTCCGG - Intronic
1160996709 19:1885360-1885382 GCCCTGGGGCCCGGGGGCGCGGG - Exonic
1161925156 19:7294209-7294231 GCTCTCGGCCCCGCGCGCTCTGG + Intergenic
1161982483 19:7637234-7637256 GGTCGGGGACGCACGGGCTCTGG + Intronic
1162327912 19:10009593-10009615 GCTCTGGGGACCGCGGGGTGGGG + Intronic
1162915686 19:13873287-13873309 GCTCTCGGGGGCGCGTCCTCGGG + Intronic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
1163636188 19:18438134-18438156 GCTCTCGGGCGCGCGACCTCCGG + Exonic
1164439270 19:28259793-28259815 GCTCTGTGGCCAGAGGGCTCTGG - Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164835256 19:31351488-31351510 GCTCTCGGGCTGGCGGACTCGGG + Intergenic
1168298236 19:55388328-55388350 GCTCTGGGGGCAGGGGGCTCAGG - Intronic
925027508 2:621286-621308 GCCCTGGGGCGCGCGCAGTCGGG + Intergenic
925265202 2:2562114-2562136 GCTCTGGGTTCCGAGGGCTCTGG - Intergenic
925589179 2:5493291-5493313 CCTCTGGGGCGGGCGGTCCCTGG - Intergenic
926101683 2:10122363-10122385 GCCTTGGCGCGCGCGGGCCCCGG - Exonic
926299610 2:11593131-11593153 GCTCTGGGCCGCGCGGCTGCGGG + Intronic
926799417 2:16646492-16646514 GCTCTGGGGCAGGCAAGCTCAGG + Intronic
927684364 2:25160578-25160600 GCTCAGGGGCTCCCCGGCTCCGG - Intergenic
930798699 2:55420048-55420070 GCCCGGGGGCGCGCTCGCTCGGG - Intergenic
933886132 2:86720475-86720497 GCCATGGGGCAGGCGGGCTCCGG + Exonic
933924049 2:87076231-87076253 GCCATGGGGCAGGCGGGCTCCGG - Intergenic
934927405 2:98391268-98391290 TCTCTGGTGCACGCGGGCTCTGG + Intronic
935222409 2:101027047-101027069 GCTCTAGTGAGTGCGGGCTCTGG - Intronic
935640802 2:105288279-105288301 GCTCAGGGGTGCACTGGCTCAGG - Intronic
936531265 2:113278322-113278344 GCTCAGCGGCGCGGGGGCTCGGG + Intronic
937203779 2:120223192-120223214 GGTGTGGCGCGCGCGGGCACGGG + Exonic
937221918 2:120346724-120346746 GCCCCAGGGCGCGCGGGCTGCGG - Intronic
938310320 2:130285122-130285144 GCTCTGGGGCTCCCAGGCTTCGG + Intergenic
938377808 2:130820060-130820082 GGCCTGGGGCTGGCGGGCTCGGG - Intergenic
939185934 2:138861052-138861074 GCTCTGGGTCCCGAGAGCTCTGG - Intergenic
941314344 2:163973792-163973814 GGTCAGGGGGGCGCGGGCTCTGG + Intergenic
944933618 2:204545486-204545508 CCTCTGCGGCGCCCGCGCTCTGG - Intergenic
945188906 2:207166513-207166535 CCTCTGAGGGGCGCGGGCTCCGG - Intronic
946064473 2:216974798-216974820 GCTCAGGGGCGCGGTGGCTGAGG + Intergenic
946235735 2:218323444-218323466 GCTCCGAAGCGTGCGGGCTCGGG + Intronic
947983231 2:234427350-234427372 GCTCTGGGGCCCTGGGGCTGGGG + Intergenic
948116020 2:235494610-235494632 GCTCGGCGGCCCGCGGGCCCCGG + Exonic
948398864 2:237668120-237668142 GCTCGGGGGAGCCCCGGCTCAGG - Intronic
948580924 2:238986696-238986718 GCTCGGCGGGGCGCGGGTTCAGG + Intergenic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
949040079 2:241844033-241844055 GGTCGGGGGCGCGGGGGCGCGGG + Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1169771939 20:9210506-9210528 GCTCTGGAGGGCGGGGGCTGTGG + Intronic
1171239163 20:23551217-23551239 GCTCTGGGGCCCTGGGGCTGAGG + Intergenic
1172529310 20:35619118-35619140 GCGCGGGGGCGCGGGGGCTGGGG - Intronic
1174053259 20:47781852-47781874 GCTCTGGGGCGGGCAGTCCCTGG - Intronic
1175367735 20:58467300-58467322 GCTGCGGAGCGCCCGGGCTCAGG - Exonic
1175911385 20:62406971-62406993 GCCCTGGGGCGCGGGGGTCCTGG + Exonic
1176380659 21:6110900-6110922 GCTCTGACGCGCGCGGGATGAGG - Intergenic
1178610059 21:34072912-34072934 GGGCCGCGGCGCGCGGGCTCGGG - Intergenic
1178673927 21:34615013-34615035 GCACAGGGTCGCGCGGGCGCGGG - Exonic
1179742813 21:43427340-43427362 GCTCTGACGCGCGCGGGATGAGG + Intergenic
1180014769 21:45074819-45074841 GCTCGGGCGGGCGCGGGCTCCGG + Intronic
1180783529 22:18534792-18534814 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1180975060 22:19843693-19843715 GCTCTGGGCAGCCGGGGCTCGGG - Intronic
1181046560 22:20217360-20217382 GCTGTGGTGCGCTGGGGCTCAGG + Intergenic
1181121677 22:20671212-20671234 GCCCTGGGGCCCGGGGGCGCGGG - Intergenic
1181127096 22:20708843-20708865 GCCCTGGGGAGGGCTGGCTCAGG - Intronic
1181240431 22:21474144-21474166 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1181334645 22:22118252-22118274 GCCCTGGGGCCCGGGGGCGCGGG - Intergenic
1182123516 22:27801091-27801113 GCTGCGGGGCGCGGGGACTCCGG - Exonic
1183683639 22:39349804-39349826 GCGCGGGGGCGCGCGTGCTGCGG - Intergenic
1184218822 22:43085890-43085912 GCTCAGGAGCGGGCTGGCTCAGG + Intronic
1184690194 22:46113970-46113992 GCTCTGGGGCGCGTCTGCTGCGG + Intergenic
1184788751 22:46686076-46686098 CCTCTGCAGCGCGAGGGCTCCGG - Exonic
1184942762 22:47781166-47781188 GCTCTGAGTGGCGCGGGCTTTGG + Intergenic
1185094379 22:48798419-48798441 GCTCTGGGGCGCGCTGGCTTTGG - Intronic
1185394156 22:50578294-50578316 GCGCTGGGGCCCGCGCGCTCGGG - Intronic
951558817 3:23945877-23945899 GTTCGGCGGCGCGCGGGCGCCGG + Intronic
952644496 3:35639355-35639377 GGTCTGGGGCCCGGGGTCTCCGG + Intronic
952937697 3:38413203-38413225 GCCCTGGGGCACACGGGCACAGG - Exonic
956605008 3:71065080-71065102 GGGCCGGGGCGCGCGGGCGCGGG - Intronic
956979034 3:74614823-74614845 GCGCAGGGCCGCGCGGGGTCCGG - Intergenic
957078396 3:75618832-75618854 GCTATGGGGGGCGGGGCCTCAGG + Intergenic
961684075 3:128617556-128617578 GGTCTGGGGTCGGCGGGCTCAGG - Intergenic
962808873 3:138945704-138945726 GCACTGGTGGGCGCGGGCGCCGG + Exonic
963827312 3:149970287-149970309 GGGCTGGGGCGCGCGGGCCCCGG - Intronic
966653492 3:182327200-182327222 GCAGTGGGCCCCGCGGGCTCTGG - Intergenic
968817132 4:2827965-2827987 GCTGAGGAGCGCGCAGGCTCAGG + Intronic
968899460 4:3424215-3424237 GCTCTGGAGCGTGGGGGTTCCGG + Intronic
968901780 4:3435510-3435532 GCTCTGGGGAGAGGGGGCTTTGG - Intronic
968901787 4:3435526-3435548 GCTCTAGGGAGAGGGGGCTCTGG - Intronic
968901798 4:3435558-3435580 GCTCTGGGGAGACGGGGCTCTGG - Intronic
969075357 4:4573982-4574004 ACTCTGGGGAGCTCGGGATCAGG + Intergenic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
970637136 4:18021832-18021854 CCTCCGGGGGGCGCGCGCTCCGG - Exonic
971556082 4:28014250-28014272 GCTCTGGGGTGGGGGGGCCCAGG - Intergenic
984973496 4:185210171-185210193 GCGGCTGGGCGCGCGGGCTCCGG - Intronic
985512605 5:321061-321083 GCTCTCGGCCGCGCGGTCCCGGG + Intronic
985652053 5:1111870-1111892 GGGCTGGGGCGCTCGGGCTCGGG + Exonic
995650291 5:114361834-114361856 GCCCTGGAGCGCCCTGGCTCTGG + Intronic
997676556 5:135717378-135717400 GCTCTGGGGTGGACGGGCCCTGG - Intergenic
997984476 5:138492002-138492024 GCGCAGGGGCGCAGGGGCTCCGG - Intergenic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1000302943 5:159972288-159972310 GCTCAGGCGCGGGCAGGCTCAGG - Exonic
1001617747 5:173056583-173056605 GCTCTGGGCCGGGCCGGCGCGGG + Intronic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002929780 6:1625056-1625078 GCTGTGGGGCGCGAGGCCCCAGG + Intronic
1003034950 6:2634145-2634167 GCTCAGGGGCGCCCGGACTCTGG + Intronic
1003645539 6:7910659-7910681 GCGCTGGGGCGCCCGGGCCCAGG - Exonic
1004262142 6:14117756-14117778 GAGCTGTGGCGCGCGGGCGCCGG - Exonic
1006068945 6:31483143-31483165 GCCCTGGGGCGGCCAGGCTCAGG - Intergenic
1006814291 6:36839963-36839985 GCTCCGGGGCGCCCGGGCTGCGG + Exonic
1007628730 6:43260825-43260847 GCTCTGGGGCACTCGGGAGCAGG + Intronic
1013512718 6:110859076-110859098 TCCCTCGGGCGCGCAGGCTCGGG + Intronic
1014313097 6:119830165-119830187 GATCTGGGGCTCTGGGGCTCAGG + Intergenic
1018859333 6:167699293-167699315 GCTCTGTGGTGCGGGGGCTGCGG + Intergenic
1019128880 6:169859416-169859438 GCACTGGGGCTCGCGGGCTCAGG - Intergenic
1019153631 6:170024504-170024526 GATCAGGGGCACCCGGGCTCAGG - Intergenic
1019421700 7:953975-953997 GCTGTGGGGTCCGCCGGCTCCGG - Intronic
1019421976 7:954789-954811 TCCCCGGGGCGCGCGGGCTGGGG - Intronic
1019828372 7:3301722-3301744 GCCCGGGGTCGCGAGGGCTCCGG - Exonic
1020099600 7:5387815-5387837 GCTTTCGGGCGCGAGGGCTCTGG - Exonic
1023791844 7:43758841-43758863 GCTCTGGCGGCCGCGGGCCCGGG - Intronic
1023913790 7:44573638-44573660 GCTCGGGCCCGCACGGGCTCCGG - Exonic
1024103770 7:46059876-46059898 GGTCTGGGGCTTGCGGGCTGGGG - Intergenic
1031531868 7:122886186-122886208 GCGCCGGGGCGCGCGGGCGGCGG - Exonic
1032710853 7:134458968-134458990 GCTCGTGGGGGCGCGGGCCCGGG - Intronic
1032793106 7:135256925-135256947 GCTCTGGGGCAGGAGGACTCAGG + Intronic
1034147324 7:148884443-148884465 GCTCGTGGGCGGGCGGGCACTGG + Intergenic
1034928207 7:155140436-155140458 GCTCAGGGGTGCTGGGGCTCAGG - Intergenic
1034928303 7:155140772-155140794 GCTCAGGGGTGCTGGGGCTCAGG - Intergenic
1034996151 7:155578341-155578363 GCTCTCTGGCTCTCGGGCTCTGG + Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036785233 8:11681188-11681210 GCCCTGGCCCGCGCGGGATCTGG + Intronic
1037457060 8:19074069-19074091 GCTGCGGGGCGCGGTGGCTCGGG - Intronic
1038035432 8:23682724-23682746 GCTCCGGGTCGCGCTGTCTCTGG + Exonic
1039521669 8:38176876-38176898 GCCCTGAGGCGCTCGGGCTACGG + Exonic
1039936509 8:42051417-42051439 GCTCGCGGGCGCTCGGGTTCGGG - Intronic
1043148337 8:76682468-76682490 GCTCTCGGCGGCGCGGGCGCGGG + Intronic
1043873821 8:85463776-85463798 GCTCCGGGGCTCCGGGGCTCCGG - Intergenic
1045111327 8:98941084-98941106 GCTCTGCGTGGCGCGGGCTGAGG - Intronic
1047499355 8:125430070-125430092 GCTCCGGGCAGCGCGCGCTCGGG - Intergenic
1049229101 8:141472954-141472976 GCTGTGGGGCGGGCAGGGTCAGG + Intergenic
1049268106 8:141680348-141680370 GCTGTGGGGCAGGCAGGCTCAGG + Intergenic
1049383535 8:142329623-142329645 GCTCTGGGGTGCTCGGGCTCAGG - Intronic
1049716420 8:144095156-144095178 GCTCCCGGGCGCGCGTGCCCGGG + Exonic
1051304922 9:15699271-15699293 GCTCGTGGGCTCGCTGGCTCAGG + Intronic
1053435129 9:38069178-38069200 GGGCACGGGCGCGCGGGCTCCGG - Exonic
1055266268 9:74498631-74498653 TCCCTGGGCCGCGCGGGCTCGGG - Intronic
1055513073 9:77014202-77014224 GCGCCGGGCCGCGCAGGCTCAGG - Intergenic
1056243067 9:84668720-84668742 GCTCCGGGCAGCGCGGGCGCAGG + Intronic
1056659518 9:88534378-88534400 GCCCAGGGGCGCGAGGGCGCGGG + Intergenic
1057432338 9:95005297-95005319 GCGCTGCGGCGCGCGGGTGCGGG + Intronic
1058699617 9:107589566-107589588 GCTCTGGGGCTGTGGGGCTCTGG - Intergenic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1059412613 9:114142400-114142422 GCTCTGAGGCCTGGGGGCTCAGG + Intergenic
1060192084 9:121599699-121599721 GCCCTGGGCCGCTCAGGCTCCGG + Intronic
1060302513 9:122383570-122383592 GCTCTGGGGCGGGATGCCTCGGG - Exonic
1060402952 9:123358697-123358719 GCTCTGGGGCTTCCTGGCTCTGG - Intronic
1061129830 9:128702690-128702712 GCGCTGGGGCGCGGGACCTCGGG + Exonic
1061196692 9:129110672-129110694 CCTCTGGGCCGAGCGGGCTGCGG + Exonic
1061317109 9:129803230-129803252 GCTCCGGGGCGCGGCGGCGCTGG + Exonic
1061666765 9:132164540-132164562 GCTCTGGGCAGCGCGAGCTCGGG + Intronic
1061747105 9:132748447-132748469 GCTCAGGTGCGAGAGGGCTCAGG + Intronic
1061908989 9:133712958-133712980 GCTCTGGGGGAGGCGGGCGCAGG - Intronic
1061921162 9:133783359-133783381 GCTCTGGGGCACGTGAGCACTGG + Intronic
1062055434 9:134467464-134467486 ACTCTGGGGCGTGCAGCCTCAGG + Intergenic
1062310132 9:135930968-135930990 GCTCTGGGGGGCGTGGGTGCTGG - Intergenic
1062345115 9:136110945-136110967 GCTCTGGGGAGGGCGGCCCCTGG - Intergenic
1062419312 9:136472011-136472033 GAGCTGGGCCGCTCGGGCTCGGG + Exonic
1062574691 9:137200683-137200705 GCCCTGGGGCGGCCGGGCTCGGG - Exonic
1062592733 9:137281363-137281385 GCGCTGGTGGGCGCGGTCTCCGG - Exonic
1189888833 X:45577604-45577626 GCTCTGGGGAGCACAGGCTTTGG + Intergenic
1190267384 X:48835493-48835515 GCTCTGGGGGCCGCGGGCCGGGG - Exonic
1192533703 X:71911000-71911022 GCTCAGGGGCGCTCGGGCCAGGG + Intergenic
1195093487 X:101485537-101485559 GCCCTGGGGCCCGCGCGCCCTGG + Intronic
1200100760 X:153688308-153688330 GCCCGGGGGCGCGCGGGCGGCGG - Exonic
1200138694 X:153886754-153886776 GCTCTGGGGTGCGCAGGAGCCGG - Intronic
1200233540 X:154457985-154458007 GCGCGGGCGCGCGCGGGTTCCGG + Intergenic