ID: 1132849894

View in Genome Browser
Species Human (GRCh38)
Location 16:2020246-2020268
Sequence GCTCTGGGGCGCGCGGGCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132849894_1132849905 11 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849905 16:2020280-2020302 CCGGAGTCCCTGGACTTCAGCGG 0: 1
1: 0
2: 1
3: 7
4: 152
1132849894_1132849900 -8 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849900 16:2020261-2020283 CCCAGAGCCTGCGCTGGAACCGG 0: 1
1: 0
2: 1
3: 22
4: 252
1132849894_1132849906 17 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849906 16:2020286-2020308 TCCCTGGACTTCAGCGGAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1132849894_1132849903 1 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849903 16:2020270-2020292 TGCGCTGGAACCGGAGTCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 101
1132849894_1132849909 22 Left 1132849894 16:2020246-2020268 CCGGAGCCCGCGCGCCCCAGAGC 0: 1
1: 0
2: 6
3: 34
4: 257
Right 1132849909 16:2020291-2020313 GGACTTCAGCGGAGCTGGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132849894 Original CRISPR GCTCTGGGGCGCGCGGGCTC CGG (reversed) Exonic