ID: 1132852462

View in Genome Browser
Species Human (GRCh38)
Location 16:2031008-2031030
Sequence CCCAAGCGCGGTTCTCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132852462_1132852472 6 Left 1132852462 16:2031008-2031030 CCACTGTGAGAACCGCGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1132852472 16:2031037-2031059 GTGTGGGATCTGGAGTTCTGAGG 0: 1
1: 0
2: 2
3: 25
4: 371
1132852462_1132852470 -10 Left 1132852462 16:2031008-2031030 CCACTGTGAGAACCGCGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1132852470 16:2031021-2031043 CGCGCTTGGGGCAGGGGTGTGGG 0: 1
1: 0
2: 1
3: 15
4: 226
1132852462_1132852475 14 Left 1132852462 16:2031008-2031030 CCACTGTGAGAACCGCGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1132852475 16:2031045-2031067 TCTGGAGTTCTGAGGGTGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 264
1132852462_1132852471 -4 Left 1132852462 16:2031008-2031030 CCACTGTGAGAACCGCGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1132852471 16:2031027-2031049 TGGGGCAGGGGTGTGGGATCTGG 0: 1
1: 0
2: 4
3: 93
4: 836
1132852462_1132852473 7 Left 1132852462 16:2031008-2031030 CCACTGTGAGAACCGCGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1132852473 16:2031038-2031060 TGTGGGATCTGGAGTTCTGAGGG 0: 1
1: 0
2: 2
3: 18
4: 213
1132852462_1132852476 15 Left 1132852462 16:2031008-2031030 CCACTGTGAGAACCGCGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1132852476 16:2031046-2031068 CTGGAGTTCTGAGGGTGCAGGGG 0: 1
1: 0
2: 3
3: 31
4: 386
1132852462_1132852474 13 Left 1132852462 16:2031008-2031030 CCACTGTGAGAACCGCGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1132852474 16:2031044-2031066 ATCTGGAGTTCTGAGGGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132852462 Original CRISPR CCCAAGCGCGGTTCTCACAG TGG (reversed) Intronic