ID: 1132852808

View in Genome Browser
Species Human (GRCh38)
Location 16:2032569-2032591
Sequence CCCAGGGGGCACCCAAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132852808_1132852820 16 Left 1132852808 16:2032569-2032591 CCCAACTTTGGGTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132852820 16:2032608-2032630 CAGTGTCCTCTGTCCTGGCTGGG 0: 1
1: 0
2: 3
3: 33
4: 251
1132852808_1132852821 17 Left 1132852808 16:2032569-2032591 CCCAACTTTGGGTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132852821 16:2032609-2032631 AGTGTCCTCTGTCCTGGCTGGGG 0: 1
1: 0
2: 4
3: 35
4: 293
1132852808_1132852825 24 Left 1132852808 16:2032569-2032591 CCCAACTTTGGGTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132852825 16:2032616-2032638 TCTGTCCTGGCTGGGGATAGGGG 0: 1
1: 0
2: 1
3: 81
4: 628
1132852808_1132852826 27 Left 1132852808 16:2032569-2032591 CCCAACTTTGGGTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132852826 16:2032619-2032641 GTCCTGGCTGGGGATAGGGGAGG 0: 1
1: 0
2: 4
3: 74
4: 644
1132852808_1132852819 15 Left 1132852808 16:2032569-2032591 CCCAACTTTGGGTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132852819 16:2032607-2032629 TCAGTGTCCTCTGTCCTGGCTGG 0: 1
1: 1
2: 0
3: 22
4: 253
1132852808_1132852824 23 Left 1132852808 16:2032569-2032591 CCCAACTTTGGGTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132852824 16:2032615-2032637 CTCTGTCCTGGCTGGGGATAGGG 0: 1
1: 0
2: 6
3: 33
4: 284
1132852808_1132852828 30 Left 1132852808 16:2032569-2032591 CCCAACTTTGGGTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132852828 16:2032622-2032644 CTGGCTGGGGATAGGGGAGGTGG 0: 1
1: 0
2: 11
3: 130
4: 1156
1132852808_1132852823 22 Left 1132852808 16:2032569-2032591 CCCAACTTTGGGTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132852823 16:2032614-2032636 CCTCTGTCCTGGCTGGGGATAGG 0: 1
1: 0
2: 3
3: 38
4: 344
1132852808_1132852818 11 Left 1132852808 16:2032569-2032591 CCCAACTTTGGGTGCCCCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1132852818 16:2032603-2032625 GCTCTCAGTGTCCTCTGTCCTGG 0: 1
1: 0
2: 3
3: 25
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132852808 Original CRISPR CCCAGGGGGCACCCAAAGTT GGG (reversed) Intronic
900396169 1:2454070-2454092 CACAGTGGGCACCCATAGGTGGG - Intronic
900398678 1:2463894-2463916 CCCATGGGGCACACAGAGTCGGG + Intronic
900798633 1:4724440-4724462 CCCAGGGGGTGCCCAGAGGTGGG - Intronic
900813480 1:4825894-4825916 CCCAGGCTGAACCCAAATTTTGG + Intergenic
901691206 1:10974281-10974303 CCCAGGGCACAGCCAAAGTCAGG + Intronic
902829648 1:19003768-19003790 CCCAGGGGACACCCAAGATGAGG - Intergenic
905042714 1:34973506-34973528 CCCAGGGGCCATGCAAGGTTGGG - Intergenic
905789380 1:40782401-40782423 CCCAGAGGGCACCCCCAGCTAGG + Intergenic
908242396 1:62198377-62198399 CTCTGAGGCCACCCAAAGTTTGG - Intronic
908288970 1:62641717-62641739 CCCAGGTGGCTGCCAAAGTTGGG - Intronic
913984660 1:143553816-143553838 GCCAGGGGGCACTCACAGGTGGG + Intergenic
918498749 1:185170331-185170353 CAGAGGGGGCTACCAAAGTTAGG - Intronic
923456704 1:234171073-234171095 CCCAGGGGTTCCCCAAAGTTTGG + Intronic
924792583 1:247266459-247266481 CCCAGTGGGCACCCCAATTCCGG - Intergenic
1063126736 10:3142595-3142617 GCCAAGGGGCAGCCAGAGTTCGG + Intronic
1067473053 10:46549834-46549856 CCCAGCGGGACCCCAAAGGTGGG + Exonic
1074377783 10:112952713-112952735 GCCCTGGGGCCCCCAAAGTTGGG - Intronic
1075573004 10:123558933-123558955 CCCAGGCGGCGCCCAAAGCCTGG + Intergenic
1077454938 11:2672822-2672844 CCCAGGCAGAACCCAGAGTTGGG - Intronic
1077670388 11:4151902-4151924 CTTAGGGGGTACCCAAAGTCAGG + Intergenic
1082131574 11:48496494-48496516 TACATGGGGCATCCAAAGTTGGG - Intergenic
1082565076 11:54667448-54667470 TACATGGGGCATCCAAAGTTGGG - Intergenic
1083436653 11:62647691-62647713 CCCAGGGGGCACTGAATGTGGGG - Exonic
1083683502 11:64361962-64361984 CCCAGGGGGCACAAGAAGTCCGG + Exonic
1083840126 11:65299511-65299533 CTCGAGGGGCACCCAAGGTTGGG + Intronic
1083920546 11:65779823-65779845 CCCAGGGACCACCCCCAGTTGGG + Exonic
1084360829 11:68667613-68667635 CCCAGGGTCCACCCACAGCTGGG + Intergenic
1084934292 11:72578831-72578853 CACAGGGGGCACCCAAAGCTGGG + Intronic
1085034425 11:73291608-73291630 CAGAGTGGGAACCCAAAGTTTGG - Intronic
1085447955 11:76614079-76614101 CCCAGGAGGCAGCCAGAGCTGGG + Intergenic
1088847577 11:113681247-113681269 CCCTGGGGCCACCAAAAGATGGG - Intergenic
1089808666 11:121114335-121114357 CACATTGGGCACCCAAAGTTTGG + Intronic
1091717933 12:2793313-2793335 GCCAGGGGTCACCCAAACTCCGG - Intergenic
1095517029 12:43017207-43017229 CCCTGGGGGCAAGCAAATTTGGG + Intergenic
1099496086 12:83348067-83348089 CCCAGGTGGCATCCAGACTTGGG - Intergenic
1100473812 12:94917291-94917313 CCCAGGGGGCACCAGCAGTTTGG + Intronic
1100793016 12:98151391-98151413 TCCAGTGGGCTCCCAAACTTTGG - Intergenic
1104663353 12:130628375-130628397 CCCAGCGGTCTCCCAAAGCTTGG + Intronic
1104880249 12:132065690-132065712 CCCAGGGAAGACCCAAAGTGGGG - Intronic
1113922049 13:113918729-113918751 ACCTGGGGGCAGCCAGAGTTGGG - Intergenic
1114595166 14:23905894-23905916 TCAATGGGCCACCCAAAGTTAGG - Intergenic
1121586262 14:95064930-95064952 CCCAGGGAGAACCCAAAGGAAGG + Intergenic
1122409976 14:101520918-101520940 CCCAGGGGTCACCCTGAGGTGGG - Intergenic
1124615514 15:31239039-31239061 CTCAGGGGCCACCCAAGGTGGGG + Intergenic
1125328248 15:38558912-38558934 CCCAGGAGGCTCCCAGGGTTGGG + Intronic
1126825050 15:52540301-52540323 CCCAGTGGGGACCCAGAGTGGGG + Intergenic
1129171462 15:73810646-73810668 CCCCTGGGGCACTCAAGGTTGGG - Intergenic
1129180391 15:73870706-73870728 CGCAGGAGGCACCCAATGTGTGG - Intergenic
1129521255 15:76187659-76187681 CCCAGTGTGAGCCCAAAGTTAGG + Intronic
1130948920 15:88570396-88570418 CCCACTGGGCAGCCAAGGTTGGG - Intergenic
1130964396 15:88686228-88686250 CCCAGGGGGTCCCAAAAGTGGGG + Intergenic
1130994766 15:88897610-88897632 CACAGCCGGCTCCCAAAGTTTGG + Intergenic
1132526748 16:420217-420239 CCCATTGGCCTCCCAAAGTTGGG + Intergenic
1132852808 16:2032569-2032591 CCCAGGGGGCACCCAAAGTTGGG - Intronic
1132998762 16:2838706-2838728 CCCCGGGGGCACCCTCAGCTGGG - Intronic
1136289002 16:29260452-29260474 CCCAGGCGGCCCCCAGACTTTGG - Intergenic
1139744751 16:69065286-69065308 GCCAGGGAGCACACACAGTTAGG + Intronic
1142094734 16:88233379-88233401 CCCAGGTGGCCCCCAGACTTTGG - Intergenic
1142248122 16:88979044-88979066 CCCAGGTGGCCGCCAAAGTTGGG - Intergenic
1143016030 17:3891846-3891868 CCCAGGAGGCCCCCAAAGCCAGG + Intronic
1146804621 17:35855470-35855492 GAGAGGGGGCACCCAAAGTAGGG + Intronic
1149143183 17:53458337-53458359 CCCAGGGGGGACCCTATGTGGGG - Intergenic
1150491115 17:65574989-65575011 CCCAGGGGGCACCCAAGACCAGG + Intronic
1150739034 17:67764837-67764859 CCCAGTGGCAACCCAAGGTTAGG + Intergenic
1151489695 17:74425394-74425416 CCCAGGGGAAACACAAAGATGGG + Intronic
1151702112 17:75748985-75749007 CCCAGGTGGGCCCCAAACTTAGG - Exonic
1152756072 17:82087602-82087624 CACAGAGGGCACCCACAGCTAGG - Intronic
1153040588 18:810030-810052 CGCTGGGGTCACCCAAACTTGGG - Intronic
1156480288 18:37432089-37432111 ACCAGGTGGGACCCAAAGCTAGG - Intronic
1161467143 19:4437288-4437310 CACAGGTGGGACCCAAAGGTGGG + Intronic
1163522619 19:17800450-17800472 CCCAGGGGGCAGTCAAGGCTGGG - Intronic
1164999040 19:32745301-32745323 CCCTGGGGGCATCCTAGGTTGGG - Intronic
1166328923 19:42067662-42067684 CACAGGTGGCAGCCAAAGGTGGG + Intronic
927529120 2:23777562-23777584 CACAGAGGGCTCCAAAAGTTTGG + Intronic
927561808 2:24078723-24078745 CCCAGGAGGCAGCCACAGATAGG + Intronic
929778023 2:44940674-44940696 CCCAGAGGGCACTCAAACTTTGG - Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
936347682 2:111687682-111687704 CCCAGTGAGCACCAGAAGTTGGG - Intergenic
941387187 2:164867954-164867976 CCAAAAGGGCACCCAAACTTGGG - Intergenic
947868783 2:233420479-233420501 CCCTGGGGGCATCCTAACTTTGG + Intronic
948468119 2:238161865-238161887 CCCAGGGGGAGCCCCGAGTTAGG + Intronic
1169739562 20:8877299-8877321 ACCAGGGGACTCCCGAAGTTAGG - Intronic
1172180872 20:33002722-33002744 CCTAGGGAGCACCCAGAGCTTGG + Intronic
1175585143 20:60133113-60133135 CCCAGAGGACACCCAAAGCCTGG - Intergenic
1175903797 20:62370180-62370202 CCCAGGAGGCTCCCAAGGTCAGG - Intergenic
1181423116 22:22815508-22815530 CCCAGGTGGAACCAAAGGTTGGG - Intronic
1184238105 22:43197085-43197107 CGCAGGGGGCGCCCACATTTAGG - Intergenic
950363448 3:12466240-12466262 CCCTGGAGGGACCCACAGTTGGG - Intergenic
955871415 3:63442371-63442393 CCGAGTGGGGACCCAAAGTAGGG + Intronic
963951542 3:151207558-151207580 CCCAGGGAGCATCCAAGATTTGG - Intronic
979837501 4:125390027-125390049 CCCAGTGGTCACCCAAAATAGGG + Intronic
982186409 4:152805962-152805984 CCCAGGCCCCAACCAAAGTTGGG - Intronic
984732262 4:183078945-183078967 GCCAGGCGGTACCCAAACTTAGG + Intergenic
990992690 5:61701064-61701086 CCCAGGGGGAGCCAAAAGATTGG + Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
997862265 5:137428675-137428697 GCCAGAGGGGACCCACAGTTTGG - Intronic
998406830 5:141878760-141878782 CCCAGGGGGCAGACAGAGCTGGG - Intronic
1005959553 6:30685851-30685873 CCCAGGGGACAGCCCAAGCTTGG + Exonic
1007366833 6:41400072-41400094 TCAAGTGGGCACCGAAAGTTAGG + Intergenic
1007997272 6:46321657-46321679 GCCAGGGGGCATCCAAACCTGGG - Intronic
1015626495 6:135184019-135184041 CGCAGGGGGCAGCCAACGTCAGG - Intronic
1015732218 6:136360854-136360876 CCCAGGGGGTGCCCAGAGGTGGG + Intronic
1018970468 6:168525291-168525313 CCCTGGGGGCACTGAAAGATGGG + Intronic
1019409718 7:901211-901233 CCCAGAGGGCACCCGACGTGGGG - Intronic
1020471465 7:8540523-8540545 CCCAGGGGACACCCTAAGTGAGG + Intronic
1021963498 7:25895134-25895156 CACAGGGGGCAGGGAAAGTTGGG - Intergenic
1025877318 7:65495007-65495029 CCCAGGGGTCACCTCAGGTTTGG - Intergenic
1028069129 7:86428510-86428532 CCCTGGAGTCACCCAAAGGTCGG - Intergenic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1029627632 7:101730238-101730260 CCCAGGGGTCAAACCAAGTTGGG - Intergenic
1034273747 7:149815282-149815304 CCCAGGGGGCACCCACAAGTGGG - Intergenic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1038002352 8:23403101-23403123 CCCAGAGGGCTTCCAAATTTGGG + Intronic
1040284905 8:46094677-46094699 CCCAGGGTGAACCCCATGTTGGG + Intergenic
1042555843 8:70033233-70033255 CCCAGGTGGCACCCAGAGCCTGG - Intergenic
1048858418 8:138703836-138703858 CCCAGGAGGCACAAAGAGTTGGG + Intronic
1051523383 9:18015428-18015450 CCTTGGGGTCACCCAAAGCTTGG + Intergenic
1055593885 9:77846292-77846314 CCCAAGGGGCAGCCACAGCTTGG - Intronic
1057007015 9:91569217-91569239 CCCAGGGGGCAAGCAAAGCAGGG - Intronic
1058439245 9:104991944-104991966 CCCAGGACACACCCATAGTTTGG - Intergenic
1060192234 9:121600241-121600263 CCCCTGGGGCACCCAAGTTTTGG + Intronic
1061399937 9:130362837-130362859 CCCAGGGGGAAGCCCAAATTAGG - Intronic
1186768246 X:12792114-12792136 CCCAGCGTGCAACCAGAGTTGGG - Intronic
1187297539 X:18016393-18016415 CCCAAGGTGCAGCCAGAGTTGGG + Intergenic
1197576558 X:128219291-128219313 CCCAGGTTCCACCCAAAGATAGG + Intergenic