ID: 1132852906

View in Genome Browser
Species Human (GRCh38)
Location 16:2032887-2032909
Sequence AGCCCCCAAGGCCCTCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 232}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132852906_1132852916 24 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852916 16:2032934-2032956 TTCTGCGGGAGGCGGCTGTGTGG 0: 1
1: 1
2: 0
3: 11
4: 189
1132852906_1132852917 28 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852917 16:2032938-2032960 GCGGGAGGCGGCTGTGTGGTTGG 0: 1
1: 0
2: 1
3: 22
4: 272
1132852906_1132852913 10 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852913 16:2032920-2032942 GTGAGGGGTGACAGTTCTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1132852906_1132852910 -6 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852910 16:2032904-2032926 GGGGCTAAGAGCAGGTGTGAGGG 0: 1
1: 0
2: 5
3: 29
4: 315
1132852906_1132852915 16 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852915 16:2032926-2032948 GGTGACAGTTCTGCGGGAGGCGG 0: 1
1: 0
2: 1
3: 8
4: 184
1132852906_1132852919 30 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852919 16:2032940-2032962 GGGAGGCGGCTGTGTGGTTGGGG 0: 1
1: 0
2: 1
3: 42
4: 1463
1132852906_1132852912 9 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852912 16:2032919-2032941 TGTGAGGGGTGACAGTTCTGCGG 0: 1
1: 0
2: 1
3: 22
4: 198
1132852906_1132852918 29 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852918 16:2032939-2032961 CGGGAGGCGGCTGTGTGGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 151
1132852906_1132852911 -5 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852911 16:2032905-2032927 GGGCTAAGAGCAGGTGTGAGGGG 0: 1
1: 0
2: 4
3: 27
4: 298
1132852906_1132852909 -7 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852909 16:2032903-2032925 GGGGGCTAAGAGCAGGTGTGAGG 0: 1
1: 0
2: 6
3: 35
4: 415
1132852906_1132852914 13 Left 1132852906 16:2032887-2032909 CCATCTGGAGGGCCTTGGGGGCT 0: 1
1: 0
2: 4
3: 24
4: 232
Right 1132852914 16:2032923-2032945 AGGGGTGACAGTTCTGCGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132852906 Original CRISPR AGCCCCCAAGGCCCTCCAGA TGG (reversed) Intronic
900343700 1:2200826-2200848 ATCCCCCAAGGTCCTCCAAGTGG + Intronic
900685425 1:3945065-3945087 ATCCCCCCAGGGACTCCAGAGGG - Intergenic
900819241 1:4873520-4873542 AGCCCCAGGAGCCCTCCAGAAGG + Intergenic
900866446 1:5272145-5272167 AGCCACCATGGCTTTCCAGAAGG - Intergenic
900959519 1:5910152-5910174 AGACCCCAAGCCCATCCTGACGG + Intronic
901050492 1:6423802-6423824 AGCCCCCACGGGACTCCAGAGGG + Intronic
902719708 1:18295851-18295873 AGCCCCCTCGTCCCTCCAGGGGG + Intronic
904951098 1:34239576-34239598 AGCCCCCAAAGACCTTCATAGGG - Intergenic
906895218 1:49763707-49763729 ACTCCCCCAGGGCCTCCAGATGG + Intronic
907481532 1:54748452-54748474 AGCCCCCAGGGCCCTTCACCTGG - Intergenic
909482622 1:76142059-76142081 ATCCCCCAAGGCCCAGCAGGGGG - Intronic
910713434 1:90204990-90205012 AGCCCCCAAGCTCCCCCAGATGG - Intergenic
912164674 1:107029320-107029342 AGTCCCCAAGGCCATCAACATGG + Intergenic
915380168 1:155433289-155433311 AGCTTCCAAGGCCCTCCTGGAGG + Intronic
915543879 1:156585010-156585032 AGCCCCCAACACCCTGCAGAGGG - Intronic
915827292 1:159091659-159091681 TTCCCCCAAGGGCATCCAGAGGG - Intronic
916075317 1:161197176-161197198 AACCCCAAAGTCCCTCCTGACGG - Intronic
920049595 1:203155400-203155422 AGTCCCCAATGGCATCCAGAAGG + Intronic
920365888 1:205448235-205448257 AGCCACCAAGGGGCACCAGAAGG - Intronic
922774705 1:228209287-228209309 AGCCCCCCAGACCCTGCAGTCGG + Intronic
922893117 1:229076936-229076958 AGCACCCACAGCCATCCAGAAGG + Intergenic
1063179430 10:3584432-3584454 AGTCCCCCAGCCCCTCCCGAGGG + Intergenic
1064011946 10:11742590-11742612 TGCCCCGAAGGCCCGCAAGACGG - Exonic
1065435390 10:25699833-25699855 AGCCCGCTTGGCCCTCCAGAAGG - Intergenic
1069535972 10:69253374-69253396 TGCTCCCAAGCCCCTGCAGAAGG - Intronic
1069622980 10:69849276-69849298 AGCCCCCAGGCCCCTCCTGGAGG - Intronic
1070765990 10:79056757-79056779 ATCCCCCAAGCCCCTCCCAAGGG + Intergenic
1070767029 10:79062623-79062645 AGCCCCCAAGGCCTTGCACTGGG + Intergenic
1070979458 10:80632770-80632792 AGCCCCCAAGGCCTTCTGGGGGG + Intronic
1073453233 10:103621802-103621824 AGCCCCCCAGGCCCAGCACATGG - Intronic
1073987150 10:109222721-109222743 AGCCCCCAAGCACCTCAGGAAGG + Intergenic
1074300346 10:112227512-112227534 AGCCCACTAGGCCTTCCACAGGG + Intergenic
1076462988 10:130659051-130659073 AGGCCCCCAGCCCCTCCAGATGG - Intergenic
1076720151 10:132388893-132388915 AGCCCCCGAGCCCCTGCAGGCGG - Intergenic
1076812900 10:132898486-132898508 AGCCCCCAAGGCCCAGGGGATGG - Intronic
1076991794 11:279537-279559 GGCCCGCAAGACCCTCAAGAGGG + Exonic
1077531048 11:3095086-3095108 CACCCCCAAATCCCTCCAGAGGG + Intronic
1077889766 11:6410755-6410777 AGGCCCCAAGCCCTTACAGATGG - Exonic
1078610243 11:12813424-12813446 AGCCCACAAAGACTTCCAGAAGG - Intronic
1080633187 11:34099312-34099334 GGCCCCCAAGACCCAACAGAGGG + Exonic
1080687045 11:34524567-34524589 AGCCCCCAATGCCCTCCTAAGGG - Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082347646 11:51457987-51458009 AGGCCTCAAAGCCCTCCAAATGG - Intergenic
1082476681 11:53328463-53328485 AGGCCTCAAAGCCCTCCAAATGG - Intergenic
1083172754 11:60932821-60932843 TCCCACCAAGGCCCTCCAGCAGG - Intronic
1084041219 11:66543743-66543765 AGCCCACACGCCCCTCCACATGG - Exonic
1085023627 11:73224052-73224074 AGAGCCCAAGGGCCTCCTGAAGG + Intronic
1085687187 11:78633791-78633813 AACCCCCTTGGGCCTCCAGATGG - Intergenic
1086453066 11:86936172-86936194 AGCCCCCAAGTCCTGCCAGGTGG - Intronic
1089848707 11:121479133-121479155 AGCCCCCAGGGCCAGCCAGCTGG - Intronic
1090877538 11:130804473-130804495 AGCTCCCAATGGGCTCCAGATGG + Intergenic
1091815130 12:3432052-3432074 TGCCCCCAAGTCCCCCTAGAAGG + Intronic
1092396899 12:8134721-8134743 AGCTTCCAAGGCCCTCCTGGAGG - Intronic
1092672692 12:10882251-10882273 CGCCCACAAGGACCTCCACAGGG - Exonic
1092677002 12:10931024-10931046 CGCCCACAAGGACCTCCACAGGG + Exonic
1093023067 12:14220774-14220796 AGCCACCAAGGGCCCCAAGAAGG - Intergenic
1095332274 12:40980908-40980930 GGCCCTCCAGGCCCTCCAGGTGG + Exonic
1099152262 12:79129064-79129086 AGTCCCCTAGACCCTCCTGATGG + Intronic
1102202729 12:111068762-111068784 TGCCCCCATGGCCCTCCTGTTGG + Intronic
1103214558 12:119191610-119191632 AACTCCCCAGCCCCTCCAGAAGG + Intronic
1103713906 12:122932115-122932137 AGCCCCCATCGCCCAGCAGATGG - Intronic
1104151677 12:126090475-126090497 AGCCACCAAGCCCCTGCAGTGGG - Intergenic
1104633090 12:130421153-130421175 AGCTCCATAGTCCCTCCAGAGGG + Intronic
1104784952 12:131443435-131443457 AGACCCCAGGGCCCTCCAGGTGG + Intergenic
1104961169 12:132489440-132489462 TGCCCCCAAGTCCCACAAGAAGG - Intergenic
1112045801 13:95596508-95596530 TTCCCCAAAGGCCATCCAGATGG + Intronic
1112242468 13:97695421-97695443 AGCCACCAAGCCCCGCCACAAGG + Intergenic
1113235686 13:108270183-108270205 AGCCCCCAAGGCCGGCCTGGAGG + Exonic
1113635609 13:111917010-111917032 AGCCCCCCAGTTCCTCAAGATGG - Intergenic
1113741760 13:112716245-112716267 AGCCCCCACTTCCCACCAGATGG - Intronic
1113950980 13:114070556-114070578 AGCCCGCACAGCCCTCCAAATGG + Intronic
1117407331 14:55417028-55417050 GCCCCCCAGGGGCCTCCAGATGG - Intronic
1118443840 14:65834706-65834728 AGCTTCCATGGCCCTGCAGATGG - Intergenic
1119660924 14:76451055-76451077 AGCCCTCCCTGCCCTCCAGAAGG - Intronic
1120070800 14:80100169-80100191 TGTCCCCAAGGCCTTCTAGAAGG - Intergenic
1121612690 14:95292479-95292501 AGGCTCCATGGCCCTCCAGGAGG + Intronic
1122348287 14:101073651-101073673 AGCCCCAGTGGCGCTCCAGAGGG + Intergenic
1122721489 14:103724918-103724940 AGCCCCCAATGCGCTGCTGAAGG + Intronic
1122934609 14:104950167-104950189 GGCCCTCAAGGGCCCCCAGATGG - Exonic
1127737215 15:61853748-61853770 AGCCACCACGGCCCGCCAAAAGG - Exonic
1128501651 15:68230945-68230967 AGCCCTCAAGCCGCTGCAGAAGG + Intronic
1129769585 15:78194505-78194527 AGCCGCCAAGGGCTTCCTGAAGG - Exonic
1130946518 15:88553210-88553232 ACCCCCCACCTCCCTCCAGATGG + Intergenic
1132339443 15:101068751-101068773 GGCGCCCCAGCCCCTCCAGACGG - Exonic
1132847425 16:2006961-2006983 GGCCCCCAAGACCCCCCACAGGG + Intronic
1132852906 16:2032887-2032909 AGCCCCCAAGGCCCTCCAGATGG - Intronic
1133132584 16:3686683-3686705 AGCCCCCAACCCCAGCCAGAGGG - Intronic
1133236237 16:4388657-4388679 AGCCCCCAGGGCCCTGCTGGTGG + Intronic
1134831683 16:17328896-17328918 AGCCTCCAAAACGCTCCAGATGG + Intronic
1135324372 16:21517000-21517022 AACCCCAAATGCCCTCCACAGGG + Intergenic
1136315078 16:29449626-29449648 AGCCCCGCAGGGCCTCCAGCAGG + Intronic
1136335856 16:29610266-29610288 AACCCCAAATGCCCTCCACAGGG + Intergenic
1136429655 16:30188965-30188987 AGCCCCGCAGGGCCTCCAGCAGG + Exonic
1141445285 16:84054231-84054253 AGCCACTAAGTCCCTCCTGACGG + Exonic
1141989944 16:87603729-87603751 AGCCCCCAACACCCTTCAGCTGG - Intronic
1142036578 16:87866068-87866090 AACCCCAAATGCCCTCCACAGGG + Intronic
1142125383 16:88407695-88407717 AGCCCCCAAGTCCCACCTGTGGG + Intergenic
1142202513 16:88767996-88768018 TTTCCCCCAGGCCCTCCAGAGGG + Intronic
1143877529 17:10003441-10003463 AGCCACCAAGGCCCCCCATGGGG + Intronic
1144343650 17:14331502-14331524 AGCCCCCAACCCCCACCACAAGG - Intronic
1147051112 17:37795843-37795865 GGCCCCAAAGACCCTGCAGAGGG + Intergenic
1148214633 17:45827745-45827767 GGCCACCAAGGCCCTTCTGAAGG - Intronic
1148623648 17:49053152-49053174 AGCTCCCAACTGCCTCCAGAAGG - Exonic
1150294717 17:64001607-64001629 AACCCCCAAACCCCACCAGAGGG - Intronic
1150382633 17:64732779-64732801 AGCTCCCAAGGGCTTGCAGAGGG + Intergenic
1150773589 17:68061769-68061791 AGCTCCCAAGGGCTTGCAGAGGG - Intergenic
1151586241 17:75010397-75010419 AGCCACCATGCCCCACCAGATGG - Intergenic
1152895191 17:82906938-82906960 AGCTCCCAGGGTCCTCCAGTCGG + Intronic
1153229295 18:2921152-2921174 AGGCCCGATGGCCCTGCAGAAGG + Intronic
1155166685 18:23237594-23237616 AGCCACCAAGGAACTCCAAACGG - Intronic
1157456415 18:47833504-47833526 AGCCACTAAGGACTTCCAGAGGG + Exonic
1160948842 19:1656090-1656112 AACCCCCAGCGCCCTCCAGCAGG + Intergenic
1161042453 19:2117238-2117260 GGCCCCCAAGGCCCAGAAGAAGG - Exonic
1161720601 19:5900171-5900193 AGCCCCCAGCGCCCTTCAAAAGG + Intronic
1162530178 19:11231363-11231385 AGCCCCCAAGACCACCCAGAGGG + Intronic
1162960054 19:14120367-14120389 GGCCCCCAAAGTCCTCTAGATGG + Exonic
1163270823 19:16252515-16252537 AGACCCCAAGTCCCTGGAGACGG + Intergenic
1163987213 19:20964867-20964889 AGCCCACTATGCCCTGCAGATGG + Intergenic
1166301348 19:41913562-41913584 AGCCCCCAGCGCCCTGCAGGAGG + Intronic
1166853910 19:45772986-45773008 GGACCCCAAGTCCCTGCAGAAGG - Intronic
1167493310 19:49803949-49803971 AGCCCCCATGCCCGGCCAGAAGG - Intronic
925140586 2:1547318-1547340 GGCCCCGAAGAGCCTCCAGAGGG - Intergenic
926415103 2:12642129-12642151 TACCTCCCAGGCCCTCCAGAGGG - Intergenic
927698396 2:25252394-25252416 AGCCAACCAGGCCCTCCAGCGGG - Intronic
928091836 2:28379286-28379308 ATCTCCCTAGGGCCTCCAGAGGG - Intergenic
930022292 2:47008758-47008780 TGCCCGAAAGGCCTTCCAGAAGG + Intronic
933897578 2:86825305-86825327 AGCCCCCATAGCCCCCCAGTAGG - Intronic
935705217 2:105850981-105851003 GGCCAACAAGACCCTCCAGATGG + Intronic
943179357 2:184524100-184524122 AGCCCCCAGGGCTCCCCAAAGGG + Intergenic
945470489 2:210223546-210223568 AGCCCCCCAGCCCATTCAGAGGG + Intronic
946311409 2:218884206-218884228 AGACCCCAAGGTCCTCCAGCAGG - Intronic
946404130 2:219483733-219483755 GGCCCCCCAGGCTCTCCAGCAGG - Exonic
946618855 2:221539510-221539532 TGCCCCAAAGGCCCTCCTGCTGG - Intronic
947984720 2:234438385-234438407 AGCACCCAAGGCCCTGGAGGGGG - Intergenic
948150340 2:235739746-235739768 AGTGTCCGAGGCCCTCCAGACGG - Intronic
948687546 2:239678318-239678340 GGCCTCCAGGGCCCTCCAGATGG + Intergenic
948822496 2:240557259-240557281 AGCCGCCAACGCCCGCTAGAGGG - Exonic
948879631 2:240850259-240850281 AGCCCCTAAGGACGGCCAGAAGG + Intergenic
1170877776 20:20267107-20267129 AGCCTCCAGGGCTCTCCTGAAGG - Intronic
1171384842 20:24763182-24763204 ATCCCCCCTGGCCATCCAGAGGG - Intergenic
1171454109 20:25257286-25257308 AGCCCCCAAGGCACTGCCCAGGG - Intronic
1174404134 20:50292809-50292831 AGCCCCCAAGCCCCGCCAGCGGG + Intergenic
1175166666 20:57048888-57048910 ATCCCCCAAGCTCCTCCAGAGGG - Intergenic
1175192704 20:57222302-57222324 AGCCACCAAGGCCCACCAGATGG + Intronic
1175263238 20:57687859-57687881 AGCCCACAAGGGCCCCCAGCAGG + Intronic
1175595144 20:60225126-60225148 TGCCCCCAAGGACCACCAGAGGG + Intergenic
1175971683 20:62689680-62689702 AGACCCCCAGACCCTCCGGAAGG + Intergenic
1178065147 21:28896282-28896304 ATCCCCCAAGAGCCTCCAGAAGG + Intergenic
1179586611 21:42377428-42377450 ATTCCCCAAGGGCCTCCAGGAGG + Intronic
1179889152 21:44327049-44327071 AGCCTGCCAGGCCCTCCAGCAGG + Exonic
1180163359 21:46007658-46007680 AGCCCCCAAGGGATTCCAGTGGG - Intergenic
1180729744 22:17972567-17972589 TGCCTCCAAGGCCCTGAAGATGG - Intronic
1181236325 22:21449783-21449805 AGCCCCCAAGGCCCTCTGGCCGG + Exonic
1181570628 22:23766239-23766261 TGCCCCCCAGCCCCTGCAGATGG - Exonic
1181803914 22:25363851-25363873 TGACCCCAAGGGCGTCCAGAGGG - Intronic
1181881321 22:25982550-25982572 TGTCCCCTAGGGCCTCCAGAAGG - Intronic
1182476979 22:30581743-30581765 AGACCCCAAGCTCCTCAAGAAGG + Intronic
1182617337 22:31596293-31596315 AGCATTCAAAGCCCTCCAGATGG - Intronic
1183035694 22:35139440-35139462 AGCCCCCTTGGCCCTCCTCATGG - Intergenic
1183317693 22:37145964-37145986 AGCCTCCACGTCCCTCCCGATGG + Intronic
1183650164 22:39149053-39149075 ACCCACCAATGCCCTCCAGCAGG - Intronic
1183831708 22:40421644-40421666 TGCCCCCAAAGACCTCCAGCTGG + Intronic
1184495242 22:44837321-44837343 AGTCCCCGATGCCCTCCAGTGGG + Intronic
1184515453 22:44959215-44959237 AACACACCAGGCCCTCCAGAAGG - Intronic
1184652859 22:45927071-45927093 AGCCCCCAGGCCTCTGCAGATGG + Intronic
1184839647 22:47045039-47045061 AGCCTCCATGGCCCTTCACATGG + Intronic
1184973373 22:48043481-48043503 AGCCTCCCTGGCCCTCCAGCTGG + Intergenic
949984887 3:9532879-9532901 TGTCCCCCAGGCCCTGCAGATGG + Intronic
950097636 3:10339175-10339197 AGCCCCCAAGAGCCTCCTGTAGG + Intronic
950441914 3:13015470-13015492 AGCCCCCAAGACCCTCACCACGG + Intronic
953385432 3:42503230-42503252 AGCCCACAGGCACCTCCAGACGG - Intronic
953853116 3:46480900-46480922 AGCCCCCATGGCCCACCTGGAGG - Intronic
954800856 3:53186205-53186227 TGCCATCAAGGCCCTCAAGAAGG + Exonic
955310301 3:57880040-57880062 AATCCCTAAGGCCCTCCACAGGG - Intronic
958797255 3:98718746-98718768 TGCCCCCAAGGGCCTCCAGAAGG + Intergenic
959194727 3:103165913-103165935 CGCCCCGAAGGCCTTCCAGCGGG - Intergenic
961739938 3:129027041-129027063 AGCCCCCAAGCATCTCCGGACGG + Intronic
963917898 3:150876832-150876854 ACCTCCCAAGGCTTTCCAGATGG + Intronic
967792250 3:193561828-193561850 AGCCCCCAAAGACCTCCATTGGG - Intronic
969248766 4:5953707-5953729 AGTCCCCCAGGCCCCCCAGCAGG - Intronic
969451436 4:7276167-7276189 AGCCCCCAAGCCCCTTCCCAGGG - Intronic
971195607 4:24470437-24470459 AGCACCCAAGGCCCGCCAGGCGG + Intergenic
971425273 4:26509412-26509434 TGTCCCTAAGTCCCTCCAGATGG - Intergenic
978366325 4:107986927-107986949 AGCCCCCAAGGGCCTACATTGGG + Intergenic
984933303 4:184867388-184867410 TGTCCCCTAGGGCCTCCAGAAGG + Intergenic
986280238 5:6316395-6316417 AGAGCCCAAGGCCCTCCTGGGGG - Intergenic
986317769 5:6601950-6601972 CTCCCCCAAGGCCCCCCACAAGG + Intronic
986380539 5:7181039-7181061 AGCCCTCAGGGTCCTCCAGAGGG + Intergenic
987519370 5:18959448-18959470 TGCCACCAACTCCCTCCAGATGG + Intergenic
988518474 5:31925098-31925120 AGCCCCTTAGGCCCTCCTGCCGG - Intronic
993411635 5:87581085-87581107 ATAACCCAATGCCCTCCAGATGG - Intergenic
994722268 5:103393836-103393858 CTCCACCAAGGCCTTCCAGAGGG - Intergenic
999173641 5:149616507-149616529 AGGCCCCCTGGTCCTCCAGAGGG + Intronic
1002582208 5:180215720-180215742 TCTCCCCAAGGGCCTCCAGAAGG + Intergenic
1002637822 5:180616870-180616892 TCCCCCGAAGGCCCTTCAGACGG - Intronic
1004366934 6:15020612-15020634 TGCCTCCCAGGCCCTCCAGATGG - Intergenic
1005947262 6:30603509-30603531 GGCCCCCAAGGCCCTGGAGGAGG - Exonic
1006016410 6:31084710-31084732 AGCCACCAAGCCCATCCATAAGG + Intergenic
1006029784 6:31170490-31170512 AGCTTCCAAGGCCCTCCTGGAGG - Exonic
1007318829 6:41011596-41011618 AGCCCACAAGGCCTCCCTGAGGG + Intergenic
1007594016 6:43040411-43040433 TGGCCCCAAGGCCCACCTGAAGG + Exonic
1007788364 6:44295031-44295053 AGTCCCCAAGGACCCACAGAGGG + Intronic
1008500927 6:52182222-52182244 ACTCCCCAAGGCCTTCCAGATGG + Intergenic
1012672952 6:102078849-102078871 AGCCCTTAATGCCCTACAGATGG + Intergenic
1012751238 6:103166815-103166837 AGGCCCCAAGGACAACCAGATGG + Intergenic
1013768181 6:113597294-113597316 AGTCCCCATGTCTCTCCAGATGG - Intergenic
1018719778 6:166563598-166563620 AGCCCCCAACTCCAGCCAGAGGG + Intronic
1019921065 7:4163543-4163565 ATCTCCCAGGGCCCTGCAGAAGG + Intronic
1019972240 7:4550306-4550328 AGCTCACCAGGGCCTCCAGAAGG + Intergenic
1020162104 7:5780985-5781007 AGCCCCCAGCGCCCCGCAGAAGG + Intronic
1021955736 7:25822766-25822788 AGCTCTCAAGCCCCCCCAGAGGG - Intergenic
1022103130 7:27180862-27180884 AGGCCCCAAGGCCCTCTCCAGGG + Intergenic
1022744532 7:33157072-33157094 AGCCCCCATGGAGCTTCAGAAGG - Intronic
1023255887 7:38311661-38311683 TGCCCCCCAGCCCCTGCAGATGG + Intergenic
1023262876 7:38375690-38375712 AGCGGCCAAGGCCAGCCAGATGG + Intergenic
1023478764 7:40610131-40610153 AGGCCCCAAGCCACTCCAGAAGG - Intronic
1026022594 7:66721414-66721436 CTCCCCCAAGAGCCTCCAGAAGG - Intronic
1029516148 7:101024529-101024551 ACCTCCCATGGCCCTCCAGTGGG + Intronic
1030254428 7:107492470-107492492 CTCCCCTAAGGGCCTCCAGAAGG - Intronic
1030386381 7:108872398-108872420 ACCCCCTAAGAGCCTCCAGAAGG - Intergenic
1032539143 7:132688866-132688888 TTCCTCCAAGGACCTCCAGACGG - Intronic
1033421596 7:141209025-141209047 AGCCCCCAACACCCTCCAGCAGG + Intronic
1034488554 7:151381152-151381174 TCCCCCCAAGGCCCTCGAGACGG + Exonic
1034901734 7:154911905-154911927 GGCCCACAGGGCCCTGCAGAAGG - Intergenic
1035669774 8:1408473-1408495 AGCCCCCATGGCCCTGCAGAGGG + Intergenic
1036195648 8:6711716-6711738 TTCCCCCTAGGGCCTCCAGAGGG - Intronic
1039907470 8:41797558-41797580 AGCCCCCAAGGCCCTTCGGCGGG - Intronic
1040073189 8:43204821-43204843 ACACCCCACGGCCCCCCAGACGG + Intergenic
1041005916 8:53496876-53496898 AGCTTCCAAGGCTCTGCAGAGGG - Intergenic
1041358254 8:57022497-57022519 GGCCCCCACCTCCCTCCAGATGG - Intergenic
1044926584 8:97214481-97214503 TGCCCACAGGGCCCTGCAGAGGG + Intergenic
1045063726 8:98427830-98427852 AGCACCCAAGACCCACCAGGAGG + Intronic
1045326342 8:101120268-101120290 AGCCCCCAAGGCACATCTGATGG - Intergenic
1047694684 8:127391697-127391719 AGCCCCAAAGGCCCCCCAGAGGG - Intergenic
1047697237 8:127415975-127415997 AGCTTCCAAGGCCCTCCTGGAGG + Exonic
1049373369 8:142278124-142278146 ATCCCCCAAGCCCCACCACAAGG + Intronic
1049451481 8:142664408-142664430 AGCCACCAGGGCCCTCCTGGAGG + Intronic
1050654200 9:7807802-7807824 ATTTCCCAAGACCCTCCAGAGGG + Intronic
1052612942 9:30799749-30799771 AGCCCGCTACGCCCTGCAGATGG - Intergenic
1055993484 9:82132264-82132286 AGCCACCAAGGGCAACCAGATGG + Intergenic
1056792009 9:89632069-89632091 ATGCCCCAACCCCCTCCAGAGGG - Intergenic
1056962564 9:91139133-91139155 CGCCCCCCAGGCCCTCCAGCTGG + Intergenic
1057719873 9:97523376-97523398 AGCCCCCATTTCCCCCCAGAGGG - Intronic
1057977305 9:99619932-99619954 TCTCCCCAAGACCCTCCAGAGGG + Intergenic
1058704745 9:107628930-107628952 AGCAGCCAAGGCTCTCCAGCAGG - Intergenic
1059388744 9:113985517-113985539 AGTCCCCCTGGCCCCCCAGAGGG - Intronic
1061329143 9:129881314-129881336 AGCCCCCACATCCCTCCAGGTGG - Exonic
1061630113 9:131866994-131867016 AGCCCCCCAGGCTCCCCCGATGG + Intronic
1061896258 9:133649790-133649812 AGGCCCCAAGGCCCTGCAAGGGG - Intronic
1062340156 9:136090563-136090585 AGCTCCCAACGCCCTCCATGAGG + Intronic
1187009988 X:15268916-15268938 AGCCCCCAAGGATCTCAACAGGG + Intronic
1191296353 X:58870539-58870561 AGGCCTCAAAGCCCTCCAAACGG - Intergenic
1191347219 X:59549881-59549903 AGGCCTCAAAGCCCTCCAAACGG - Intergenic
1191379225 X:59977755-59977777 AGGCCTCAAAGCCCTCCAAACGG - Intergenic
1191413543 X:60437452-60437474 AGGCCTCAAAGCCCTCCAAACGG - Intergenic
1191466555 X:61146876-61146898 AGGCCTCAAAGCCCTCCAAACGG - Intergenic
1191504284 X:61651580-61651602 AGGCCTCAAAGCCCTCCAAACGG - Intergenic
1191517116 X:61823664-61823686 AGGCCTCAAAGCCCTCCAAACGG - Intergenic
1198977161 X:142349110-142349132 AGTCCTGAAGGCCCTCCAGCTGG - Intergenic
1199076799 X:143534631-143534653 AGGCCACAGAGCCCTCCAGAAGG + Intergenic
1199976887 X:152899416-152899438 AGGCACCAAGGCCTGCCAGAAGG - Intergenic