ID: 1132852985

View in Genome Browser
Species Human (GRCh38)
Location 16:2033158-2033180
Sequence TGGAGCCTTCGCAGGGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132852977_1132852985 2 Left 1132852977 16:2033133-2033155 CCTAGCTGGGTGGGGGGCGCCAG 0: 1
1: 0
2: 0
3: 62
4: 1942
Right 1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG 0: 1
1: 0
2: 0
3: 20
4: 215
1132852969_1132852985 20 Left 1132852969 16:2033115-2033137 CCTTTCTTGGGACGGAAGCCTAG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG 0: 1
1: 0
2: 0
3: 20
4: 215
1132852966_1132852985 28 Left 1132852966 16:2033107-2033129 CCTTCCTTCCTTTCTTGGGACGG 0: 1
1: 1
2: 10
3: 56
4: 327
Right 1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG 0: 1
1: 0
2: 0
3: 20
4: 215
1132852968_1132852985 24 Left 1132852968 16:2033111-2033133 CCTTCCTTTCTTGGGACGGAAGC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG 0: 1
1: 0
2: 0
3: 20
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132852985 Original CRISPR TGGAGCCTTCGCAGGGGAGC GGG Intronic
900272739 1:1800960-1800982 AGGCGCCTTTGCAGGAGAGCGGG + Intronic
900830828 1:4963986-4964008 TGGAGCCATCGCAGAGAAGAGGG + Intergenic
900934525 1:5756693-5756715 TGGGGCCTTAGCAGGTGATCAGG - Intergenic
901630311 1:10644803-10644825 TGGAGCCTGCGGTGGGGAACAGG + Intronic
902649164 1:17825581-17825603 TGGAGGATTAGAAGGGGAGCTGG - Intronic
902691182 1:18110809-18110831 TGGAGCCTGTGCAGTGGCGCCGG + Intronic
902892157 1:19452259-19452281 TAGAGCCGTTGCGGGGGAGCAGG - Intronic
903180371 1:21602175-21602197 TGGAGCCCTCTCAGGGGACCTGG + Intronic
903369973 1:22829232-22829254 TGGAGCCTTGGCAGGGAAGGTGG + Intronic
903643572 1:24876643-24876665 TGGAGCCTTCAACGTGGAGCTGG + Intergenic
905281753 1:36853717-36853739 TTGAGCCTGCGGAGGGGAGAGGG + Exonic
906521113 1:46467458-46467480 TGGGGCCTTCTCAGGGTAGGTGG + Intergenic
907524449 1:55046067-55046089 TGGAAGCTTTGCAAGGGAGCTGG + Intronic
910678888 1:89843170-89843192 CTGAGCCTTTGCAGGGGAGTAGG - Intronic
912818720 1:112850164-112850186 GGGAGCCGGCGCTGGGGAGCCGG + Intergenic
913058537 1:115183851-115183873 TGAAGCCTTCTCAAAGGAGCCGG - Intergenic
915486371 1:156223801-156223823 TGGGGCCTTAGCAGGGGCTCGGG - Intronic
916422683 1:164651245-164651267 TGGAGGCTGTGCAGGGGAGGGGG + Intronic
917174609 1:172219608-172219630 GGGAGCCTTCACAGAGGTGCTGG + Intronic
918292618 1:183123338-183123360 TGGAGCCATTGTAGGGGAGCAGG - Intronic
918894997 1:190330959-190330981 TGGAGACTACTTAGGGGAGCGGG + Intronic
920919719 1:210288551-210288573 TAGAGCTATAGCAGGGGAGCAGG + Intergenic
921502187 1:215918332-215918354 TGGAGCCTTGGGAGGTGATCAGG + Intronic
1064584160 10:16822947-16822969 TTGAGCCTATGCAGGGAAGCAGG - Intergenic
1066166152 10:32790162-32790184 TGGAGCCTTGGGAGTGGGGCTGG - Intronic
1070599633 10:77856695-77856717 TGGGGCCTGGGCAGGGGAGACGG + Intronic
1070787449 10:79170201-79170223 TGGTGCCTGCAAAGGGGAGCTGG + Intronic
1076992795 11:284485-284507 TGGAGCCCTCGCTGGGGGTCAGG - Exonic
1077295729 11:1825464-1825486 TGGAGCCAACTCAGGGGAGCTGG + Intergenic
1079185406 11:18231709-18231731 TGGAGCTGTCTCAGGTGAGCAGG - Intronic
1080640621 11:34156251-34156273 TGGAGCCTTGCTATGGGAGCTGG + Intronic
1081462906 11:43288064-43288086 TGGAGCCTTCCCACTGGAGGTGG - Intergenic
1082670794 11:56033953-56033975 TGCAGCCTTCGCAGGCAAACAGG + Intergenic
1087416099 11:97857804-97857826 TGGAGCCTTCACCAGGCAGCGGG + Intergenic
1089927160 11:122270805-122270827 TGGAGCCATGGCAATGGAGCAGG - Intergenic
1090282601 11:125469064-125469086 TGGAGCCTACTCAGGGAAGGAGG - Intronic
1090556663 11:127883685-127883707 TGGAGTCTTGGCAGGGCAGGGGG + Intergenic
1091219410 11:133921109-133921131 TGGAGCCCTCGCTGAAGAGCAGG - Exonic
1091299762 11:134500085-134500107 TGGAACCTTTGGAGGGCAGCGGG + Intergenic
1093067513 12:14673939-14673961 TGTAGGCTTCGGAGGGCAGCAGG - Intronic
1093594925 12:20948631-20948653 TGGAGCCTTCCCAGGTTAGAGGG + Intergenic
1096116925 12:49060332-49060354 TGGAGCGGCCGGAGGGGAGCGGG - Intergenic
1096145461 12:49275861-49275883 TGCAGCCTGGGCAGGGGAGCGGG + Intergenic
1096716154 12:53492878-53492900 TGGAGCCCTCGGGGAGGAGCCGG + Intronic
1098673938 12:73265920-73265942 TGGAGTCTTGGCAGAGCAGCTGG + Intergenic
1100154412 12:91780900-91780922 TGGAGCCAAGGTAGGGGAGCTGG + Intergenic
1101345541 12:103882900-103882922 GGGAGCCTTCTCAGAGGAGGGGG - Intergenic
1102471097 12:113160339-113160361 TGGAGTCTTCCCTGGGGAGAGGG - Intronic
1103083369 12:118042966-118042988 AGGAGCCCTGGCATGGGAGCAGG + Exonic
1103453174 12:121043979-121044001 AGGACACTTCGCAGGGGTGCAGG + Intergenic
1103911571 12:124355102-124355124 TGGCCCCTTCACAGGGGAGGGGG - Intronic
1104034451 12:125088793-125088815 TGGACCCTTCAGAGGTGAGCTGG + Intronic
1104761698 12:131300751-131300773 TGCAGCCTTCACAGGGGATGGGG + Intergenic
1104818075 12:131660034-131660056 TGCAGCCTTCACAGGGGATGGGG - Intergenic
1105476135 13:20729691-20729713 TGGGGATGTCGCAGGGGAGCTGG - Intronic
1107681000 13:42850425-42850447 TAGAGCCTTCAGAGGGTAGCTGG - Intergenic
1108533662 13:51349659-51349681 TGGAGAGTTCTCAGTGGAGCTGG - Intronic
1110371312 13:74743569-74743591 TAGAGCCTTCCCTGGGGACCAGG - Intergenic
1112326285 13:98444574-98444596 TGGACCCGACACAGGGGAGCGGG + Intronic
1113116727 13:106882153-106882175 TGGAGCCTTCGCATTGGTGTAGG + Intergenic
1113208187 13:107941752-107941774 TGGAGCCTGCTCAGGGGAAGAGG - Intergenic
1113295506 13:108955124-108955146 TGGTGCCATCTCAGGGGAGCAGG - Intronic
1113682063 13:112251342-112251364 TGGAGCCATCGCATGGGCACAGG - Intergenic
1113801811 13:113090608-113090630 TGGAGCTCTCGCAGGTGAGCAGG - Intronic
1114155600 14:20099517-20099539 TGGAGCAGGAGCAGGGGAGCGGG - Intergenic
1114259663 14:21027077-21027099 AGGGGCCTACGCAGGGGCGCAGG + Intronic
1120695365 14:87638595-87638617 TGCAGCCTTGGAAGGGGCGCGGG + Intergenic
1122179948 14:99947515-99947537 TGCAGCCTTCTCTGGGCAGCTGG + Intergenic
1122238493 14:100346232-100346254 TGGAGCCATGGAAGGAGAGCAGG + Intronic
1122882695 14:104697125-104697147 TGGGGACTTCACAGGGGAGGGGG + Intronic
1122943948 14:104996540-104996562 TGGAGGCCCAGCAGGGGAGCTGG + Intronic
1123035440 14:105469994-105470016 TGGGGCCTTCCCAGGGCAGGCGG + Intronic
1125200068 15:37095400-37095422 TAGAGCCCCCGCACGGGAGCTGG - Intronic
1125726646 15:41871641-41871663 TGGGGCCTCCTCAGTGGAGCGGG - Intronic
1127352793 15:58169721-58169743 TGGAACATTCCCAGGGGAGCAGG - Intronic
1128289022 15:66462721-66462743 GGGAGGCTTCACAGAGGAGCTGG + Intronic
1128452383 15:67813238-67813260 TGCTGCCCTTGCAGGGGAGCTGG - Intergenic
1129275495 15:74442715-74442737 TGGAGCTGCTGCAGGGGAGCTGG - Intergenic
1132226253 15:100144012-100144034 TGGAGCCTTCTCAGGGTATGTGG + Intronic
1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG + Intronic
1135281928 16:21159539-21159561 TGGAGCCTTGGAAGGGGAAAGGG + Intronic
1137907901 16:52343271-52343293 TGCAGACTTCTCAGGGAAGCTGG + Intergenic
1139594259 16:67948896-67948918 TGGAGCCTGCTCAGGGGTACAGG + Intronic
1141582771 16:85011493-85011515 CGGAGCCTTGGCTGGAGAGCGGG + Exonic
1141760773 16:86027097-86027119 TGGGGGCTTCGCGGGGGAGTGGG - Intergenic
1142267529 16:89071328-89071350 GGGAGCTTCCGCAGGGGAACCGG + Intergenic
1142501747 17:336902-336924 TGGAGAATTCCCAGGGGAGGTGG - Intronic
1144961152 17:19044888-19044910 TGGAGACTGGGCTGGGGAGCAGG + Intronic
1144974009 17:19129636-19129658 TGGAGACTGGGCTGGGGAGCAGG - Intronic
1145091316 17:19988308-19988330 TCCAGCCTTCTCTGGGGAGCAGG + Intergenic
1145279302 17:21456242-21456264 TGGAGCCCTCACGGGGCAGCGGG + Intergenic
1146667715 17:34715987-34716009 GGGAGGCTTTGCAGGGGAGCAGG - Intergenic
1146705757 17:34999558-34999580 TGCAGCTTGCTCAGGGGAGCAGG + Intronic
1146906808 17:36623160-36623182 TGCAGCCTCTGCCGGGGAGCTGG + Intergenic
1152527082 17:80894393-80894415 TGGAGATTCCGCAGGTGAGCAGG - Intronic
1152567561 17:81106978-81107000 TGGAGCCTCCGCTGAGGGGCGGG + Intronic
1152615021 17:81333975-81333997 TGGAGCCTCCGCATGGGTGCGGG + Intergenic
1153781235 18:8496376-8496398 TTGGGCCTTGGCAGGAGAGCTGG - Intergenic
1156535777 18:37863202-37863224 TGGAGCCTTAGCAGGGGCTGTGG + Intergenic
1156740242 18:40317658-40317680 TGGAGCCCTAGCAGGAGAGGAGG - Intergenic
1160015026 18:75133845-75133867 TGGAGCCTTCACAGGATGGCTGG - Intergenic
1160028914 18:75241765-75241787 TGGAGCCTTCAGAGGGAGGCTGG - Intronic
1160368821 18:78353239-78353261 TGCAGCCTTCACAGTGGAGCTGG - Intergenic
1160769730 19:825171-825193 TGGGGCCTCCGCAGGGAAGATGG + Intronic
1161382930 19:3976014-3976036 CGGTGTCTTCGCAGGGGAGCGGG - Intergenic
1161396258 19:4046261-4046283 GGAAGCCATCGCAGGGGACCTGG - Exonic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162327249 19:10006559-10006581 GGGAGCCTGCGCGGGAGAGCAGG - Intronic
1162996493 19:14339155-14339177 GGGAGCCTGGGCAGGGGAGGAGG - Intergenic
1163863500 19:19754650-19754672 TGGAGGCTTGTCAGGGGACCAGG - Intergenic
1165036987 19:33040885-33040907 TGGAGGTTGCGCAGGTGAGCTGG + Intronic
1165352357 19:35282685-35282707 TGGGTCCTTAGCAGGGCAGCAGG + Intronic
1167581318 19:50344747-50344769 TGGAGACATTGCTGGGGAGCCGG + Intronic
1167584432 19:50365613-50365635 TGGAGACATCGCTGGGGACCTGG + Exonic
1168355087 19:55695538-55695560 TGGGGCCTGGGGAGGGGAGCTGG + Intronic
926773232 2:16396896-16396918 TGGCCGCTTCGCAGAGGAGCTGG + Intergenic
928101272 2:28438867-28438889 TCCAGCCTTCACAGGGCAGCAGG + Intergenic
930014998 2:46964176-46964198 TGGGGCCTTCACAGGCGAGCTGG + Intronic
934774944 2:96931413-96931435 CAGAGCCTTCTCAGAGGAGCAGG + Intronic
935378285 2:102422502-102422524 TGGAGCATTCCCAGGGCAGAGGG - Intronic
938010236 2:127822987-127823009 TGGAGCCTTCGCAGATGAGAGGG - Intergenic
938599553 2:132822676-132822698 TGGATCCATTGCTGGGGAGCTGG - Intronic
941531866 2:166680260-166680282 TGGAGCCTTTGGAGGGGATTAGG + Intergenic
947717018 2:232345940-232345962 TGCAGAGTTAGCAGGGGAGCAGG - Intergenic
947735460 2:232452262-232452284 TGCAGAGTTAGCAGGGGAGCAGG - Intergenic
948185974 2:236021617-236021639 TGGAGCTTTCACAGGGTATCTGG + Intronic
948206334 2:236164550-236164572 GAGAGGCTACGCAGGGGAGCTGG - Intergenic
948484397 2:238271311-238271333 TGGAGCATGTGCAGTGGAGCAGG - Exonic
948814501 2:240502914-240502936 GGGAGCCTCAGCAGGGGAACGGG - Intronic
1169044430 20:2524664-2524686 GGGGGCCTTCGCAGAGGATCTGG + Intronic
1169198343 20:3695096-3695118 TGGAGCCTGTGCAGGAGAGTGGG - Intronic
1169927279 20:10796052-10796074 TGGAACCTAAGAAGGGGAGCTGG - Intergenic
1171051430 20:21862748-21862770 TGGAACCAAGGCAGGGGAGCTGG + Intergenic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1175100299 20:56574603-56574625 TGCAGCCTTCGCAGGGAGGTGGG + Intergenic
1175299832 20:57934870-57934892 TGGAGCCATCCTAGGAGAGCAGG + Intergenic
1177877822 21:26656001-26656023 TGCAGCTTTCACATGGGAGCAGG + Intergenic
1178405159 21:32317520-32317542 TGGAGCCCTGGATGGGGAGCTGG - Intronic
1178812354 21:35895741-35895763 TGGCACCTTCACAGGGGACCTGG + Intronic
1179608200 21:42531966-42531988 TGGACCCTTCCCAGGGGCGGAGG + Intronic
1179609942 21:42543743-42543765 GGGAGACTTCCCCGGGGAGCCGG + Intronic
1180908197 22:19430907-19430929 TGGATCCTTCGCGGGGGCCCGGG + Intronic
1181068833 22:20320189-20320211 TGGAGTCTCCGCAGAGGAGCGGG - Intergenic
1181451683 22:23026847-23026869 TGGAGCAGTCGGAGGAGAGCCGG - Intergenic
1181580300 22:23824506-23824528 TGGTGCCTCCCCAGGGGGGCAGG + Intronic
1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG + Exonic
1183405892 22:37630384-37630406 TGGACCTTTCTCAAGGGAGCTGG - Intronic
1184792576 22:46709034-46709056 AAGAGCCTTCCCATGGGAGCCGG - Intronic
1185038239 22:48490469-48490491 TGGAGCCTCGGCAGGGGCACAGG - Intronic
1185364527 22:50431297-50431319 TGGAGCCTCCGCATGAGAACGGG + Exonic
949189709 3:1236699-1236721 TGGATCCATTGCAGGTGAGCTGG - Intronic
951662806 3:25088525-25088547 TGGAGCATTCTCAAGGGAACCGG + Intergenic
952828681 3:37545183-37545205 TGGAGCTTTCTCAGTGGAGCTGG + Intronic
953884261 3:46706636-46706658 TGATGCCTTTGCAGGGGAGTGGG - Intronic
956748266 3:72326747-72326769 TGGCTCCTTGGAAGGGGAGCAGG - Intergenic
956865595 3:73365895-73365917 TGGAGCCAGAGCAAGGGAGCTGG - Intergenic
964457571 3:156885306-156885328 TGGATCCATTGCTGGGGAGCTGG + Intronic
966905980 3:184526004-184526026 TAGAGCCTGCGCAGGAGCGCGGG + Intronic
968083153 3:195860814-195860836 TCGAGGTTTCTCAGGGGAGCAGG - Intergenic
968899721 4:3425625-3425647 TGGAGCCGGTGCAGGGGAGGGGG + Intronic
968899759 4:3425732-3425754 TGGGGCCAGCGCAGGGGAGGGGG + Intronic
968899831 4:3425944-3425966 TGGGGCCAGCGCAGGGGAGGGGG + Intronic
969139098 4:5053305-5053327 TGGAGCATGTGCAGGTGAGCAGG + Intronic
969191702 4:5526550-5526572 TGGGGCCTTCCCTGGAGAGCTGG + Intronic
969228386 4:5813682-5813704 GGGAGCCTTCTCAGAGGAGAAGG - Exonic
969662516 4:8538494-8538516 TGGAGCCCTTGCAGGGGCGAGGG + Intergenic
969686570 4:8678345-8678367 TGGAGGCTTTGCAGGGAGGCTGG - Intergenic
970312159 4:14793766-14793788 TGGATCCATCGCTGGTGAGCTGG - Intergenic
973344212 4:49036875-49036897 AGGAGGCTTCCCAGAGGAGCTGG - Intronic
977872751 4:102112639-102112661 TGGAGGCTACACAGGGGAGAAGG + Intergenic
982202825 4:152975768-152975790 AGGAGCCTCCCCAGGGGGGCTGG - Exonic
983064332 4:163191741-163191763 TGGAGCCTTCCCAGGCTAGAGGG + Intergenic
983329165 4:166302176-166302198 TGGATCCATTGCTGGGGAGCTGG - Intergenic
985025140 4:185733018-185733040 TGGAGCCTTCACAGGCAACCCGG + Intronic
985206343 4:187541574-187541596 TGGAGCCTTCGCAGAGTGGGTGG - Intergenic
986617760 5:9637946-9637968 TGGATCCATTGCTGGGGAGCCGG + Intronic
990674080 5:58163594-58163616 TGGAGATTTAGCATGGGAGCAGG - Intergenic
993813272 5:92509630-92509652 TGAAGACTTCACAGGGCAGCAGG - Intergenic
997305672 5:132834306-132834328 TGCAGCCTTCCTAGGAGAGCAGG + Intergenic
1000407507 5:160904080-160904102 GGGAGCTTTTCCAGGGGAGCAGG - Intergenic
1001037150 5:168305412-168305434 TGGAGCCTGGGCTGGGGAGGTGG - Intronic
1001775287 5:174324254-174324276 TGGAGCTTTGGCAGGGGTGGAGG + Intergenic
1002585892 5:180247833-180247855 TGTATCCTTCACAGGGGACCCGG - Intronic
1003551510 6:7106341-7106363 TCAAGCCTTCTCAGAGGAGCTGG + Intergenic
1006331978 6:33398153-33398175 TGGAGCCTGAGAAGGTGAGCTGG + Exonic
1007368068 6:41408369-41408391 TGCAGCCTTGGCAGAGGAGCTGG + Intergenic
1010055319 6:71557884-71557906 TGGATCCATTGCTGGGGAGCTGG + Intergenic
1010288110 6:74102727-74102749 AGAAGGCTTCGCAGGGGAGTTGG - Intergenic
1013152957 6:107464205-107464227 TGGAGCCTTCTCAGGGTATGTGG - Intergenic
1016425519 6:143932681-143932703 TGGATCCATTGCTGGGGAGCTGG + Intronic
1018458344 6:163972648-163972670 TGAAGCCTGCGCAGCGGCGCTGG + Intergenic
1018997568 6:168721711-168721733 TGGAGCCTTCGCAGAGGGCACGG + Intergenic
1019658951 7:2213118-2213140 TGGAGACTGCGCTGGTGAGCCGG + Intronic
1021778963 7:24082958-24082980 TTGAGGCTGCACAGGGGAGCAGG + Intergenic
1022015388 7:26344924-26344946 TAGGGCCTCTGCAGGGGAGCAGG - Intronic
1023043302 7:36191328-36191350 TGAAGCCTTTGCAGAGCAGCTGG + Intronic
1025093542 7:56081492-56081514 TGAAGCCATCACAGGGCAGCTGG + Intronic
1025783439 7:64622297-64622319 TGGAGCCTTCCCAGGTTAGAGGG - Intergenic
1026148872 7:67771540-67771562 TAGAGCATTCGCAGGCCAGCAGG - Intergenic
1026537936 7:71255720-71255742 TGGGGCTTTTTCAGGGGAGCTGG + Intronic
1026898150 7:74022268-74022290 TAGAGCCAGCTCAGGGGAGCAGG + Intergenic
1028251294 7:88542472-88542494 TGGAGCCTTCCCAGAGTAGAGGG + Intergenic
1029156547 7:98521574-98521596 TGGAGGCTTTGTAGGGAAGCTGG - Intergenic
1030884590 7:114922362-114922384 AGGCCCCCTCGCAGGGGAGCCGG + Exonic
1031480212 7:122269306-122269328 TGGAGCCTCAGCCTGGGAGCTGG - Intergenic
1032195520 7:129786218-129786240 CGGAGCCTGCCCAGGGGACCAGG - Intergenic
1032478866 7:132230617-132230639 TGGAGTCCTCGCAGAGGAGCTGG - Intronic
1034019613 7:147627285-147627307 TGGATCCATTGCTGGGGAGCTGG - Intronic
1035094849 7:156345921-156345943 TGCAGGCTCCTCAGGGGAGCTGG - Intergenic
1035818054 8:2562093-2562115 AGGAGCCGTCGCAGGCGAGAAGG - Intergenic
1037885091 8:22591694-22591716 CTGAGCCTTCACAGGGGAGTGGG + Intronic
1038898971 8:31820278-31820300 TGGAGCTTACACAGGGCAGCTGG + Intronic
1042680356 8:71376874-71376896 GGGAGCCTGGGCAGGGCAGCGGG - Intergenic
1044692553 8:94895002-94895024 AGGAACCTTGGCAGGGGACCGGG - Intronic
1046866617 8:119158017-119158039 TGAAGTCTTAGCATGGGAGCAGG - Intergenic
1047288493 8:123508442-123508464 GGGAGACTTCCCAGGGGAGCTGG - Intronic
1049178291 8:141207067-141207089 TGAGGCCTGCGGAGGGGAGCTGG - Intergenic
1049483817 8:142840889-142840911 TGGAGCCTGCGTTGGAGAGCAGG + Intronic
1049791589 8:144474903-144474925 TGGAGCCTTCGCCAAGGACCTGG - Exonic
1052325635 9:27214420-27214442 TGGAGCCATCCCAGGAAAGCTGG - Intronic
1053251074 9:36574232-36574254 AGAAGCCTTTGCAAGGGAGCAGG + Intronic
1055829466 9:80360761-80360783 GGAAACCTGCGCAGGGGAGCTGG - Intergenic
1056495218 9:87149042-87149064 TGGAGGCCTCGCAGGCAAGCAGG + Intronic
1057036676 9:91816581-91816603 GGGAGCCTTGGCAGGTGGGCAGG - Intronic
1057195064 9:93112133-93112155 TGGGGGCTGCGCAGGGGAGTGGG - Intronic
1058392574 9:104512520-104512542 TGGAGCCTGCACAAGGGAGATGG + Intergenic
1058508849 9:105694546-105694568 TGGAGCCGGCGCGGAGGAGCGGG + Exonic
1059341046 9:113597761-113597783 TTGAGCCTTCCCAGGGTGGCTGG + Intergenic
1060210847 9:121709278-121709300 TGGAGCCATCGTAGCGGGGCGGG + Intronic
1061618088 9:131793170-131793192 TGCAGCCTTCTCAGGAGAACTGG + Intergenic
1062730416 9:138105352-138105374 TGTAGCCTTGGCTGGGGAGGAGG - Intronic
1186218690 X:7326525-7326547 TGGGGCCTTAGCTGGGGACCCGG - Intronic
1189247287 X:39572912-39572934 TGGAGGCTTCATAGGGTAGCAGG - Intergenic
1189663146 X:43325542-43325564 TGGATCCATTGCTGGGGAGCTGG + Intergenic
1192832838 X:74768065-74768087 TGGAGTCTTGGCAGAGCAGCTGG - Intronic
1196574017 X:117297507-117297529 TGGAGCCTGGGAAGGGGAGTGGG - Intergenic