ID: 1132855975

View in Genome Browser
Species Human (GRCh38)
Location 16:2044707-2044729
Sequence CATGCAGCGACTGCGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132855975_1132855980 -5 Left 1132855975 16:2044707-2044729 CCCGCGCCCGCAGTCGCTGCATG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1132855980 16:2044725-2044747 GCATGGCGCCCGCCGTCACCTGG 0: 1
1: 0
2: 1
3: 3
4: 49
1132855975_1132855981 2 Left 1132855975 16:2044707-2044729 CCCGCGCCCGCAGTCGCTGCATG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1132855981 16:2044732-2044754 GCCCGCCGTCACCTGGTCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 38
1132855975_1132855985 7 Left 1132855975 16:2044707-2044729 CCCGCGCCCGCAGTCGCTGCATG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1132855985 16:2044737-2044759 CCGTCACCTGGTCTTTGGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 81
1132855975_1132855986 11 Left 1132855975 16:2044707-2044729 CCCGCGCCCGCAGTCGCTGCATG 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1132855986 16:2044741-2044763 CACCTGGTCTTTGGTTTGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132855975 Original CRISPR CATGCAGCGACTGCGGGCGC GGG (reversed) Exonic
900091887 1:924281-924303 TAGGCGGCGGCTGCGGGCGCCGG + Intergenic
900573754 1:3372918-3372940 GATGCAGAGCCTGCGGGCTCGGG + Intronic
902515330 1:16986786-16986808 AATGGTGCCACTGCGGGCGCGGG - Exonic
903034582 1:20485785-20485807 CCTGCGGCGAGTGCGGGCGGCGG + Exonic
904681396 1:32231921-32231943 CATGCAGCTTCTGCAGGCTCAGG + Intergenic
904738143 1:32651005-32651027 CTTCCAGCGATTGCGCGCGCCGG - Intergenic
907689096 1:56645099-56645121 GAAGCAGCGACAGCGGGGGCCGG - Intronic
917060617 1:171033268-171033290 CAGGCAGCGGCAGCTGGCGCTGG + Intronic
918654437 1:187006697-187006719 CATGCTGCCACTGCTGGCTCGGG + Intergenic
920310127 1:205043791-205043813 CATGCAGGGACTTCTGGGGCAGG - Intronic
924037497 1:239952556-239952578 CATGCAGCCACTGCAGGCTCTGG - Intergenic
1070154224 10:73823894-73823916 CATGGAGCAACTGTGGGCACAGG + Intronic
1078618051 11:12883021-12883043 CAGGCAGGGACTGAGGGAGCTGG - Exonic
1081705782 11:45181236-45181258 CAGGCAGGGCCTGGGGGCGCTGG - Intronic
1089998545 11:122932013-122932035 TATGCAGCGACTGCGGGTGTTGG + Intronic
1090772193 11:129931084-129931106 CATGCTGCGGCTGCAGGTGCAGG + Exonic
1096217130 12:49803924-49803946 TCTGCACCGACTGCGGGAGCTGG - Exonic
1103479256 12:121240719-121240741 CATGCATCCACTGCGGCCGGAGG - Exonic
1105538933 13:21297974-21297996 CCTGCTGTGACTGGGGGCGCGGG - Intergenic
1115960939 14:38835931-38835953 CATGCAGCGACTGTGGTGGCAGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122609801 14:102974063-102974085 CACGCAGCGGCTGCGGGGGCTGG - Exonic
1131827187 15:96331219-96331241 CACCCAGCGACTGCGGGCGGCGG + Exonic
1132855975 16:2044707-2044729 CATGCAGCGACTGCGGGCGCGGG - Exonic
1133212692 16:4272179-4272201 CATGCCGCGGCTCCCGGCGCGGG - Intronic
1133914928 16:10100965-10100987 CATTCAGCCACTGGGGGTGCAGG + Intronic
1137728596 16:50673576-50673598 CCTGCAGCGCCTGCAGGCCCGGG - Exonic
1139451297 16:67029619-67029641 CAAGCAGAGGCTGCGGGCGATGG - Intronic
1139603179 16:67999032-67999054 CAGGTAGCCACTGCGGGCTCAGG - Intronic
1141862598 16:86728198-86728220 CAGGCAGGGAATGCGGGAGCAGG + Intergenic
1142135353 16:88449478-88449500 CCTGCAGCCACTGCGGTCCCTGG + Intergenic
1148372458 17:47110903-47110925 CATGCAGAGACTTCTGGGGCCGG - Intergenic
1150311206 17:64130394-64130416 CATCCAGCGTCTGGGGGCGCTGG + Intronic
1150423282 17:65056944-65056966 CCGGCCGCGGCTGCGGGCGCGGG - Intergenic
1152686576 17:81696636-81696658 CATCCAGCGCCTGCAGGAGCAGG + Exonic
1152743774 17:82030091-82030113 CAAGCTGAGACTGCTGGCGCAGG + Exonic
1160832020 19:1108570-1108592 AAGGCAGCGCCAGCGGGCGCGGG + Exonic
1161237542 19:3205315-3205337 TATGCCGGGACTGCGGGCGCTGG - Intronic
1165454072 19:35900643-35900665 CATTCAGGGACTGCGTTCGCCGG - Exonic
1167115015 19:47484044-47484066 CAGGCGGCGCCGGCGGGCGCGGG - Exonic
925937246 2:8776321-8776343 CATGCAGGGACTTCAGGCACAGG + Intronic
931429546 2:62197194-62197216 CCTGCCGGGGCTGCGGGCGCGGG + Intronic
935592249 2:104854298-104854320 AGTGCACCGACGGCGGGCGCTGG - Intergenic
938314362 2:130315804-130315826 CATGCAGCTACTGCTGGCTGCGG + Intergenic
1176267793 20:64219861-64219883 CATGGAGCTGCTGGGGGCGCTGG - Exonic
1180713285 22:17854618-17854640 CATGCAGCTACTTGGGGTGCAGG - Intronic
1181804921 22:25369029-25369051 CATGCAGCCAGTGCGGGGACTGG - Intronic
1183504709 22:38202566-38202588 CACGCACCGCCCGCGGGCGCCGG - Intronic
1184599462 22:45533992-45534014 CAGGCAGCCACAGAGGGCGCAGG - Intronic
1185291606 22:50030349-50030371 GATGCAGCGGCTGCTGGCGAGGG + Intronic
955687519 3:61561941-61561963 CAGGCAGGGACCGCGGGCGGCGG - Exonic
956827330 3:73010342-73010364 CTGGCAGCTACTGCGGGCGGGGG - Intronic
966866404 3:184261086-184261108 CAGGCGGCGACTCCGGGCCCGGG + Intronic
968642410 4:1721286-1721308 CATGGGGCGACTGCGAGCCCGGG + Exonic
1004044605 6:12012171-12012193 CATGCCGTGGCTCCGGGCGCCGG + Intronic
1004114198 6:12750093-12750115 CATGCGCAGGCTGCGGGCGCGGG + Intronic
1007415921 6:41691168-41691190 CATGCAGCTCATGCGGGAGCAGG - Exonic
1021313132 7:19116946-19116968 CGTTCAGCGACTGGGTGCGCTGG + Exonic
1023972296 7:45000264-45000286 CATGTAGCGGCTGCTGGCGGCGG + Intronic
1024043844 7:45574513-45574535 CATGCAGCGGCCGCGGCCGCGGG - Exonic
1032534755 7:132653488-132653510 CAAGCAGGGACTGAGGGCCCTGG - Intronic
1049243963 8:141551694-141551716 CATGTAGCCACTGAGGGAGCGGG - Intergenic
1057824640 9:98362887-98362909 CACGCAGCAACTGGGGGCCCAGG + Intronic
1061261517 9:129483048-129483070 GAAGCAGCGCCTGGGGGCGCCGG - Intergenic