ID: 1132858856

View in Genome Browser
Species Human (GRCh38)
Location 16:2060186-2060208
Sequence CTGTGAGCACAGAACGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132858856_1132858862 -7 Left 1132858856 16:2060186-2060208 CCGTCCTCGTTCTGTGCTCACAG 0: 1
1: 0
2: 0
3: 24
4: 250
Right 1132858862 16:2060202-2060224 CTCACAGCTCCCTGGAGGGTGGG 0: 1
1: 0
2: 5
3: 39
4: 452
1132858856_1132858866 11 Left 1132858856 16:2060186-2060208 CCGTCCTCGTTCTGTGCTCACAG 0: 1
1: 0
2: 0
3: 24
4: 250
Right 1132858866 16:2060220-2060242 GTGGGGCGATCACGTCGTCCTGG 0: 1
1: 0
2: 0
3: 0
4: 64
1132858856_1132858861 -8 Left 1132858856 16:2060186-2060208 CCGTCCTCGTTCTGTGCTCACAG 0: 1
1: 0
2: 0
3: 24
4: 250
Right 1132858861 16:2060201-2060223 GCTCACAGCTCCCTGGAGGGTGG 0: 1
1: 0
2: 4
3: 40
4: 361
1132858856_1132858863 -6 Left 1132858856 16:2060186-2060208 CCGTCCTCGTTCTGTGCTCACAG 0: 1
1: 0
2: 0
3: 24
4: 250
Right 1132858863 16:2060203-2060225 TCACAGCTCCCTGGAGGGTGGGG 0: 1
1: 0
2: 7
3: 143
4: 1733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132858856 Original CRISPR CTGTGAGCACAGAACGAGGA CGG (reversed) Intronic
900296805 1:1956008-1956030 CTGTGATCCCACAACCAGGATGG - Intronic
901046869 1:6401971-6401993 CTGTGAGAACTGAACAAGTAAGG + Intergenic
902050467 1:13560372-13560394 CTCTGTGCACAGACCAAGGAAGG + Intergenic
902943562 1:19817312-19817334 CCGTGAGCACAGAATGACGGTGG - Intergenic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904571732 1:31471117-31471139 CTCTGTGCACAGACCGAGGAAGG - Intergenic
906224011 1:44106176-44106198 CTATGAGCTCAGAACCAGTATGG - Intergenic
907710449 1:56875933-56875955 CAGTGAGAACAGAAAGAGAATGG + Intronic
908144840 1:61229610-61229632 CTTTGATCACAGAGCAAGGATGG - Intronic
909344755 1:74572173-74572195 CTCTGAGGAAAGAAGGAGGAGGG - Exonic
909787098 1:79627620-79627642 CTGTGTGAATAGAACTAGGATGG - Intergenic
910529998 1:88225134-88225156 TTGGGAGCACAGCAAGAGGAAGG - Intergenic
911831391 1:102554621-102554643 GTGTGAGCACAGAATGGGGGTGG - Intergenic
912245327 1:107956142-107956164 CTATGAGCACAGATGCAGGAAGG + Intronic
915311571 1:155008132-155008154 CTGTGGGCACCGAAAGAGGAAGG - Intronic
915510705 1:156385532-156385554 CTCTGAGCAGAGAAGGAAGAGGG + Intergenic
915548313 1:156616386-156616408 CAGTGAGGACAGAATGAGAAAGG - Intergenic
917202667 1:172533470-172533492 CAGAGAGCACAGAAAGAGGCAGG - Exonic
918237881 1:182597957-182597979 CTGTGAGCACTGAGGGAGGGAGG - Intergenic
919845711 1:201640870-201640892 CTGTGTGCACAGAGCTGGGATGG + Intronic
921325866 1:213985839-213985861 CGGAGAGCAGAGAAGGAGGAGGG - Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063716597 10:8533531-8533553 CTGAGGCCACAGTACGAGGAGGG + Intergenic
1064582546 10:16808912-16808934 ATGTGAGCACAGCAAGAAGACGG + Intronic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1065810504 10:29438618-29438640 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1066094672 10:32060634-32060656 ATGTTATCACAGAACCAGGAAGG + Intergenic
1066455452 10:35568171-35568193 CTGAGAGCACAGGCCGAGGTTGG + Intronic
1068534484 10:58226249-58226271 CTTTGAGGACAGAAAGAGAAGGG - Intronic
1069551828 10:69369396-69369418 CTATGACCACACAACGGGGAGGG - Intronic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1069795031 10:71046498-71046520 TTTTGTGCACATAACGAGGAGGG - Intergenic
1071283805 10:84125952-84125974 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1071847296 10:89534417-89534439 CTCTGAGCAAAGAACCAGGTAGG + Intronic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076685011 10:132194602-132194624 CTCTGAGCACAGAAGGGAGAGGG - Intronic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1083659918 11:64247168-64247190 CAATGAGGACAGAATGAGGAAGG - Intergenic
1084115742 11:67042002-67042024 CTGTGAGCAGAGTGCGAGGAGGG + Intronic
1084617034 11:70243307-70243329 GTGGGAGCAGAGAATGAGGAAGG + Intergenic
1085254066 11:75162481-75162503 CTGTGACCTAAGAATGAGGAAGG + Intronic
1085787844 11:79470706-79470728 CTTTGAACACAGCACCAGGAAGG - Intergenic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1088547834 11:110979493-110979515 CTGTGAGCAAGAAAGGAGGAAGG - Intergenic
1089846638 11:121463999-121464021 CTGTGAGGACAGAAGGAGCCAGG - Intronic
1090594584 11:128307505-128307527 CTGGGAGCACAGAAAGGAGATGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091762864 12:3098578-3098600 CTCTAAGCAAAGAACGAGGCTGG - Intronic
1091966498 12:4746652-4746674 CTGTGAGTACAGAAGCAGGCTGG - Intronic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1097680561 12:62645269-62645291 CTGAGAACACAGTAAGAGGAGGG + Exonic
1097845244 12:64359634-64359656 CTGTGAGCACTGAACAGGGCAGG + Intronic
1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG + Intergenic
1101320517 12:103669300-103669322 CTGTGCGAACAGACAGAGGAAGG - Intronic
1101604583 12:106238506-106238528 CTGTCAGCTCTGAATGAGGAGGG - Exonic
1102803655 12:115760210-115760232 CTGTGATCACACAATGAGGTAGG + Intergenic
1102953687 12:117046261-117046283 CTGTGAGCACTGACTGAGGCCGG + Intronic
1104752199 12:131246815-131246837 CTGTGAGCACAGAAGTGGGAAGG - Intergenic
1105926247 13:25011422-25011444 CTGGGAGCAGAGAACTAGGAAGG + Intergenic
1106038737 13:26069555-26069577 CTGGGAGCAGAGAACTAGGAAGG - Intergenic
1108107897 13:47032926-47032948 CTGTGAGAACAGAAAAAGGTGGG - Intergenic
1113857020 13:113452358-113452380 CTGTGAGCACAGAACTAAACTGG + Intronic
1115745044 14:36427915-36427937 CTATGAGCTCAGAACGATGATGG + Intergenic
1117006567 14:51426712-51426734 CTCTGAGAAGAGAACGAGAAGGG - Intergenic
1117179897 14:53181153-53181175 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1118105127 14:62650117-62650139 ATGTGACCACAGACCCAGGATGG + Intergenic
1120764319 14:88314745-88314767 CTGTGAGAACAGCACAAGGCAGG + Intronic
1122171163 14:99876768-99876790 CTGTAAGCAAAAAAGGAGGAGGG - Intronic
1127299639 15:57640020-57640042 GTGGGAGAAGAGAACGAGGAAGG - Intronic
1128291014 15:66478208-66478230 CTGTGAGGACAGAGAGAGTAAGG - Intronic
1130448952 15:84031415-84031437 CTGTGATGACAGAAAGAGGTAGG + Exonic
1130764418 15:86855731-86855753 CTGCGAGCACAGGAAGATGACGG - Intronic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1131281434 15:91024485-91024507 CTGTGAACCCAGACCGAGGCAGG + Intergenic
1132403686 15:101529503-101529525 CTGTGAACACAGAAAGATTAAGG - Intergenic
1132826129 16:1906563-1906585 CCGGGAGCACAGACGGAGGAGGG + Intergenic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133116776 16:3582080-3582102 CTGTGAGCACGGACAGAGGAAGG + Exonic
1134136594 16:11680462-11680484 CTGAGAGCACAGAATAAGGAAGG + Intronic
1137332300 16:47510522-47510544 CCGTGTGCCCAGAACTAGGAAGG + Intronic
1139950395 16:70665452-70665474 CTGGGAGCACTGACCGAGGTGGG + Exonic
1141776553 16:86126997-86127019 ATGTGAGCACAGAACAAGTCAGG - Intergenic
1142107785 16:88315602-88315624 CTGTGACCCCAGAAGGAGGGTGG + Intergenic
1143113274 17:4565617-4565639 CTATGGGCACAGAAAGTGGATGG - Intergenic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143858615 17:9871570-9871592 CTGTCATCTCAGAAAGAGGAAGG - Intronic
1144761245 17:17708818-17708840 ATTTGAGCACAAAAGGAGGATGG - Intronic
1145921989 17:28616540-28616562 CTGAGACTTCAGAACGAGGATGG - Intronic
1146668596 17:34721417-34721439 CTGTGAGCAGGAAACGGGGATGG + Intergenic
1148193880 17:45699470-45699492 GTGAGAGCTCATAACGAGGAAGG + Intergenic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150947290 17:69761808-69761830 GTATGAGCAGAGAATGAGGAAGG + Intergenic
1151234566 17:72710098-72710120 CTGTAAGCAAAGGACGAAGAGGG - Intronic
1160389415 18:78518860-78518882 CTGTGCCCACAGAGCCAGGATGG + Intergenic
1160673724 19:377740-377762 CTGGGAGCCCAGAAAGGGGAGGG - Intergenic
1163927582 19:20360635-20360657 CTCTGTGCACAGACCCAGGAAGG + Intergenic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1164883629 19:31758956-31758978 CTGAGAACACAGAACTTGGAGGG - Intergenic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167472337 19:49682258-49682280 CGGTGAGCCCAGAAAGAGGATGG + Exonic
1167768642 19:51500403-51500425 GTGTGAGCAGAGAAGGGGGAGGG + Intronic
1168187674 19:54710053-54710075 GTGTCAGCTCAGAACGAGGTGGG + Intergenic
1168358149 19:55715129-55715151 ATTTGAGCCCAGATCGAGGAGGG + Exonic
1168632461 19:57968150-57968172 CTGTGAGGACACAACAAAGAAGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
927467438 2:23347950-23347972 CTGAGAGCACACAGTGAGGAAGG + Intergenic
928685491 2:33745129-33745151 CTGTGAGAACAGTACCAAGAGGG - Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930603484 2:53468800-53468822 CTGTGTGCACACACCAAGGAAGG - Intergenic
933390247 2:81657869-81657891 CTCTGTGCACAGACCAAGGAAGG - Intergenic
933915242 2:86985081-86985103 CTGTTAAAACAGAACGATGAAGG - Intronic
934007751 2:87784820-87784842 CTGTTAAAACAGAACGATGAAGG + Intronic
935771388 2:106425739-106425761 CTGTTAAAACAGAACGATGAAGG + Intronic
935908685 2:107870210-107870232 CTGTTAAAACAGAACGATGAAGG - Intronic
935995090 2:108762428-108762450 CTGTTAAAACAGAACGATGAAGG - Intronic
936130468 2:109835324-109835346 CTGTTAAAACAGAACGATGAAGG - Intronic
936214229 2:110536161-110536183 CTGTTAAAACAGAACGATGAAGG + Intronic
936423366 2:112390720-112390742 CTGTTAAAACAGAACGATGAAGG + Intronic
937057606 2:118952607-118952629 CTTTGTGCACAGACCAAGGAAGG - Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
940485795 2:154294086-154294108 CTGTGAGCACAGATGGCTGATGG + Intronic
943137462 2:183932618-183932640 CTCTGAGGACATAACTAGGAAGG + Intergenic
943752715 2:191526279-191526301 CAGTCATCACAGAAAGAGGAAGG - Intergenic
944938047 2:204590179-204590201 CTGTGAGGACAGAGAGATGATGG - Intronic
945719912 2:213407016-213407038 CTCTGTGCACAGACCAAGGAAGG + Intronic
947556769 2:231099919-231099941 CTCTGTGCACAGACCAAGGAAGG - Intronic
948249012 2:236510440-236510462 CTGTCAGCACAGAAGAAGGCAGG + Intergenic
1168823394 20:792513-792535 CTCTGCGCACAGAGCAAGGAAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169876032 20:10297827-10297849 CTGAGAGCACAGAGCAAAGAAGG + Intronic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171467544 20:25341173-25341195 CTGTGAGCACAGCACAAGTGCGG - Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1173954714 20:47022182-47022204 CAGTGACCACAGAACGAGTTTGG - Intronic
1175455558 20:59109976-59109998 CTTTCATCACAAAACGAGGAGGG - Intergenic
1178836757 21:36104961-36104983 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1180971059 22:19815974-19815996 CTGTGTGCACAGGGCTAGGAGGG - Intronic
1181035875 22:20169535-20169557 CAGTGACCACAGGACGAGGAGGG - Intergenic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1183211361 22:36453447-36453469 CTGTGACCCCAGAACCTGGAGGG + Intergenic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184631205 22:45781322-45781344 CTGTCAGCAGAGACCGAGTAGGG + Intronic
949355984 3:3180989-3181011 ATGCCAGCACAGAACGATGAGGG + Intergenic
949856613 3:8467516-8467538 CTATGATCACAGAACATGGATGG - Intergenic
950364530 3:12473771-12473793 TGGTGAGCACAGAATGAGAAGGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950740950 3:15051584-15051606 CTATGAGGAAAGAACAAGGAAGG + Exonic
950846896 3:16023506-16023528 CTCTGTGCACAGACCAAGGAAGG - Intergenic
952505317 3:34001987-34002009 CAGTGAACACAGAACTAGGCTGG - Intergenic
952842698 3:37661766-37661788 CTGTGAGCAGAGCAAGAGGCTGG + Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
954272314 3:49519401-49519423 CTGAGAGCACAGTCCCAGGAAGG - Intronic
954604412 3:51897649-51897671 CTCTGTGCACAGACCAAGGAAGG + Intronic
957878209 3:86176369-86176391 CTGTGAGAACATGATGAGGAAGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959979588 3:112500824-112500846 CTGTGAACACAGGAAAAGGAAGG - Intergenic
960720836 3:120623059-120623081 CTCTGTGCACAGACCAAGGAAGG - Intergenic
960840776 3:121956432-121956454 CTGTGAGGACTGAACAAGGGTGG + Intergenic
961469159 3:127100695-127100717 CTGTGCGCTCAGGACCAGGACGG - Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962974929 3:140437610-140437632 CTGTGACAACAGAAAGAGGCTGG + Intronic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
966672809 3:182547479-182547501 CTGTGGGCACAGAACAAGCATGG + Intergenic
968789577 4:2650331-2650353 TTGAGAGCACAGAAGGAGGGAGG + Intronic
970093015 4:12430877-12430899 CTCTGTGCACAGACCAAGGAAGG - Intergenic
970419847 4:15895650-15895672 CTGTGAGCACCACAAGAGGAGGG + Intergenic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
978479593 4:109174323-109174345 CTGTCAGGACAGAATGGGGAGGG - Intronic
980550625 4:134329029-134329051 CTGGGAGCACAGAATCAGGCTGG - Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984675975 4:182548140-182548162 CTGTGAGCCCAGGAGGTGGAGGG + Intronic
985051871 4:185999251-185999273 TTGAGAGCACAGAAGCAGGAGGG + Intergenic
985891601 5:2720076-2720098 CTATGAGCACAGGACGGAGAGGG + Intergenic
986742294 5:10714745-10714767 CTGTGAGGACAGTACCAGGGGGG - Intronic
989615838 5:43335889-43335911 CTCTGTGCACAGACCAAGGAAGG - Intergenic
995138622 5:108707357-108707379 CAGTGAGGACAGAACAAGAAGGG - Intergenic
996099928 5:119435780-119435802 CTCTGTGCACAGACCAAGGAAGG + Intergenic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996543601 5:124654618-124654640 TTGTGAGCTCAGAAAGGGGAGGG - Intronic
998384073 5:141746103-141746125 CTGTGAGCACCATACTAGGAAGG + Intergenic
998552897 5:143094272-143094294 CTCTGTGCACAGACCAAGGAAGG - Intronic
998939059 5:147260961-147260983 CTCTGCGCACAGACCAAGGAAGG - Intronic
999772733 5:154787696-154787718 CTGGGAGCAGAGAAAGAGCAGGG + Intronic
1000245077 5:159442381-159442403 CTGAGAGCGCAGGAGGAGGAAGG - Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1004295222 6:14403981-14404003 GAGTGAGCACAGAATGAGGAAGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1006448447 6:34092572-34092594 CTCTGAGCAGGGCACGAGGAAGG - Intronic
1007811182 6:44486861-44486883 ATGGGAGCCCAGAACAAGGAGGG - Intergenic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1009926323 6:70125396-70125418 CTCTGAGCTCGGAATGAGGAGGG - Intronic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1012592470 6:100999194-100999216 GTGTGAGCACAGAGAGTGGAAGG + Intergenic
1013520380 6:110927252-110927274 CTGTGATCACAGAAAAAGCAAGG - Intergenic
1014812764 6:125904683-125904705 GTGTGAGCACAGAGCCAGAATGG + Intronic
1018137032 6:160788923-160788945 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1018191715 6:161314886-161314908 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1018220656 6:161575015-161575037 TTGTGAGCACGGCATGAGGATGG - Intronic
1018294203 6:162328412-162328434 CTGTGTTCACAGAACAAGCAGGG - Intronic
1018438756 6:163788790-163788812 CTGTGAACCCAGAACGGCGATGG + Intergenic
1019647584 7:2139318-2139340 CTGTGAGCTCAGAGGGAGGGTGG - Intronic
1022342847 7:29485453-29485475 CTGTGAGCATTCAAAGAGGAGGG + Intronic
1023030083 7:36083660-36083682 CTGTGAGAACAGAAAGCGTACGG + Intronic
1023436732 7:40147593-40147615 CTCTGTGCACAGACCAAGGAAGG - Intronic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023798578 7:43813949-43813971 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1028333503 7:89624846-89624868 CTCTGCGCACAGACCAAGGAAGG + Intergenic
1028793416 7:94878423-94878445 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1031505850 7:122581238-122581260 CTTTGACCACAGGCCGAGGATGG + Exonic
1032534141 7:132646556-132646578 CTGTGAGGACACAGTGAGGATGG + Intronic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1033028205 7:137798296-137798318 TTGTGAGAACTGAAAGAGGAAGG + Intronic
1033307967 7:140238884-140238906 CTCTGGGGACAGAACAAGGACGG - Intergenic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034897356 7:154886084-154886106 CTGGGAGCAGAGAAGGAGGGCGG - Intronic
1036068696 8:5415228-5415250 CTGTGAGCACAGGAGGAGCTGGG + Intergenic
1036105155 8:5830296-5830318 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1036257766 8:7219120-7219142 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036259015 8:7226117-7226139 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036307606 8:7613394-7613416 CTGTTATTAAAGAACGAGGATGG - Intergenic
1036309814 8:7677716-7677738 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036311068 8:7684713-7684735 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036358458 8:8061395-8061417 CTGTTATTAAAGAACGAGGATGG - Intergenic
1036359720 8:8068403-8068425 CTGTTATTAAAGAACGAGGATGG - Intergenic
1036812019 8:11873630-11873652 TAGTGAGCACAAAACGAGGAGGG + Intergenic
1036891238 8:12598567-12598589 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036892497 8:12605557-12605579 CTGTTATTAAAGAACGAGGATGG + Intergenic
1037489524 8:19385105-19385127 CTGGGACCAAAGCACGAGGAGGG - Intronic
1037980546 8:23250286-23250308 CTCTGAGCACAGGAGGAGGTGGG - Intronic
1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG + Intergenic
1039893095 8:41697571-41697593 CAGTTAGCACAGAACCAGGAGGG - Intronic
1040621212 8:49095258-49095280 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1041938553 8:63361257-63361279 CTGTCACCACTGAACGTGGATGG + Intergenic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1043871831 8:85441660-85441682 CTGAGACCACAGAACTAGCAAGG + Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1047624681 8:126644453-126644475 CTGTGAGGACACAATGAGAAGGG + Intergenic
1048423186 8:134297303-134297325 CTGTGAGCCCGGAATGAGCATGG + Intergenic
1049323790 8:142011210-142011232 CTCTGAGAACAGAACAGGGAAGG + Intergenic
1049461715 8:142732638-142732660 CTCTGTGCACAGACCAAGGAAGG - Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1051099605 9:13505958-13505980 CTGTGAGCATAGAAAGGGGCCGG - Intergenic
1051142030 9:13988127-13988149 CTGGGAGCACAGAATCAGGCTGG - Intergenic
1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG + Intergenic
1055407400 9:75989107-75989129 CTGTTAGGACAGAACGAGTCAGG + Intronic
1055589987 9:77802268-77802290 CTGTGAGCCCAGAGTGAGGGGGG - Intronic
1056203925 9:84302318-84302340 CGGTGATCACAAAAAGAGGAAGG + Exonic
1056415010 9:86367284-86367306 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1056690520 9:88804438-88804460 TGGTGAGCACAGAACGATGTGGG + Intergenic
1057006922 9:91568829-91568851 TTGTGAGCACAGAAGGGAGAGGG - Intronic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1060999068 9:127892210-127892232 CTGTGAGGTCAGAAACAGGATGG - Intronic
1061213469 9:129206670-129206692 CTGGGAGCAAAGAAAGGGGAAGG + Intergenic
1061408553 9:130405932-130405954 CTGTGAGCAAAGAAAGGGGTTGG - Intronic
1061466906 9:130787642-130787664 CTGGGAGCAGAGCACGAGGCTGG - Intronic
1062160418 9:135076558-135076580 CTGTGAGCGCCGAACTGGGAGGG + Intronic
1062311459 9:135939888-135939910 CTGTGAGGAAAGAACGTGGACGG - Intronic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1189034150 X:37479030-37479052 CTCTGTGCACAGACCAAGGAAGG + Intronic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1189514731 X:41701682-41701704 CAGTGAGCACAGAACTGGAAAGG + Intronic
1189531202 X:41884800-41884822 CTAGGAGCACACAACAAGGATGG + Intronic
1191890251 X:65932222-65932244 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1199637266 X:149825746-149825768 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1199637770 X:149829861-149829883 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1201786037 Y:17780270-17780292 ATTTGAGCAAAGAAAGAGGATGG - Intergenic
1201815516 Y:18125718-18125740 ATTTGAGCAAAGAAAGAGGATGG + Intergenic
1201900272 Y:19041390-19041412 CTCTGTGCACAGACCAAGGAAGG - Intergenic