ID: 1132858982

View in Genome Browser
Species Human (GRCh38)
Location 16:2060792-2060814
Sequence ACGGCTCCTTCAGCAGCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132858980_1132858982 16 Left 1132858980 16:2060753-2060775 CCAGGTGGTGGCGTGGGACATTC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1132858982 16:2060792-2060814 ACGGCTCCTTCAGCAGCTCCAGG 0: 1
1: 1
2: 3
3: 19
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132858982 Original CRISPR ACGGCTCCTTCAGCAGCTCC AGG Exonic
900181777 1:1314263-1314285 ACGGCTCTTTAAGGAGCCCCTGG - Intronic
900637812 1:3674521-3674543 ACGGCTTCGTCAGCAGGTCAGGG - Intronic
901052538 1:6432514-6432536 ATGTCTCCACCAGCAGCTCCTGG + Intronic
901088872 1:6628514-6628536 CCCATTCCTTCAGCAGCTCCGGG - Exonic
901721802 1:11204619-11204641 ATGAGTCCTTCAGCAGCTCCAGG + Exonic
901817427 1:11802896-11802918 ACAGCTCCCTCAGCAGTTCGAGG + Exonic
902323786 1:15684928-15684950 GGGGTTCCTTCAGGAGCTCCCGG - Intronic
903050423 1:20596344-20596366 ACTGCAGCCTCAGCAGCTCCTGG + Intronic
903207664 1:21795068-21795090 ACGCCTCCTGCAGCAGGCCCGGG - Intergenic
903314384 1:22489969-22489991 ACAGCTGCTGCAGCAGCTGCCGG - Exonic
903385133 1:22921120-22921142 ATGGCTCTGACAGCAGCTCCAGG - Intergenic
903483299 1:23670301-23670323 AAGGCTCCTTCACATGCTCCGGG + Intergenic
906127238 1:43434425-43434447 TCGCCACCTGCAGCAGCTCCTGG + Exonic
906281873 1:44559991-44560013 ACGGCTCCTTCAGCACCTCCCGG + Intronic
907399279 1:54214703-54214725 AGGCCTCCTTCAGCCCCTCCAGG + Intronic
908252053 1:62273381-62273403 ACTGCTCCTGCAGGAGCTCCTGG + Exonic
908563543 1:65331170-65331192 ACCCCTCCTTCTTCAGCTCCAGG + Intronic
915737105 1:158091888-158091910 ACAGCTCTTTCTGCAGCCCCTGG - Intronic
917435673 1:175018554-175018576 ATGGTTCCTTCATCAGCTTCAGG - Exonic
917451576 1:175151720-175151742 TCAGCTCCTTCAGCATTTCCTGG - Intergenic
920110828 1:203586023-203586045 AAGCCTCCTTCTGCATCTCCTGG - Intergenic
920878455 1:209858867-209858889 AGGGCACCCTCCGCAGCTCCTGG + Intergenic
921317147 1:213903220-213903242 ACGGCTCCATCACCATCCCCAGG - Intergenic
922216708 1:223526002-223526024 GTGGCTCCTGTAGCAGCTCCTGG - Intergenic
922509773 1:226154664-226154686 AGGGCTTCTTCTGCAGCTTCTGG + Exonic
923515997 1:234698528-234698550 AGGGGTCCTTCATCATCTCCAGG + Intergenic
1064600816 10:16990466-16990488 CAGGCTCCTTCAGCAGCCCCGGG - Exonic
1067150451 10:43728485-43728507 ACGGCTGCTGCAGCGCCTCCTGG + Intergenic
1067793843 10:49306846-49306868 ATGGCTCCTTCAGGAGCTCTGGG - Intronic
1069797349 10:71061868-71061890 CCTGCTCTTTCTGCAGCTCCGGG + Intergenic
1070555900 10:77527565-77527587 AGGCCTCCTTCAGCAGATCTGGG - Intronic
1071089248 10:81899652-81899674 AGGGCAGCTTCAGTAGCTCCAGG - Intronic
1071510640 10:86260505-86260527 ATGGGACCTTCAGGAGCTCCCGG + Intronic
1072709564 10:97707269-97707291 AGGGCACCTTCAGCACCTCATGG + Intergenic
1073330738 10:102668561-102668583 AGTGCTCCCTCAGCAGCTTCTGG - Intergenic
1073491338 10:103855326-103855348 CCGGCTCCTTCTCCAGCTGCCGG + Exonic
1075265143 10:120994188-120994210 ACCTCTCCTTCAGACGCTCCAGG - Intergenic
1075390072 10:122085543-122085565 TCAGCTGCTTCAGAAGCTCCTGG - Exonic
1075860123 10:125667902-125667924 ACAGCTCCTTCTTCTGCTCCAGG + Intronic
1076809526 10:132879382-132879404 CCTGCTCCTGCAGCACCTCCCGG - Intronic
1076816096 10:132915370-132915392 CCCTCTCCTGCAGCAGCTCCGGG - Intronic
1076848538 10:133081854-133081876 AGGGCTCCCTCGGCAGCACCGGG + Intronic
1077086677 11:755955-755977 TCGCCTCCTCCACCAGCTCCTGG - Exonic
1078415215 11:11159305-11159327 ACCACTCCTCCAGCATCTCCTGG - Intergenic
1079364766 11:19799599-19799621 ACTGCTGGTTCAGAAGCTCCTGG + Intronic
1081869273 11:46375983-46376005 CCGGCTGCTTCAGCCCCTCCTGG - Intronic
1081915070 11:46725547-46725569 ATGACTCCTCCAGCAGCTCCAGG + Intronic
1083933135 11:65857005-65857027 CCGGCTTCTTCTGCAGTTCCGGG - Intronic
1084213763 11:67635738-67635760 AGCTCTCCTTCAGCAGCACCGGG - Intronic
1085924820 11:81004824-81004846 ACAGCTCCTTCAGCTTCTTCAGG - Intergenic
1086700426 11:89895580-89895602 AGGGGTCCTCCAGCAGCCCCAGG - Intergenic
1086705743 11:89948946-89948968 AGGGGTCCTCCAGCAGCCCCAGG + Intergenic
1088655304 11:111993516-111993538 TCGCCTTCTTCAGCAGCACCAGG + Intronic
1088808159 11:113370423-113370445 CCACCTCCTCCAGCAGCTCCCGG + Intronic
1089869429 11:121658943-121658965 ACAGCACCTTGAGCAGCCCCAGG - Intergenic
1090335572 11:125960950-125960972 AGAGGTCCTTCAGCAGCCCCGGG - Exonic
1090589206 11:128247039-128247061 AAGGGACCTTCAGCAGCCCCAGG - Intergenic
1091248919 11:134125120-134125142 ACTGCTGCTCCAGCCGCTCCCGG + Intronic
1091394005 12:142602-142624 GCGTCTCCACCAGCAGCTCCAGG - Intronic
1091658014 12:2360021-2360043 ATGGCTGCCTCAGCATCTCCAGG + Intronic
1092787449 12:12040234-12040256 ACGGGTCCTTGAGCCTCTCCAGG - Intergenic
1094035515 12:26066167-26066189 ACGGCCCGTACAGCAGCTACTGG - Intronic
1096178070 12:49536129-49536151 CTGCCTCCTCCAGCAGCTCCAGG - Intergenic
1097665126 12:62469241-62469263 AGGGATCCTCCAGCAGCTTCTGG - Intronic
1100073986 12:90755720-90755742 ACAGCTCGGTCTGCAGCTCCTGG - Intergenic
1101750423 12:107578951-107578973 ACGGCTCCCGCCGCAGCTCCAGG - Intronic
1102946898 12:116997716-116997738 AGGGCTCCTGCAGCAGCCCAGGG - Intronic
1102955234 12:117054610-117054632 AGGGGTCCTTCAGCTGCCCCTGG - Intronic
1104050296 12:125190079-125190101 GCCCCTCCTTCAGCAGCCCCCGG + Intronic
1105057892 12:133119701-133119723 ATAGCTCTTTCAGCAGCTTCAGG + Exonic
1107985094 13:45768726-45768748 TCGGCTGCTCCAGCAACTCCTGG - Intergenic
1108689391 13:52847827-52847849 CCAGCTCCTGCAGCAGCACCAGG + Exonic
1108727674 13:53200585-53200607 CCAGCTCCTGCAGCAGCACCAGG - Intergenic
1110399273 13:75070787-75070809 TCAGCTCCTTCAACAGCTCTAGG - Intergenic
1113267433 13:108634725-108634747 ACGTCTTCTTCTGCAGCTCTTGG + Intronic
1113634448 13:111910114-111910136 AGGGCTCCTTCCTCAGGTCCAGG + Intergenic
1113747118 13:112752892-112752914 ACGGCTCCTTCGGCAGCTGCTGG - Intronic
1116937621 14:50758392-50758414 GAGTCTCTTTCAGCAGCTCCTGG + Exonic
1117647339 14:57865882-57865904 CCGGCACCTGCACCAGCTCCCGG - Intronic
1117888282 14:60388648-60388670 ACAGCTCCTGCATCAGCTTCTGG - Intergenic
1118753033 14:68820261-68820283 GCGGCTGCTTCAGCAGCTGTGGG - Intergenic
1118906794 14:70029190-70029212 ACGCCTGCTCCAGCAGGTCCTGG - Intronic
1119601618 14:75980644-75980666 GCATCTCCTCCAGCAGCTCCCGG + Exonic
1121664990 14:95665561-95665583 ATGTCTCCTTCAGCAGCCCTGGG + Intergenic
1122788861 14:104176105-104176127 ACGGCTCCTCCATCAGCTCCTGG + Exonic
1123043833 14:105501856-105501878 AGGGCTCCTTCACCTGGTCCTGG + Intergenic
1124141281 15:27079238-27079260 CAGGCTCCTTTAGCAACTCCTGG - Intronic
1124244597 15:28058424-28058446 AAGGCTCCCTCTGCAGCTGCAGG + Intronic
1125729232 15:41883437-41883459 GAGGCTCCTTCAGCATCTACAGG - Exonic
1130371115 15:83285533-83285555 ACAGCTGCTGCAGCAGCGCCCGG + Intergenic
1131316424 15:91342204-91342226 TCGCCTCCCTCAGCAGCCCCAGG + Intergenic
1132122208 15:99185797-99185819 ACGGCTCTTTCAGCAGTCCCTGG + Intronic
1132319910 15:100918438-100918460 AGGGCTCCTGCAGGACCTCCCGG - Intergenic
1132326454 15:100973916-100973938 AGGCCTCCTCCAGCAGGTCCCGG - Exonic
1132383910 15:101386515-101386537 ATCGCTCCTTCTGCAGCCCCTGG + Intronic
1132588052 16:714827-714849 TCGGCTCCATCAGAGGCTCCAGG + Intronic
1132759101 16:1500340-1500362 ACAGCTCCTTCAGCACCTGCAGG - Exonic
1132858982 16:2060792-2060814 ACGGCTCCTTCAGCAGCTCCAGG + Exonic
1136409387 16:30067281-30067303 ACAGCTCCTTCTTCTGCTCCGGG - Exonic
1136569145 16:31086485-31086507 CCGTCTCTTTCACCAGCTCCTGG - Exonic
1138538025 16:57670068-57670090 ATGGCTCCTTCAGCCCCTGCTGG - Intronic
1139437262 16:66943483-66943505 ATGGCCCCTTCCCCAGCTCCGGG + Intronic
1139573694 16:67828472-67828494 ACCGCCGCATCAGCAGCTCCAGG + Exonic
1142625148 17:1187105-1187127 TCGGCTCCTGCAGCCACTCCTGG - Intronic
1144208478 17:12995636-12995658 CCGTCTCCTTCAGAAGCTCAAGG - Intronic
1144922046 17:18772222-18772244 ACGACTCCTGCTGCATCTCCTGG + Intronic
1145004334 17:19328934-19328956 ACGGGCCCTGCAGCCGCTCCTGG + Intronic
1146371301 17:32266670-32266692 TCCGCTCCTTCCCCAGCTCCGGG - Intronic
1146797806 17:35795269-35795291 CCGCCTCCTTGCGCAGCTCCTGG + Exonic
1146974480 17:37099152-37099174 ACGGCTCAGTCAGCAGCCCAAGG - Intronic
1147987651 17:44315589-44315611 ACAGCTGCTCCTGCAGCTCCAGG - Exonic
1150710759 17:67529118-67529140 CCGGCTCATTCAGCAGCCACTGG + Intronic
1151497319 17:74466662-74466684 GCGGCACTTGCAGCAGCTCCAGG - Exonic
1151675441 17:75595102-75595124 AGGGCTCCTTCTGCATCTGCTGG + Intergenic
1151959896 17:77400379-77400401 ACGGCTCCTTGCCCAGCTTCTGG + Intronic
1152007636 17:77692553-77692575 ACGGCACCTTCCTCAACTCCAGG - Intergenic
1152783787 17:82237841-82237863 CCGCCTCCATCAGCAGCACCAGG - Exonic
1152944148 17:83189954-83189976 AGGGCCCCTGGAGCAGCTCCAGG - Intergenic
1153787231 18:8545792-8545814 CCTGCTCCTTGAGCTGCTCCTGG - Intergenic
1155216661 18:23649121-23649143 ACAGCAGCTTCAGCAGCGCCAGG + Exonic
1155342963 18:24831400-24831422 ACGGCTCCTTGGGCACATCCGGG + Intergenic
1155819962 18:30362427-30362449 ACGCCTCCTGCAGCAGGCCCAGG + Intergenic
1156841318 18:41613437-41613459 GAGGCTCTGTCAGCAGCTCCAGG + Intergenic
1157943592 18:51955268-51955290 ACGACTGCTTGAGCAGCTCCTGG - Intergenic
1159618253 18:70607227-70607249 CCAACTCCTGCAGCAGCTCCGGG - Intergenic
1160626178 18:80208480-80208502 ACGGCTGCTTCAACATCTGCTGG + Intronic
1160782426 19:883779-883801 CTGGCTCCTGCAGCAGCACCTGG - Intronic
1160798370 19:955943-955965 AAGGCTCCTCCTGCAGCCCCTGG - Intronic
1161719822 19:5896560-5896582 ACGGCCCCGACAGCAGCTGCGGG + Exonic
1162510347 19:11114176-11114198 ATGGCTGACTCAGCAGCTCCTGG + Intronic
1163471780 19:17501343-17501365 CCAGCACCTTCTGCAGCTCCTGG - Exonic
1164595179 19:29527344-29527366 CCAGCTCGTGCAGCAGCTCCCGG - Exonic
1164896721 19:31883325-31883347 CCTGCTCCTACAGCAGGTCCCGG + Intergenic
1165341534 19:35215684-35215706 AGGTGTCCTTCAGCAGCTCCAGG - Intergenic
1165446772 19:35860963-35860985 ACGCTTCCTTCAGCTGCGCCTGG + Exonic
1165489190 19:36113594-36113616 ACTGCGGCTTCACCAGCTCCCGG + Exonic
1165696012 19:37901510-37901532 ACTACTCTCTCAGCAGCTCCAGG - Intronic
1166204403 19:41259719-41259741 TCAGCTCCTCCTGCAGCTCCAGG - Exonic
1166317991 19:41999266-41999288 GCAGCTCCTGCAGCATCTCCTGG + Exonic
1167033562 19:46979315-46979337 ACGGCTCTCCCAGCTGCTCCTGG + Intronic
1168288883 19:55347504-55347526 AGGGCTCCTTCTGGAGGTCCTGG - Exonic
1168289930 19:55352676-55352698 ACGGCTCCCTCAGCAGGACCAGG + Exonic
1168323037 19:55521677-55521699 ACGGCTCCTTTTCCAGGTCCAGG + Intergenic
925233239 2:2254358-2254380 ACAACTCATTCAGCAGCTACAGG + Intronic
925559961 2:5181011-5181033 ACGGCTCCAGCATCCGCTCCTGG + Intergenic
926136937 2:10343059-10343081 AGGGGTCCTTCCCCAGCTCCAGG + Intronic
929461065 2:42102334-42102356 ACGCCTTCCTCCGCAGCTCCTGG - Intergenic
930014924 2:46963760-46963782 AGGTCTTCCTCAGCAGCTCCAGG + Intronic
932776160 2:74529631-74529653 ACTGCTGCTTCAGGAGCGCCCGG + Exonic
934165386 2:89289638-89289660 CAGGCTCCTTCAGAGGCTCCAGG + Intergenic
934201888 2:89892824-89892846 CAGGCTCCTTCAGAGGCTCCAGG - Intergenic
934580882 2:95436734-95436756 AGGGGTCCTCCAGCAGCTCCAGG + Intergenic
934598569 2:95639981-95640003 AGGGGTCCTCCAGCAGCTCCAGG - Intergenic
934761860 2:96860982-96861004 TGGGCTCCTTGGGCAGCTCCAGG + Exonic
935319641 2:101873435-101873457 ACGGCTCCTGCAGTGGTTCCAGG + Intronic
936516302 2:113183474-113183496 GGGGCTCCTGCAGCACCTCCTGG + Exonic
937283471 2:120736006-120736028 CCGGCTCCTCCTGCGGCTCCTGG - Intronic
938311157 2:130288819-130288841 CCGACTCCTCCTGCAGCTCCGGG + Intergenic
938975965 2:136479454-136479476 ACTGATTCTTGAGCAGCTCCAGG + Intergenic
941517230 2:166494431-166494453 GCGTCTCCTCCAGCAGCTGCCGG + Intergenic
944046201 2:195414392-195414414 AAGGCTCTTTCAGCAGCTTGCGG - Intergenic
945274300 2:207972646-207972668 GTGGCTTCTTCTGCAGCTCCAGG - Intronic
945907891 2:215615101-215615123 ACCGCACCTTCCGCAGCTGCTGG + Intergenic
946164732 2:217857141-217857163 ACGGCTGCCTCTGCTGCTCCAGG + Intronic
947795651 2:232892467-232892489 GGGGCTCCTCCAGCAGCGCCGGG - Intronic
948708940 2:239813387-239813409 AGGGCTCCTCCAGCAGCTGAAGG - Intergenic
948846603 2:240685800-240685822 ACGGCTCCTCCAGCAACCCATGG - Intergenic
949010003 2:241672956-241672978 CAGGCTCCAGCAGCAGCTCCAGG - Exonic
1168999386 20:2156108-2156130 ACTGCTCACCCAGCAGCTCCAGG + Intronic
1172036961 20:32017972-32017994 GCAGCTCCTTCAGCTGCTGCAGG - Exonic
1173129110 20:40370990-40371012 TCCTCTCCTTCAGCAGCTGCAGG - Intergenic
1173154101 20:40593429-40593451 CCAGCTCATTCAGAAGCTCCTGG + Intergenic
1174584684 20:51598965-51598987 ATGGCTTCTTCAGCCCCTCCTGG + Exonic
1175229189 20:57462653-57462675 GCGGCTCCTTGAGCAGTTCAAGG + Intergenic
1175444599 20:59011345-59011367 ACGGTTCCCTCACCAGCTACAGG + Intergenic
1175592117 20:60201436-60201458 AGGTGGCCTTCAGCAGCTCCAGG + Intergenic
1175761159 20:61562896-61562918 ACGGCTCCTGAAGCAGCAACAGG + Intronic
1175856935 20:62126170-62126192 AGGGCTCCTCCAGCATCTCAAGG + Intronic
1176232439 20:64039177-64039199 CCGGCTCTGTCAGCGGCTCCCGG + Intronic
1179879458 21:44287332-44287354 CCGCCTACTTCACCAGCTCCGGG - Intronic
1179976907 21:44873489-44873511 CCGGCGCCCTCACCAGCTCCGGG + Exonic
1180108439 21:45634882-45634904 ACGGCTCCCACAGCAGCAGCCGG - Intergenic
1183658400 22:39204321-39204343 AGGGGGCCTTCAGCAGCACCAGG + Intergenic
1184259968 22:43309121-43309143 CCTGCACCTTCACCAGCTCCAGG + Intronic
1184464748 22:44662287-44662309 AAGGGCCCTTCAGCAGCTGCAGG + Intergenic
1185232272 22:49690014-49690036 AGGGCCCCTGCAGCCGCTCCAGG + Intergenic
949790043 3:7782683-7782705 TGGGCTCTCTCAGCAGCTCCTGG + Intergenic
950635112 3:14308688-14308710 ATGTGTCCTTCAGCTGCTCCAGG - Intergenic
950860858 3:16146235-16146257 GCAACTCCTTCAGCATCTCCAGG + Intergenic
951335204 3:21412664-21412686 CTGGTTCCTTCAGCAGCTCTAGG - Intergenic
954218041 3:49135253-49135275 ATGCCTTCTTCAGGAGCTCCTGG + Intergenic
954544418 3:51420590-51420612 CAGGCTCCTTCATCAGCTGCTGG + Exonic
955008165 3:54989045-54989067 AAGCTTCCTGCAGCAGCTCCTGG + Intronic
957471801 3:80668297-80668319 ATGGTTTCTTCAGCAGGTCCAGG + Intergenic
957907601 3:86578156-86578178 AGGGCTCTTTCATCAGCTTCTGG + Intergenic
958791021 3:98651422-98651444 ACAGTTCCTTCACCACCTCCAGG + Intergenic
961017618 3:123479796-123479818 ACAGCTCCTTCTGCACCTGCAGG - Intergenic
961496978 3:127300657-127300679 ACGCCTCCTTCAGCTCCTCGTGG + Intergenic
961509394 3:127391770-127391792 ACAGCTCCTGCAGCAGAGCCTGG - Intergenic
961885126 3:130091970-130091992 CCGGCTGCATCAGCAGCACCAGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962668292 3:137679079-137679101 ACAGCTCTATCTGCAGCTCCTGG + Intergenic
965505348 3:169509192-169509214 CAGGCTCCACCAGCAGCTCCTGG + Intronic
967777343 3:193398055-193398077 AAGGCTCTTTCATCAACTCCGGG + Intergenic
968473267 4:791559-791581 ACGGCTTCTCCACCTGCTCCAGG + Intronic
968881592 4:3303003-3303025 GTGGCTTCTGCAGCAGCTCCAGG - Intronic
970511070 4:16782277-16782299 ACTGCTCTTTCTCCAGCTCCTGG + Intronic
975796873 4:78015391-78015413 AGGACTCCTCCAGCAGCTGCTGG + Intergenic
984335714 4:178387410-178387432 ACGGCTCCTTCTCCAGCTAGTGG - Intergenic
984908863 4:184653221-184653243 CCCCCTCCTTCAGCTGCTCCTGG + Intronic
985544843 5:504426-504448 ACGGCCCCTGCAGCGGCTCAAGG - Intronic
985631414 5:1015991-1016013 AGGGCTCCTTCCGCACCTCCAGG - Intronic
987577268 5:19745801-19745823 CCTGCTCCTACAGCAGCTGCAGG + Intronic
989185052 5:38615675-38615697 ATCGCTCCTTGAGCAGCTGCAGG + Intergenic
991960250 5:72037086-72037108 CCTGCACCCTCAGCAGCTCCAGG + Intergenic
994043406 5:95283936-95283958 GCGGCTCCAGCAGCTGCTCCAGG + Exonic
995137760 5:108698515-108698537 AAGGCTTCTCCAGCAGCTACTGG + Intergenic
998151071 5:139757849-139757871 ACAGGTCCCTCAGCAGCCCCTGG + Intergenic
1000003633 5:157163480-157163502 GCTCCTCCTTCAGCAGCCCCTGG + Exonic
1001424480 5:171614525-171614547 ACGGCTGCTTCAAAACCTCCAGG - Intergenic
1002160200 5:177310497-177310519 TCTGCTGCTTCAGCCGCTCCAGG + Exonic
1002434259 5:179221491-179221513 CCTGCTCCTTGAGCAGGTCCTGG - Intronic
1002440348 5:179261363-179261385 CTGGCTCCCACAGCAGCTCCTGG - Intronic
1002896115 6:1381595-1381617 AGGGCACCTCCAGGAGCTCCGGG + Intergenic
1004255345 6:14058262-14058284 CCGGCTGCTTCAGCATCGCCTGG + Intergenic
1004715767 6:18215108-18215130 CCTGCTCCTTGAACAGCTCCCGG - Exonic
1006375008 6:33667179-33667201 ACAGCTCCTCCAGCCGCACCAGG - Exonic
1006949862 6:37812832-37812854 GTAGGTCCTTCAGCAGCTCCAGG + Intergenic
1007227198 6:40323406-40323428 AAAGCTCTTTCAGCAGCACCTGG - Intergenic
1007658931 6:43470287-43470309 ATGACTCCTTTAGCAGCTACTGG - Intergenic
1013111782 6:107070171-107070193 ACGACTTCTTCAGCCGCTTCTGG - Exonic
1015029833 6:128581218-128581240 CTGGCTCCTTCAGGAGCTCAAGG + Intergenic
1018663729 6:166114076-166114098 CTGGCTCCCTCAGCAGCTCTCGG - Intergenic
1018792187 6:167157301-167157323 ACGGCTCCTTCAGCATCATCTGG - Exonic
1019198675 6:170296730-170296752 CGGGCTCCTGCAGCACCTCCTGG - Intronic
1019421868 7:954429-954451 CCGGCCGCTGCAGCAGCTCCAGG + Intronic
1020022557 7:4877851-4877873 GCGCCTCCTTCACCAGCTCACGG + Exonic
1021571867 7:22074248-22074270 ATGGCTGCTTCAGCAGGTTCTGG + Intergenic
1021814912 7:24437606-24437628 AAAGCTCCTTCACCATCTCCAGG + Intergenic
1023479853 7:40622347-40622369 ATGGGTTCTTCAGCAGTTCCTGG + Intronic
1025050744 7:55732045-55732067 CCGCCTCCTTCTGCCGCTCCTGG + Intergenic
1029174821 7:98657350-98657372 AGGGCTCATGCTGCAGCTCCAGG - Intergenic
1032119245 7:129144772-129144794 ACCGCGGCTCCAGCAGCTCCAGG + Intergenic
1033672344 7:143505041-143505063 ACTGGTACTTCAGAAGCTCCAGG + Intergenic
1034411978 7:150946703-150946725 AAGGCTGCTTCAGGAGCTGCAGG - Intronic
1035376711 7:158411392-158411414 ACAGCTCCTTCAGCAGCCTCTGG + Intronic
1037838480 8:22228286-22228308 GCGACTCCTTCCGCATCTCCTGG - Exonic
1039970375 8:42316829-42316851 CCGCTTCCTGCAGCAGCTCCTGG - Exonic
1040306061 8:46212426-46212448 AGGCCTCCTTGAGAAGCTCCCGG - Intergenic
1042241166 8:66666208-66666230 ACAGCACTTTCAGCAGCACCTGG - Exonic
1045214708 8:100136167-100136189 ATGGCTGCTTCTGCAGCTGCTGG - Intronic
1049156564 8:141070707-141070729 AGGCCTCCTCCAGAAGCTCCAGG - Intergenic
1049222663 8:141435015-141435037 ACAGCTGCTATAGCAGCTCCAGG - Intergenic
1049279796 8:141738428-141738450 ACGGCTCATTCCGTGGCTCCTGG - Intergenic
1049424211 8:142530869-142530891 GCCTCCCCTTCAGCAGCTCCCGG + Intronic
1049572677 8:143376588-143376610 GCTCCTCCTTCAGCAGCTGCAGG - Exonic
1049671517 8:143872182-143872204 AGAGCTCCATGAGCAGCTCCTGG - Exonic
1049847541 8:144810389-144810411 ATGGCTCTTTCTGCAGCCCCTGG - Intronic
1049849164 8:144821551-144821573 CCGGCTCATCCGGCAGCTCCAGG + Intergenic
1050190459 9:3019806-3019828 GTGGCTCCTTCAGCTGCTCAGGG + Intergenic
1050253512 9:3770627-3770649 ACAGCGCCTGCAGCAGCTCCAGG + Intergenic
1051685784 9:19656947-19656969 TCTGGTCCTTCAGAAGCTCCTGG + Intronic
1056515296 9:87343991-87344013 AGGGCTCCTCCAGCAGCTCCTGG + Intergenic
1059755714 9:117291413-117291435 ACGTCTCCATGAGCAGCTCCGGG - Exonic
1060422780 9:123481450-123481472 ACGGCCTCTTCGGCAGCACCTGG - Intronic
1060797995 9:126525632-126525654 AGAGCTCCTTCAGCAGCTCGCGG - Intergenic
1061144333 9:128788346-128788368 AGGGCTCCTTCAGGACATCCTGG - Exonic
1061388284 9:130303198-130303220 CCGGCTCCTTCACCAGCTGATGG - Intronic
1061483257 9:130907447-130907469 CCAACTCCTTCACCAGCTCCCGG + Intronic
1061661193 9:132131397-132131419 TCGGCTGTTTCAGCAGCTCAGGG - Intergenic
1062095072 9:134698899-134698921 GCGGCTCCAGCAGCAGGTCCTGG + Intronic
1062179898 9:135185683-135185705 AAAGCTCCTACAGCAGGTCCTGG - Intergenic
1062289737 9:135789189-135789211 GCGGCTCCCACTGCAGCTCCAGG + Intronic
1062400508 9:136370578-136370600 GCAGCTCCCACAGCAGCTCCTGG + Exonic
1187950453 X:24465467-24465489 CCGGCTGCTTCAGCAGCCACCGG - Exonic
1190691933 X:52919719-52919741 ACATGTCCTTCAGCAGCTGCTGG - Intergenic
1190694050 X:52936073-52936095 ACATGTCCTTCAGCAGCTGCTGG + Intronic
1197335019 X:125203041-125203063 ACGGCTCCTGGAGCACCGCCTGG + Intergenic
1198214983 X:134546875-134546897 TCGGCTCCACCTGCAGCTCCTGG - Intergenic
1198270400 X:135051561-135051583 CAGGCTCCTGCTGCAGCTCCTGG - Exonic
1198828729 X:140726716-140726738 ACGGCTTCTTCCACACCTCCTGG + Intergenic
1201312724 Y:12611743-12611765 ACAGCTCCATCTGTAGCTCCTGG + Intergenic