ID: 1132860733

View in Genome Browser
Species Human (GRCh38)
Location 16:2070557-2070579
Sequence CGCGAGCAGCATCCGGCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132860727_1132860733 19 Left 1132860727 16:2070515-2070537 CCACATTCAGCTCCACTACAAGC 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1132860733 16:2070557-2070579 CGCGAGCAGCATCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1132860728_1132860733 7 Left 1132860728 16:2070527-2070549 CCACTACAAGCACAGCTACACCC 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1132860733 16:2070557-2070579 CGCGAGCAGCATCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132860733 Original CRISPR CGCGAGCAGCATCCGGCTGC AGG Exonic
901931002 1:12596023-12596045 TGCCAGCAGCCTCCGGCCGCAGG + Intronic
904499926 1:30908016-30908038 CGCGAGAAGGACCCGGCGGCGGG - Intronic
906315925 1:44786406-44786428 CGCCACCTGCATCCGGCTGTGGG + Intronic
906707738 1:47907036-47907058 TGCGAGCACCAGCCGGCCGCTGG + Intronic
919754332 1:201057260-201057282 AGCAAGCACCATCCTGCTGCAGG + Intronic
920052226 1:203171165-203171187 CCCCAGCAGCATCAGGCTCCTGG - Exonic
921283720 1:213590760-213590782 CGCCACCACCACCCGGCTGCCGG - Intergenic
922776332 1:228215801-228215823 TGAGAGCAGCATCCGGATGGAGG + Exonic
1064588684 10:16865771-16865793 CCCGAGCAGGTTGCGGCTGCTGG - Intronic
1075768880 10:124917026-124917048 CGCGCGCGGCTCCCGGCTGCCGG - Intergenic
1077898888 11:6474185-6474207 CGCCAGCTGCCTCCGGCTCCGGG + Exonic
1077941548 11:6848676-6848698 CCCAGGCAGCATCCTGCTGCAGG + Intergenic
1079413058 11:20207969-20207991 CGCGAGCTGCATGCAGGTGCGGG - Intergenic
1090375109 11:126282985-126283007 CTCGGGCACAATCCGGCTGCGGG - Intergenic
1100435098 12:94563937-94563959 AGTGAGCAGCATCAGGCAGCAGG - Intergenic
1104947420 12:132422354-132422376 TGCGAGCAGCAGCAGGATGCTGG + Intergenic
1109163867 13:59009321-59009343 CCCGAGCAGGTTGCGGCTGCTGG - Intergenic
1113378073 13:109782762-109782784 CGCGGGCAGCTTCTGGCTTCGGG + Exonic
1121546655 14:94768290-94768312 CGCGGGCGGCCTCGGGCTGCTGG + Exonic
1123050799 14:105541055-105541077 CGTGAGCCTCATCAGGCTGCAGG + Intergenic
1124589405 15:31040166-31040188 GGTCAGCAGCATCTGGCTGCAGG + Exonic
1127982688 15:64046276-64046298 CGTGAGTAGCACCCGTCTGCGGG - Intronic
1132860733 16:2070557-2070579 CGCGAGCAGCATCCGGCTGCAGG + Exonic
1133239190 16:4404498-4404520 TCTGAGCAGAATCCGGCTGCAGG - Intronic
1146763119 17:35495685-35495707 CGCGAGCAGAATCGGACTGGTGG - Intronic
1147385030 17:40075934-40075956 TGGGAGCTGCATCCGGCTCCAGG + Intronic
1148852359 17:50561275-50561297 CGCGGGCAGCATGCCCCTGCGGG + Intronic
1149490942 17:57085029-57085051 CGCGAGCAAGACCCGGCTCCGGG + Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1166354022 19:42216749-42216771 CGAGAGCAACCTGCGGCTGCTGG - Exonic
1167306534 19:48713290-48713312 CTCCAGCAGCAGCCGGCTGTGGG - Exonic
1168689355 19:58367546-58367568 GGCGCACAGCATCCGGTTGCAGG - Intergenic
928100826 2:28436609-28436631 CACGAGAAGCAGCAGGCTGCAGG - Intergenic
942251093 2:174048458-174048480 CGCGAGTGGCAGCCGGCTGCGGG - Intergenic
946335169 2:219031112-219031134 GAGGAGCAGCATCCAGCTGCAGG - Exonic
1182519525 22:30877587-30877609 CGGGAGCAGGTTCCGTCTGCAGG + Intronic
1183540501 22:38426881-38426903 GGCGGGCATCATCCGGATGCTGG - Exonic
1184229679 22:43151814-43151836 CGCGGGCCGCCTCCGGCTGGGGG + Intronic
961517993 3:127450436-127450458 CGCGTGGAGCACCCAGCTGCTGG - Intergenic
962231927 3:133673896-133673918 CCTGAGCAGGATCGGGCTGCAGG + Intergenic
968834161 4:2950430-2950452 CGCGCCCAGCATCCTGCCGCAGG - Intronic
968976368 4:3824281-3824303 GGTGAGCAGCATGCGGGTGCAGG - Intergenic
990698178 5:58446138-58446160 CGCGAGCAGGTTGCCGCTGCTGG + Intergenic
998266730 5:140672578-140672600 CGCGAGCAGCAGCGCGCTGCGGG + Exonic
1019636455 7:2078639-2078661 CCCGAGCAGCTTTCGGCTGCAGG + Intronic
1034393275 7:150801691-150801713 CAGGGGCAGCAGCCGGCTGCTGG + Exonic
1036453927 8:8892407-8892429 CGTGTCCAGCAACCGGCTGCGGG - Exonic
1045440525 8:102204185-102204207 CTCTAGCAGCATTTGGCTGCTGG + Intergenic
1048073336 8:131042354-131042376 CTCCACCTGCATCCGGCTGCGGG - Exonic
1057001885 9:91517685-91517707 AGCCAGCAGCAACCAGCTGCGGG + Intergenic
1060786705 9:126456821-126456843 CGCTATCAGCAGCCTGCTGCTGG - Intronic
1062515004 9:136928633-136928655 TGAGAGCAGCATCGGGCTCCAGG + Intronic