ID: 1132862208

View in Genome Browser
Species Human (GRCh38)
Location 16:2077246-2077268
Sequence GCCTGCCTTCCGCGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132862196_1132862208 18 Left 1132862196 16:2077205-2077227 CCACTGAGGCCTCAGTGCCGCCT 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1132862208 16:2077246-2077268 GCCTGCCTTCCGCGGGTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 138
1132862198_1132862208 9 Left 1132862198 16:2077214-2077236 CCTCAGTGCCGCCTCGGTCAGAG 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1132862208 16:2077246-2077268 GCCTGCCTTCCGCGGGTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 138
1132862195_1132862208 23 Left 1132862195 16:2077200-2077222 CCTGGCCACTGAGGCCTCAGTGC 0: 1
1: 0
2: 1
3: 30
4: 304
Right 1132862208 16:2077246-2077268 GCCTGCCTTCCGCGGGTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 138
1132862203_1132862208 -2 Left 1132862203 16:2077225-2077247 CCTCGGTCAGAGCTGGGCGGTGC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1132862208 16:2077246-2077268 GCCTGCCTTCCGCGGGTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 138
1132862201_1132862208 1 Left 1132862201 16:2077222-2077244 CCGCCTCGGTCAGAGCTGGGCGG 0: 1
1: 0
2: 2
3: 8
4: 106
Right 1132862208 16:2077246-2077268 GCCTGCCTTCCGCGGGTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132862208 Original CRISPR GCCTGCCTTCCGCGGGTGGG TGG Intronic
900118774 1:1039882-1039904 ACAGGCCTGCCGCGGGTGGGGGG + Intronic
900298663 1:1965641-1965663 CCCTGGCTTCCCGGGGTGGGGGG + Intronic
900325573 1:2107223-2107245 GGCTGCCTTCCGTGGCTGTGTGG + Intronic
900486340 1:2924510-2924532 GCCTGCCTGCTGAGGGTGGAGGG - Intergenic
900981689 1:6049502-6049524 GCATGGCTCCCGGGGGTGGGGGG - Intronic
901129192 1:6951632-6951654 TCCTGGGTTCCACGGGTGGGAGG + Intronic
901613490 1:10518292-10518314 CCCTGCCTCCCCCGGGTGGTGGG + Intronic
905091298 1:35433326-35433348 CCCTGCCTGCCACTGGTGGGTGG - Intergenic
910160142 1:84263621-84263643 TCCTGCCATCCGTGGGTGTGGGG + Intergenic
918187976 1:182144355-182144377 GTCTGACTTCAGTGGGTGGGGGG + Intergenic
922743310 1:228029037-228029059 GCCGGCGTTCCCCAGGTGGGTGG - Intronic
1063388921 10:5635882-5635904 GCCCACCTTCTGCAGGTGGGAGG - Intergenic
1064432171 10:15280518-15280540 ACCTGCCTGCCACGGGTGGAGGG + Intronic
1065534756 10:26706446-26706468 ACATGACTTCCACGGGTGGGAGG - Intronic
1066657975 10:37712639-37712661 GCCTGGCCTCAGAGGGTGGGAGG + Intergenic
1068475383 10:57517411-57517433 GCCTGTCGTCGGGGGGTGGGAGG - Intergenic
1069982292 10:72260927-72260949 TCCTTCCTCCCGAGGGTGGGCGG + Intergenic
1073349103 10:102806761-102806783 GCCAGCCTGCCGGGGCTGGGGGG + Intronic
1076481460 10:130787834-130787856 GCCTGCCTTCAGGGGGGAGGTGG - Intergenic
1076784389 10:132742501-132742523 GCCTGCCATCCCCAGGTGGAAGG + Intronic
1077198088 11:1291522-1291544 CCGTGCCTTCGGGGGGTGGGTGG - Intronic
1077327495 11:1970027-1970049 CCCTCCCAGCCGCGGGTGGGAGG + Intronic
1080763297 11:35273242-35273264 GCCAGCCTTCCTCGGGTTTGGGG - Intronic
1081488342 11:43548176-43548198 GCTTGGCTTCCACGCGTGGGAGG + Intergenic
1081774081 11:45665774-45665796 GGCTGCCCCCGGCGGGTGGGTGG - Intergenic
1081868954 11:46374676-46374698 GCCAGGCTGCCGTGGGTGGGTGG + Intronic
1083628774 11:64085392-64085414 GCCTGCCTTCCGGGGACGGAGGG + Intronic
1083654630 11:64223570-64223592 GCCTGCCTGGAGCGGGTGTGGGG - Exonic
1083707101 11:64524294-64524316 GCTTGCATTCCGCCTGTGGGGGG + Intergenic
1083901739 11:65646701-65646723 GCCTGCCCTCCCTGGGTGGGAGG + Exonic
1083934511 11:65863306-65863328 GCCTCCCTACTGTGGGTGGGTGG + Intronic
1090082341 11:123622411-123622433 GCCTGCCCTAGGCGGGTGTGGGG + Intronic
1090697982 11:129267956-129267978 TAATGCCTTCCGTGGGTGGGGGG - Intronic
1202810477 11_KI270721v1_random:25207-25229 CCCTCCCAGCCGCGGGTGGGAGG + Intergenic
1097938552 12:65279086-65279108 GCCTCCCTTCGGCGGGTGGGGGG - Intronic
1100766098 12:97867143-97867165 GCCTGCCTTGCTAGGTTGGGGGG - Intergenic
1103521301 12:121538081-121538103 GCCTTCCTTCCGCGGGGAGCCGG + Intronic
1106296736 13:28420993-28421015 GCCTTCCATCCGGGGATGGGGGG - Intronic
1107126922 13:36856182-36856204 ACCTGCCTTGTGAGGGTGGGCGG + Intronic
1115770938 14:36663429-36663451 GCCTGCCATCCCCGGTTCGGTGG + Exonic
1115957391 14:38796580-38796602 GGCTGCCTTCTGGGGTTGGGTGG - Intergenic
1118860417 14:69658724-69658746 ACCTGCCTTCTGTGTGTGGGTGG + Intronic
1121047171 14:90796507-90796529 CCCCACCTTCCCCGGGTGGGGGG - Intronic
1121340808 14:93103982-93104004 CCCTGCCTTGGGCGGGTAGGAGG + Intronic
1122093124 14:99353031-99353053 GCCTGCCTGGGCCGGGTGGGAGG - Intergenic
1123020985 14:105397857-105397879 TCCTGCCGTCCGCGGGTGTGTGG + Exonic
1202862232 14_GL000225v1_random:90057-90079 GCCAGCCTTCCCCGGGTGCCTGG + Intergenic
1125675732 15:41501741-41501763 GCCTGCCTTCCACGGCGTGGTGG + Exonic
1128246003 15:66133255-66133277 GCCTGCCTTGTGCTGGTGTGGGG - Intronic
1128797866 15:70478287-70478309 GCCTGCCTTGAGCAGGTGGCTGG - Intergenic
1129466480 15:75727105-75727127 CCCTGCGTTCCCCCGGTGGGTGG - Exonic
1129653900 15:77510243-77510265 GCCTACCTCCCGAGGGTTGGGGG - Intergenic
1132862208 16:2077246-2077268 GCCTGCCTTCCGCGGGTGGGTGG + Intronic
1132901206 16:2255478-2255500 GCCTGCCTTCCACTGCTGTGCGG - Intronic
1133840066 16:9399826-9399848 GCTTGCTTTCCTGGGGTGGGGGG + Intergenic
1136235987 16:28914094-28914116 GCCTGCCTTCACCAGGAGGGGGG + Intronic
1136402173 16:30024919-30024941 TCCTGCCCTCAGTGGGTGGGAGG + Exonic
1137694185 16:50450142-50450164 GCTTGCCTTCCGCTGGGGGGTGG + Intergenic
1138777833 16:59745809-59745831 GCCTGCATTCCATGCGTGGGTGG - Intronic
1139849113 16:69940114-69940136 GACTGCCATCCGCGGGTCGGGGG - Exonic
1140904082 16:79395619-79395641 TCCTGGCTTCTGCTGGTGGGTGG - Intergenic
1142018478 16:87765469-87765491 GCCTCCCTTCAGAGGGAGGGTGG + Intronic
1142361867 16:89631164-89631186 GCCTGCCTTCTCCCGGGGGGAGG + Intronic
1142494536 17:299355-299377 TCCTGCCTTCCGTGGGAGGGAGG - Intronic
1146269954 17:31478323-31478345 GTCTGCCTTCCGCGCGTGTTGGG + Intronic
1146518531 17:33508470-33508492 GCCTGCCTGCCTAGGGAGGGTGG + Intronic
1151334581 17:73432350-73432372 CCCTTCCTTACGGGGGTGGGGGG - Intronic
1156375883 18:36515033-36515055 GCCTGCAGGCCGCTGGTGGGAGG - Intronic
1156647263 18:39180018-39180040 TCCTGCCATCCATGGGTGGGAGG - Intergenic
1158865271 18:61632422-61632444 GCCTGCCGTTGGCGGGTGGAAGG - Intergenic
1158954709 18:62526626-62526648 GCCCGCCCTCCCCGGGTGCGCGG - Intronic
1160514144 18:79469412-79469434 GCCTGCCCTTCACAGGTGGGAGG + Intronic
1160824645 19:1074020-1074042 GCCTGCCTGCCGCTGGGTGGGGG - Intronic
1161283383 19:3457298-3457320 GCCTGCCTTCTAGGGGTGGTGGG - Intronic
1161335036 19:3708485-3708507 GCCTGCCTGGCACGGGTGGTGGG - Intronic
1161480200 19:4506526-4506548 GCCTGCCCTTGGGGGGTGGGGGG - Intronic
1162552571 19:11365711-11365733 GCCTTCCTCCCCCGGGTGGTGGG + Intergenic
1163123716 19:15233037-15233059 GCCTGGCTTATGCGGGTGGGCGG + Intronic
1164462834 19:28463586-28463608 GCCTGCCTTTGGCTGGTGGCAGG - Intergenic
1164536109 19:29087615-29087637 GCCTCCCCTCCCCGGGTGCGGGG - Intergenic
1165101448 19:33440938-33440960 GCCTGACTTCCCAGGATGGGTGG + Intronic
1166007074 19:39915292-39915314 GCCTGCCTTCCGGGTGCTGGTGG - Exonic
925064232 2:916776-916798 GCCTGCCTTCGGTGGGGTGGTGG - Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
934564235 2:95329626-95329648 GCCTGGCTGCCGGGAGTGGGGGG + Intronic
940211693 2:151261765-151261787 GCCTGCGTTCCGCTGGTTGTGGG - Exonic
946177207 2:217929128-217929150 GCCTGGCTTCAGTGGCTGGGAGG - Intronic
946600568 2:221355782-221355804 GGCTGCTTTCCGGGGATGGGAGG - Intergenic
948686518 2:239673858-239673880 ACCTGCCCTGCGCTGGTGGGCGG + Intergenic
948854785 2:240725013-240725035 GCCAGCCTGCAGCGGATGGGAGG - Intronic
948895739 2:240926088-240926110 GCCCTCCTTCTCCGGGTGGGGGG - Intronic
949017415 2:241721139-241721161 CCCTGCTCTCCGCGGGTGAGAGG + Intronic
1172118221 20:32583932-32583954 AGCAGCCTCCCGCGGGTGGGTGG - Intronic
1175637591 20:60598692-60598714 GCCAGCCTCCCGTGGGTAGGAGG - Intergenic
1175847875 20:62068063-62068085 CACTGCCTTCCGGGGGGGGGGGG + Intergenic
1176199951 20:63855667-63855689 CCCTTCCTTCCTGGGGTGGGTGG - Intergenic
1179511750 21:41878584-41878606 GCGTGCCTACCCGGGGTGGGTGG - Intronic
1180260736 21:46667306-46667328 GGCCGCCTTCCGCGTGAGGGTGG - Intergenic
1183358557 22:37371913-37371935 GCCCTCCTTCCCCGGGTGGGCGG + Exonic
1183364686 22:37400618-37400640 GCGTGCCCACCGAGGGTGGGTGG - Intronic
1184757996 22:46527563-46527585 TCCTGACTTCTGCGGCTGGGTGG - Intronic
1184915178 22:47564088-47564110 GCCTCCCTTCTGCAGGTGGGTGG + Intergenic
1185409422 22:50674372-50674394 GCCTGCCTTCCCCGGGGGCGGGG - Intergenic
950336775 3:12200972-12200994 GCCTGCCTTCACCGGGCTGGAGG - Intergenic
953572599 3:44083092-44083114 GCCTGCCTTCCCAGGAGGGGTGG - Intergenic
953771497 3:45781381-45781403 GCCTTCCTTTCTGGGGTGGGAGG + Intronic
968625246 4:1623993-1624015 GCCTGCCTGGGGCGGGTGTGAGG + Intronic
968727819 4:2256418-2256440 GCCTGCCTCCCGGGGATGGCTGG + Intronic
968729048 4:2261293-2261315 CCCTTCTCTCCGCGGGTGGGTGG - Intronic
968730884 4:2268710-2268732 GCCTGCCTTGTGCAGGGGGGAGG - Intergenic
976727451 4:88228464-88228486 ACCTGCCATCCGCTGTTGGGTGG + Intronic
985588014 5:750932-750954 GCCTGCCTCCCGCGCGCTGGGGG + Intronic
985602683 5:843399-843421 GCCTGCCTCCCGCGCGCTGGGGG + Intronic
985688421 5:1294220-1294242 GCCTGCCAGCCCCGGGTGCGAGG - Exonic
991618704 5:68522907-68522929 GCCTGCCTTCTGGCGGTGGCTGG - Intergenic
997346166 5:133194000-133194022 GCCTGGCTCCCGCGGCTGGCCGG - Intergenic
999586449 5:153094778-153094800 ACCTGCATTTCGGGGGTGGGGGG + Intergenic
1001269869 5:170302996-170303018 TCCTGCCGGCCGTGGGTGGGAGG + Intergenic
1002429083 5:179192642-179192664 CCCTGCCAGGCGCGGGTGGGAGG + Intronic
1003940061 6:11015712-11015734 GCCTGCCTTCTGTGGGTAGGTGG + Intronic
1014230303 6:118895022-118895044 GCCTGCCTTTCGCCGGGGGCAGG - Intronic
1018709094 6:166485109-166485131 GCCTGCCTTCCAGGGCTGTGTGG + Intronic
1019300601 7:301650-301672 TCCCGCCTCCCTCGGGTGGGCGG - Intergenic
1025198155 7:56947560-56947582 GGCTGCCTTCCCCGGGGGTGGGG - Intergenic
1033282886 7:140018218-140018240 GCCTGCCTTTGCGGGGTGGGGGG + Intronic
1033904300 7:146183182-146183204 GCCTGGCATCCTCTGGTGGGAGG - Intronic
1034182290 7:149147949-149147971 GCCTGGTGTCCCCGGGTGGGCGG - Intronic
1037882646 8:22580397-22580419 GCATGGCTTCCCAGGGTGGGGGG + Intronic
1038406424 8:27325860-27325882 GCCAGCCTTCCGCGGGGAAGAGG + Intronic
1042028842 8:64452072-64452094 GGCTGCCTGCAGCTGGTGGGTGG - Intergenic
1046672362 8:117070278-117070300 GGCTGCATTCAGCGGGAGGGTGG + Intronic
1048185241 8:132234475-132234497 GGCTACCTTCTGCGGGTGGGTGG + Intronic
1049203030 8:141351055-141351077 GCCTCCCTTGGGCGGGTGTGAGG + Intergenic
1049407254 8:142457283-142457305 CCTTGCCTTCTGCAGGTGGGGGG + Intronic
1049453025 8:142672562-142672584 GCCAGCCTTCCGGGGGAGGGAGG - Intronic
1049478383 8:142807386-142807408 GCCTAGCTTCCGAGGGTGGATGG - Intergenic
1049767867 8:144363319-144363341 TCCTGCCTTCCGGTGGAGGGTGG - Intergenic
1053010556 9:34630513-34630535 TCCTGCCTTCTGGGGGTGTGAGG - Intergenic
1055491423 9:76808752-76808774 GCCTGCCTTTGGCTGATGGGTGG - Intronic
1055513523 9:77016700-77016722 GCATCCCTTCCGCGGGTTGCTGG - Intergenic
1060102510 9:120852834-120852856 GCCTGGCTTCCGTGGTTGGCAGG + Intergenic
1060787399 9:126461231-126461253 GCCAGCCTTCGGCGGTTGTGGGG - Intronic
1060931109 9:127490055-127490077 GCCGGCCTGCGGGGGGTGGGGGG - Intronic
1061665376 9:132157873-132157895 GCCAGCCTGCCCCGGCTGGGAGG - Intergenic
1062313016 9:135949637-135949659 GCCTGACTTCCTCGGGTGCCAGG - Intronic
1187326433 X:18294989-18295011 GCCTTGCTTCTGGGGGTGGGGGG - Intronic
1189237437 X:39498090-39498112 GCCAGCCCCCCGCAGGTGGGAGG + Intergenic
1194974563 X:100380433-100380455 CCCTGCCTTCATGGGGTGGGGGG - Intronic
1196193630 X:112818603-112818625 TCCTGCTTTCCCCTGGTGGGTGG - Intronic
1196923043 X:120604137-120604159 GCCGGCCTTCCTCGTGTGAGGGG + Intronic
1197763258 X:130042518-130042540 GCCTGCCTTCCTGTGGTGGTAGG - Intronic
1200269587 X:154669859-154669881 GCCTGCCTTGCTAGGTTGGGGGG + Intergenic