ID: 1132864577

View in Genome Browser
Species Human (GRCh38)
Location 16:2087116-2087138
Sequence CTGGGTGGGCACAGTGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132864568_1132864577 28 Left 1132864568 16:2087065-2087087 CCTGCTGCTGAGTGTCTGTCAGG 0: 1
1: 0
2: 5
3: 29
4: 252
Right 1132864577 16:2087116-2087138 CTGGGTGGGCACAGTGTAGTTGG 0: 1
1: 0
2: 1
3: 25
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132864577 Original CRISPR CTGGGTGGGCACAGTGTAGT TGG Intronic
900151927 1:1182604-1182626 CTGGGTGGGGACTGAGGAGTTGG + Intronic
900527583 1:3136653-3136675 CTGGGTGTGGACAGAGGAGTGGG + Intronic
900987012 1:6078976-6078998 CAGGGTGGGCACCGTGGAGGTGG + Intronic
900998661 1:6136455-6136477 CTGGGTGGCCCCAGTGAAGACGG - Intronic
903972670 1:27129274-27129296 CTGGCTGGGCTCTGTGTGGTGGG + Intronic
904861399 1:33540774-33540796 CTAGGTGGGTGCAGGGTAGTCGG - Intronic
906220497 1:44074483-44074505 CTGGGTGGGCAGACTGGAATGGG - Intergenic
907545006 1:55252226-55252248 TTGGCTGGACACAGTGTATTAGG - Intergenic
907970670 1:59377777-59377799 CTGGGAGGGCACAGGGTGGTGGG + Intronic
908002651 1:59695708-59695730 CTGGTTGACCACAGTGTAATGGG - Intronic
912468409 1:109889918-109889940 CTTGGTGGTCACAGTGTTGGAGG + Intergenic
912933015 1:113981166-113981188 CTGGGTAGGCACAGGGCAGCTGG + Exonic
914378088 1:147091103-147091125 CTGGGTAGACACCCTGTAGTAGG - Intergenic
914804664 1:150983315-150983337 CTGTGGGAGCACAGGGTAGTTGG - Intronic
914982908 1:152430943-152430965 CTGAGATGGCACAGTGGAGTAGG - Intergenic
915462116 1:156076527-156076549 CAGGGTGGGCCCAGTGGAGTGGG + Exonic
915822219 1:159036828-159036850 CTGTGTGGTCACAGTGCAGTTGG - Intronic
916020859 1:160790924-160790946 CTGGTTGGGTACAGTGTGTTGGG + Intergenic
916837628 1:168564415-168564437 CTGGGTGGACACCCAGTAGTGGG - Intergenic
917531216 1:175836822-175836844 CTGGCTGGGCCCAGCGTTGTGGG - Intergenic
917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG + Intronic
919485243 1:198138045-198138067 CTGGGTAGGTACACAGTAGTGGG + Intergenic
919660087 1:200235895-200235917 CTGGGTGGGCCCACTGTTCTAGG - Intergenic
923978589 1:239294501-239294523 CAGGGTGGTGACAGTGGAGTAGG - Intergenic
1062760429 10:12969-12991 CAGGGTGGGCGCTGTGCAGTGGG - Intergenic
1062851148 10:744208-744230 CTGGGTGGGGACAGTGGGCTGGG + Intergenic
1064177892 10:13091134-13091156 CTGGGTGGGCACCATCCAGTTGG - Intronic
1069567171 10:69471454-69471476 CTGAGTGGGCAGAGTGGCGTGGG - Intronic
1070673812 10:78398190-78398212 CTGGGAGGACACGATGTAGTTGG - Intergenic
1072810215 10:98455771-98455793 CTGGCTGGGCACAGAGTGGCTGG + Intergenic
1073042187 10:100615228-100615250 CTGGCTGGGCACCCTGTAATGGG - Intergenic
1074549316 10:114428028-114428050 CTGGGTGGCCACAGTGCTTTGGG + Intergenic
1075597522 10:123742913-123742935 GTGGGTGGTCACAGTGTGGAGGG - Intronic
1075727073 10:124616153-124616175 CGCGGTGGGCTCAGTGAAGTGGG + Intronic
1076525330 10:131109049-131109071 CAGGATGAGCACAGTGTTGTGGG + Intronic
1076576799 10:131474895-131474917 CTGGGTGGGCACCATCTAATCGG - Intergenic
1077520229 11:3028831-3028853 CTGGGTGGGCCCAGAGTTGTAGG + Intronic
1078645898 11:13141185-13141207 CTGGGTGGGGACAGAGGAGTGGG + Intergenic
1079182794 11:18208686-18208708 CTGGGTGGGCACAATCTAATGGG + Intronic
1079989064 11:27228014-27228036 CTGGGAGGCCACAGTGGGGTGGG + Intergenic
1080258095 11:30315527-30315549 CTGGGTGTCCACAGTGTGTTTGG - Intergenic
1080672066 11:34389514-34389536 CTGGGTAGACACACAGTAGTGGG + Intergenic
1082185195 11:49171186-49171208 CTGAGTGGGCAGAGGTTAGTTGG - Exonic
1082865977 11:57900525-57900547 CTGGGTGTGTACAGGGTGGTTGG + Intergenic
1083590710 11:63892318-63892340 CTACGTGGGCACAGTGAAGAAGG + Intronic
1083714881 11:64569494-64569516 CTGGGTGGGCTCCGTGGAGGAGG + Intronic
1084416894 11:69037683-69037705 CTTGGTGGGGACAGTGATGTTGG - Intergenic
1084753671 11:71221344-71221366 CTGGTTGGGCACAAGGCAGTGGG + Intronic
1085273019 11:75281465-75281487 CCGGGTGTGCACACAGTAGTAGG - Intronic
1086681137 11:89674156-89674178 CTGAGTGGGCAGAGGTTAGTTGG + Intergenic
1087732335 11:101793029-101793051 CAGGGTAAGCACAGTGCAGTGGG + Intronic
1089773651 11:120820961-120820983 CTGGGTGGTCACAGCTGAGTTGG - Intronic
1091253026 11:134159857-134159879 CTGTCTGGTCACAGTGCAGTGGG + Intronic
1092033259 12:5307709-5307731 CTGCATTGGCATAGTGTAGTAGG - Intergenic
1092460515 12:8681945-8681967 CTGGGTGGGAGCAGTCTTGTGGG + Intronic
1092967533 12:13658957-13658979 CTGGGTGGGTACAGGGTAAGAGG - Intronic
1093412194 12:18880193-18880215 CTGATTGGGAACAGGGTAGTTGG - Intergenic
1095306951 12:40650266-40650288 CTGGGTGGGGCCACAGTAGTAGG + Intergenic
1095502982 12:42860785-42860807 CTGGGTGGGCACCATCTAATCGG - Intergenic
1096747916 12:53740183-53740205 ATGGGTGGGCACATTGCTGTTGG + Intergenic
1097346728 12:58501527-58501549 CTGGGTGGGCACAATCTAATTGG + Intergenic
1098394052 12:69999580-69999602 CTGAGGGGGCACAGTGAAGCTGG + Intergenic
1100023782 12:90102751-90102773 AAGGGTAGGCAAAGTGTAGTAGG + Intergenic
1101192661 12:102351191-102351213 CTGGGTGGGCACCATCTAATCGG - Intergenic
1101298217 12:103448933-103448955 CTGGGTAGGCACCTAGTAGTGGG - Intronic
1102236812 12:111298774-111298796 CAGGGTGGGCCCAGGGTAGGGGG + Intronic
1104358430 12:128109783-128109805 CTGGGTGGGCAGAGCTTAGGAGG - Intergenic
1105632041 13:22179144-22179166 CGGGGTGGGCAGAGTGAAATGGG - Intergenic
1107069749 13:36256946-36256968 CTGGGTAGGCACTGTGTGGCAGG + Intronic
1108609641 13:52071533-52071555 CTGGCTGGGGCCAGTGTTGTGGG - Intronic
1112206119 13:97324932-97324954 CTGGGTGGGCACCATCTAATCGG - Intronic
1112322892 13:98423153-98423175 CTGGGTGGGCACAACCTAATCGG - Intronic
1113795990 13:113058779-113058801 CTGAGTGGACACTGTGTATTTGG + Intronic
1113898546 13:113782761-113782783 CAGGTTGGGCACAGTTTGGTGGG + Intronic
1117222102 14:53616697-53616719 CTGGGTGGACACAATCTAATTGG - Intergenic
1118963584 14:70558623-70558645 ATGGGTGTGCACAGTGTTCTTGG + Intergenic
1119035944 14:71230920-71230942 CAGGGTGGGCACGATGCAGTTGG - Intergenic
1120272069 14:82325955-82325977 CTGGGTGGACATAGTGGTGTAGG + Intergenic
1120325276 14:83016390-83016412 CTGGGTAGGCACACAATAGTAGG - Intergenic
1121443054 14:93961013-93961035 CTAGGAGGTCACAGTCTAGTTGG + Intronic
1121749271 14:96334964-96334986 CTGGGAAGGCACAGTGTTGGAGG - Intronic
1122301848 14:100735865-100735887 CTGGGTGGGCAAAGAGGGGTGGG - Exonic
1122634843 14:103124946-103124968 CAGGATGGGGACAGGGTAGTGGG + Intronic
1122987487 14:105219233-105219255 CTGGGCGAGCACAGGGAAGTGGG + Intronic
1125834987 15:42741215-42741237 CTGGGTGAGGACAGGGAAGTAGG + Exonic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1127385054 15:58460399-58460421 CAGGGTGGGCACAGTTAAGGTGG + Intronic
1128662280 15:69510876-69510898 GTGGGTGGGCACCATGTAGTTGG + Intergenic
1130253459 15:82315218-82315240 CTGGGTGGACTCAGGGTAGGTGG - Intergenic
1130328505 15:82901201-82901223 CTGGATGGGCCCAGGGCAGTGGG + Intronic
1131514324 15:93067013-93067035 TTGAGTGGCCACAGTGTAGCAGG - Intronic
1132396573 15:101479369-101479391 CTGGGTGAGCACAGAGCAGTGGG + Intronic
1132864577 16:2087116-2087138 CTGGGTGGGCACAGTGTAGTTGG + Intronic
1133280192 16:4660767-4660789 CTGTGTGGACTCAGTGGAGTGGG + Intronic
1134425212 16:14135816-14135838 CTGGATGGGGCCAGTGTAGAGGG - Intronic
1134467161 16:14489735-14489757 GTGGGTGGGGAGAGTGTACTAGG + Intronic
1135859318 16:26040947-26040969 CTGAGTGTGCTCAGTGTACTTGG - Intronic
1136182674 16:28565177-28565199 ATGGGTGGGCACCGTCCAGTTGG - Intronic
1137887155 16:52118027-52118049 CTAGGTGGTCACAGTCTAGTGGG - Intergenic
1138845564 16:60561202-60561224 CTGGGTAGACACACAGTAGTGGG + Intergenic
1140231243 16:73119009-73119031 CAGGGTGGGCACTGTGTCCTGGG + Intergenic
1140495947 16:75388528-75388550 CTGGGGTGGCACAGAGTAGATGG - Intronic
1142121092 16:88387088-88387110 CTGGGTGGACACAGTCTTGGAGG - Intergenic
1142425344 16:89999594-89999616 CAGGGTGGGCAGAGCGTAGGTGG + Intergenic
1147170750 17:38617414-38617436 CTGGGAGGGCACACTGTCGCAGG - Intergenic
1147256597 17:39185560-39185582 CTGGGTGGGCACATAGTGGGGGG - Intronic
1147492599 17:40884295-40884317 CTGGGTGGAAACAGTGTGGCAGG - Intronic
1148108132 17:45130329-45130351 CAGGGAGTGCACAGTTTAGTGGG - Intronic
1148809808 17:50283243-50283265 CTGGGTGAGCACAGTGAATGGGG - Intergenic
1150272638 17:63876524-63876546 CTGGGAGGGCACTGTGCTGTGGG + Intronic
1150273977 17:63884273-63884295 CTGGGAGGGCACTGTGCTGTGGG + Intergenic
1150411138 17:64941326-64941348 ATGGGTGGGCAGTGTGTAGATGG + Intergenic
1150432583 17:65130203-65130225 TTGTGTGGGTACAGTGTAGGGGG + Intergenic
1150945040 17:69736026-69736048 CTGGGTAGGCACCCAGTAGTAGG + Intergenic
1151025786 17:70674741-70674763 CTGGGTGGGCTCAATGTATCTGG - Intergenic
1151490197 17:74428173-74428195 CTAGAAGGGCACAGTGTAATTGG + Intronic
1152953337 18:13323-13345 CAGGGTGGGCGCTGTGCAGTGGG - Intergenic
1153387304 18:4511671-4511693 CGGGGTGTGCACAGGGTAGTCGG - Intergenic
1153514119 18:5889629-5889651 TTGGGTGAGCACAGTGGGGTGGG + Exonic
1156372364 18:36483007-36483029 CTGTGTGGGCTCAGAATAGTGGG + Intronic
1157114607 18:44851316-44851338 CTGGATTGGCACAGAGAAGTGGG + Intronic
1158647997 18:59264654-59264676 CAGGGTGGTCCCAGTTTAGTTGG + Intergenic
1161962264 19:7529375-7529397 CTGGGTGGGCACAAAGGAGCAGG - Intronic
1162566296 19:11447194-11447216 CGGGGTGGGGGCAGTGTGGTGGG - Intronic
1163492750 19:17626512-17626534 CTGGGTGGTCACTGGATAGTTGG - Intronic
1166345033 19:42160200-42160222 CTGGGTGGGCAGAGTGGAGAAGG + Intronic
1166727023 19:45034561-45034583 CTGGGTGGGCAGAGGGTAAGTGG + Intronic
1166993954 19:46710467-46710489 CTGGCTGGGCACAGTGGGGGAGG - Intronic
1167745273 19:51347059-51347081 CTGGGGAGGGACAGTGTAGGAGG + Intronic
925518784 2:4716843-4716865 TTGGGTGGGCACAATCTAATCGG + Intergenic
926405105 2:12543462-12543484 GTGGGTGGGAACAGTGTTGCAGG + Intergenic
927487679 2:23499890-23499912 ATGGGTGGGAACAGAGGAGTAGG + Intronic
928627688 2:33157768-33157790 TTGGGTGGGCACAGGTCAGTGGG - Intronic
928979988 2:37127604-37127626 ATGAGTGGGCACAGAGCAGTGGG - Intronic
930186900 2:48420019-48420041 CTCGGTGAGCACAGGGCAGTGGG + Intergenic
931430998 2:62208947-62208969 CTGGGTGGGGGCAGTGGGGTGGG + Intronic
932396474 2:71452416-71452438 CTGGGTGGGGACACAGTGGTGGG - Intergenic
933097714 2:78208771-78208793 CTAGGTGGACACACAGTAGTGGG - Intergenic
933131845 2:78681921-78681943 CTGGGTGGGGAGAGGGGAGTGGG - Intergenic
933229309 2:79787813-79787835 CTAGGTGGGCCCAGTGTCATTGG - Intronic
936490025 2:112961952-112961974 CATGGTGGCCACGGTGTAGTTGG + Intergenic
938047925 2:128139895-128139917 ATAGGTGGGGACAGTGCAGTAGG + Intronic
938067006 2:128286843-128286865 CTGGGTGGGCACAGCTTTGCAGG - Intronic
938213356 2:129487264-129487286 TTGGGTGGGTACCGAGTAGTGGG - Intergenic
938299308 2:130198853-130198875 CTGGGTGGGAACAGGGAAGAGGG - Intergenic
938457407 2:131475684-131475706 CTGGGTGGGAACAGGGAAGAGGG + Intronic
939058204 2:137387922-137387944 CTGGGAGGCCACAGTGGTGTCGG - Intronic
941732523 2:168934238-168934260 CTGGGTGGGTGTAGTGGAGTGGG + Intronic
943151937 2:184124963-184124985 GTGGGTGGGCACAATCTAATTGG + Intergenic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
945075621 2:206036229-206036251 CTGGGTGGGTACCCGGTAGTGGG - Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946355773 2:219183390-219183412 CTGGGTGATCCAAGTGTAGTGGG + Exonic
1170257381 20:14360095-14360117 CTTGCTGGGCACAGGGTGGTGGG + Intronic
1176167490 20:63681707-63681729 TGGGGTGGGCACAGGGTGGTGGG + Intronic
1177242541 21:18478262-18478284 CTGGGTAGGGACGGTGTAGATGG - Intronic
1177943782 21:27442964-27442986 CTGGGTGGGCACCATCTAATCGG - Intergenic
1181527871 22:23500465-23500487 CTGGGTGGGGAGAGGGAAGTGGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1182551265 22:31102020-31102042 CTGTGTGGGCACTGGGGAGTTGG + Intronic
1183281351 22:36934296-36934318 CTGGGTGGGCACAGAGATGTGGG + Intronic
1183367906 22:37416946-37416968 CTGGCTGCGCACAGTGTTGGTGG - Intronic
1183510064 22:38229544-38229566 CTGGGTGGGGGCAGTGTGGTGGG - Intronic
953127250 3:40103171-40103193 CTAGGTGGGCACACTGTGGGAGG - Intronic
957633984 3:82758460-82758482 CTGGGTGGGCACAATCTAACTGG + Intergenic
962668945 3:137685448-137685470 CAAGTTGGTCACAGTGTAGTGGG - Intergenic
965435874 3:168650672-168650694 CTGTGGGGTCACAGTGTTGTGGG + Intergenic
967948722 3:194824104-194824126 CATGGTGGGCACAGGGTAGCGGG - Intergenic
968235030 3:197026409-197026431 CTGAGTGGGCACAGGCTAGGGGG + Intronic
972636134 4:40885879-40885901 CTGAGAGGGCCCAGTGTACTTGG + Intronic
972827319 4:42774728-42774750 CAGGGTGGGGAAAGTGTAGGAGG + Intergenic
974165305 4:58193747-58193769 CTGGGTGGATACCCTGTAGTGGG - Intergenic
974181358 4:58387614-58387636 CTGGGTGGGCACAATTTAATCGG + Intergenic
980234739 4:130090632-130090654 CCGGGTGGGCACAGGCTCGTCGG + Intergenic
980261366 4:130453075-130453097 CTGGGTGGGCAGCCTATAGTTGG - Intergenic
980831501 4:138134082-138134104 CTGGGTGGGACCACTGGAGTAGG + Intergenic
982181677 4:152753596-152753618 GTGGGTGGGCAAAGAGGAGTGGG + Intronic
984616893 4:181908406-181908428 TTGCATGAGCACAGTGTAGTTGG - Intergenic
985536006 5:466077-466099 CCGGGTGGGGACAGTGGGGTGGG + Intronic
985912994 5:2897573-2897595 GTGGGTGGGCAGAGGGGAGTTGG - Intergenic
986235339 5:5904463-5904485 CTGGGTGGGCACCATCTAATCGG + Intergenic
986422757 5:7600709-7600731 CTGGCTGGGCACAGTGCAGGTGG + Intronic
986962413 5:13231195-13231217 CTGGATGGGCACTGTTTAGTGGG - Intergenic
988492635 5:31717779-31717801 CTGGGAGGGGACAGTGCAGGAGG + Intronic
989279325 5:39622497-39622519 TTGGGTGGGCACAGAGGAATGGG - Intergenic
992048844 5:72925549-72925571 CTGGGTGGGCACAGGGTCCACGG + Intergenic
994079256 5:95688055-95688077 TTGGGTGGACACATGGTAGTGGG - Intronic
994369635 5:98953625-98953647 CTGGGTGGGCACCATCTAATCGG - Intergenic
994805131 5:104436773-104436795 CTGGGTGGGCACCATCTAATCGG + Intergenic
997523336 5:134537196-134537218 ATGGGTGGGCACAGTGGAGGGGG - Intronic
997629317 5:135354701-135354723 GTGGGTGGGCACAGAGTCGGGGG + Intronic
997696133 5:135862541-135862563 CAGGGTGTCCACAGTCTAGTGGG + Intronic
1000296484 5:159916973-159916995 CTGGTTGGGGCCAGTGAAGTTGG - Exonic
1001136827 5:169109483-169109505 GAGTCTGGGCACAGTGTAGTTGG - Intronic
1002261937 5:177999313-177999335 CTGGATGAGCACAGTGTGCTAGG - Intergenic
1004374040 6:15076374-15076396 CTGGGAGGGCACAGTCCAGCTGG + Intergenic
1008774906 6:55026605-55026627 CTGGGTAGACACCCTGTAGTAGG + Intergenic
1009735897 6:67675357-67675379 CTGGGAGGGAACGGTGTGGTGGG + Intergenic
1011090747 6:83596199-83596221 CTGGCTGGGCATAGTGCTGTAGG - Intronic
1013327981 6:109067312-109067334 CAGGGTGGGCACTGTGCAGGAGG - Intronic
1016116345 6:140290582-140290604 GTGGGTGGGGACAGGGTAGTTGG - Intergenic
1016907523 6:149166581-149166603 CTGGGTGGTCCCAGTGCAGATGG + Intergenic
1018530707 6:164759882-164759904 CTGGGTGGGCACAATCCAATTGG + Intergenic
1018995087 6:168704358-168704380 CTCGGGGGGCACAGTGAAGCCGG + Intergenic
1019279883 7:194184-194206 CTGGGTGGGCACCTTGGAGAAGG + Intronic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1020187737 7:5971686-5971708 CTGGGTGGGCCCAGTCCATTGGG - Intergenic
1020295179 7:6753084-6753106 CTGGGTGGGCCCAGTCCATTGGG + Intergenic
1021578737 7:22129875-22129897 CAGCTTGGGAACAGTGTAGTTGG - Intronic
1024193011 7:47031594-47031616 GTCGGTGGGCACAGCATAGTAGG + Intergenic
1024578101 7:50781361-50781383 CTGGGTGGGAACAGGGGAGGTGG - Intronic
1025190587 7:56892834-56892856 CTGGGTGTGCACAGTGTGGATGG + Intergenic
1025681365 7:63684142-63684164 CTGGGTGTGCGCAGTGTGGATGG - Intergenic
1027467849 7:78537348-78537370 CTGGGTAGGTACTGAGTAGTGGG + Intronic
1027619847 7:80470994-80471016 CTGGGTGGGCACAAGCTAATCGG + Intronic
1031009025 7:116504622-116504644 CTGGGTGGGCATAAGGGAGTAGG - Intronic
1031129372 7:117813684-117813706 CTTGGTGGGCTCAGTGGAGGTGG - Intronic
1033136124 7:138785997-138786019 CTGGGAGGGCTCAGTGTCCTAGG - Intronic
1034060312 7:148081403-148081425 CTGGGTGGGCACCATCTAATCGG + Intronic
1035673281 8:1436430-1436452 CTGGGTGGGCACCATCTATTCGG - Intergenic
1036248328 8:7140074-7140096 CTGGGTGGGTACAGTGGTATAGG + Intergenic
1037669108 8:20999056-20999078 CTGGGTGGGCACAATCTAATAGG + Intergenic
1039156505 8:34564506-34564528 ATGGGTGGGCACCATGCAGTTGG + Intergenic
1039891152 8:41686355-41686377 CTGGGTGGGCACTGGGGCGTGGG + Intronic
1041131546 8:54707402-54707424 CTGTCTGGGCACAGTGTCTTAGG - Intergenic
1041310636 8:56512919-56512941 ATGGGCGGGGACAGTGCAGTGGG - Intergenic
1047350914 8:124072719-124072741 CAGGGAAGTCACAGTGTAGTTGG + Intronic
1048536039 8:135295580-135295602 GTGGGAGGGCACAGAGTAGGAGG - Intergenic
1049172740 8:141172026-141172048 GTGGGTGTGCACAGTGTCTTGGG + Intronic
1049708211 8:144052391-144052413 CTGGGTGGGCAGGCTGGAGTAGG - Intronic
1051646963 9:19278857-19278879 CTGGGGGGGCAGAGTGGAGGGGG - Intronic
1052814816 9:33093791-33093813 CTGGGTGGGGACTGTGTGGTGGG + Intergenic
1053095833 9:35327589-35327611 GTGGGTGGGCACAATCTAATTGG - Intronic
1055486250 9:76759409-76759431 CTGTGTGGGCACAGGATAGCAGG - Intronic
1055936263 9:81607372-81607394 GTGGGTGGGCACAGTTAAATTGG - Intronic
1058309486 9:103483771-103483793 CTGGGTGGGCACAGGCTCGTCGG + Intergenic
1058976935 9:110133651-110133673 CGGGGTGGGCGGAGGGTAGTGGG - Intronic
1060779423 9:126400612-126400634 CAGGGAGGGCACAGAGCAGTGGG + Intronic
1061567657 9:131454241-131454263 CTGTGTGAACACAGTGTGGTAGG - Intronic
1062397398 9:136357991-136358013 CTGGGTGGACACAGTGCAGTTGG - Intronic
1062462739 9:136668682-136668704 CTGGGTGAGCTCGGTGTGGTGGG - Intronic
1185934052 X:4235767-4235789 CTGGGTAGATACACTGTAGTGGG + Intergenic
1185990459 X:4889431-4889453 GTGGGTGGGCACAATCCAGTTGG + Intergenic
1186032455 X:5384632-5384654 CTGGGTGGGCACCATCTAATCGG - Intergenic
1187425117 X:19170661-19170683 CAGGCTGGGCACAGTGGAGCAGG + Intergenic
1187485886 X:19703043-19703065 CAGTGTGGGCATAGTGGAGTTGG - Intronic
1188157887 X:26763794-26763816 AAGTGGGGGCACAGTGTAGTTGG - Intergenic
1188681825 X:33017756-33017778 CTGAGTGGGCTCAGTGTGGGTGG - Intronic
1192502140 X:71661215-71661237 CAGGGTGGGAACAGTGCAGGTGG - Intergenic
1194180126 X:90700654-90700676 CTGGGTGGGCACCATCCAGTAGG - Intergenic
1194383284 X:93222101-93222123 CTGGGTGGCCTCAGTGTGTTTGG + Intergenic
1194685490 X:96908932-96908954 CTGGGAGGGCACAGTATGGTTGG + Intronic
1195630323 X:107049065-107049087 CTAGGTTGGCACAGGGTTGTGGG + Intergenic
1196818602 X:119685343-119685365 CTGGGTGGGGAGAGAGTCGTAGG - Intronic
1196859865 X:120016497-120016519 CTGGGTGGGCACTGTGGACTTGG + Intergenic
1198666645 X:139031447-139031469 TTAGGTGGGCACAGAGTAGGTGG - Intronic
1200526783 Y:4282822-4282844 CTGGGTGGGCACCATCCAGTAGG - Intergenic
1201437909 Y:13979233-13979255 CTGGGTGGGCACCATCCAGTTGG - Intergenic
1201666498 Y:16462722-16462744 TGTGCTGGGCACAGTGTAGTAGG - Intergenic