ID: 1132865420

View in Genome Browser
Species Human (GRCh38)
Location 16:2090694-2090716
Sequence AGGCTACCCCGAGCACCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132865409_1132865420 18 Left 1132865409 16:2090653-2090675 CCCGGCCGCGCAGTCACCTACCA 0: 1
1: 0
2: 0
3: 9
4: 66
Right 1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1132865412_1132865420 13 Left 1132865412 16:2090658-2090680 CCGCGCAGTCACCTACCAGGATG 0: 1
1: 0
2: 1
3: 2
4: 86
Right 1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1132865407_1132865420 22 Left 1132865407 16:2090649-2090671 CCTCCCCGGCCGCGCAGTCACCT 0: 1
1: 0
2: 3
3: 13
4: 186
Right 1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1132865416_1132865420 2 Left 1132865416 16:2090669-2090691 CCTACCAGGATGGCCAGCTGGGC 0: 1
1: 0
2: 1
3: 10
4: 218
Right 1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1132865410_1132865420 17 Left 1132865410 16:2090654-2090676 CCGGCCGCGCAGTCACCTACCAG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1132865408_1132865420 19 Left 1132865408 16:2090652-2090674 CCCCGGCCGCGCAGTCACCTACC 0: 1
1: 0
2: 1
3: 3
4: 53
Right 1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1132865406_1132865420 23 Left 1132865406 16:2090648-2090670 CCCTCCCCGGCCGCGCAGTCACC 0: 1
1: 0
2: 3
3: 17
4: 246
Right 1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1132865417_1132865420 -2 Left 1132865417 16:2090673-2090695 CCAGGATGGCCAGCTGGGCGTAG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132865420 Original CRISPR AGGCTACCCCGAGCACCACC AGG Exonic
900138195 1:1127686-1127708 GGGCTACGCCCAGCCCCACCCGG + Intergenic
900739001 1:4319145-4319167 GGGCTTCCCCGAGCTCCCCCAGG + Intergenic
902642757 1:17777270-17777292 AGCCTCCCCGGAGCGCCACCTGG + Intronic
903354380 1:22737207-22737229 AGTCTACCCCCTGCCCCACCTGG + Intronic
903680487 1:25093185-25093207 AGGCCACCCCGGGCCTCACCTGG + Intergenic
905497463 1:38403798-38403820 AGGCTTGCCCTAGCATCACCTGG - Intergenic
905626278 1:39492135-39492157 CGGGTAGCCCGAGCACCGCCAGG - Exonic
906743323 1:48204151-48204173 AAGCCACCCCTAGCCCCACCTGG + Intergenic
912686813 1:111774474-111774496 ATGCTGCCCCCAGCTCCACCAGG + Intronic
916108595 1:161447789-161447811 AGGCCGCCCCGCGCCCCACCGGG + Intergenic
916110183 1:161455170-161455192 AGGCCGCCCCGCGCCCCACCGGG + Intergenic
916111768 1:161462580-161462602 AGGCCGCCCCGCGCCCCACCGGG + Intergenic
916113355 1:161469961-161469983 AGGCCGCCCCGCGCCCCACCGGG + Intergenic
916323190 1:163528918-163528940 AGGCTGCCGCTATCACCACCTGG - Intergenic
918463736 1:184801085-184801107 AGCCTTCCCCCAGCACCACCAGG - Intronic
922766233 1:228158043-228158065 GGGCTACGCCGTGCACCGCCTGG + Exonic
1067037765 10:42932475-42932497 AGGCTACCCCGAGTGCCGCCAGG - Intergenic
1067472975 10:46549518-46549540 TGGCCACACCGAGCACCTCCAGG + Exonic
1071506092 10:86232511-86232533 AACCTACCCCCACCACCACCTGG + Intronic
1076165548 10:128279583-128279605 AGGCTGCCCAGGGAACCACCTGG - Intergenic
1077517747 11:3012061-3012083 AGGCTGCCCCGTGCACCACAGGG - Intronic
1078456506 11:11479998-11480020 CTGCTACCCCAAGCCCCACCAGG + Intronic
1081549127 11:44095992-44096014 AGGCCACCCCCAGCCCCGCCGGG + Intronic
1082834471 11:57641352-57641374 AGGCTACCCAGATTCCCACCAGG - Intergenic
1084966820 11:72749149-72749171 AGGCTGCCTCGGTCACCACCCGG + Intronic
1094204288 12:27824265-27824287 AGACTGCCCCAAGCCCCACCTGG - Intergenic
1103005330 12:117416269-117416291 AGGTGACCCCCAGCATCACCAGG + Intronic
1104502448 12:129299227-129299249 AGGCTGACCCCAGCACCTCCAGG - Intronic
1104831563 12:131755866-131755888 AGGACACCCCCAGCACCAGCTGG - Intronic
1106365415 13:29074329-29074351 AGGGGATCCCTAGCACCACCCGG - Intronic
1115417139 14:33148966-33148988 AGGATACCCCGCGAGCCACCGGG + Intronic
1115812391 14:37124127-37124149 AGACTACCCTGAGCAACACAGGG - Intronic
1123765795 15:23477509-23477531 AGTCCACCCAGTGCACCACCTGG - Intergenic
1125833476 15:42731791-42731813 ACGGTGCCCCCAGCACCACCAGG + Exonic
1127588344 15:60398221-60398243 AGGCTGCCCCGAGGCCCACAGGG + Intronic
1129741298 15:77990913-77990935 TGCCTTCCCTGAGCACCACCTGG - Intronic
1130253573 15:82315654-82315676 AGGCTGCCCAGACCACCACGAGG - Intergenic
1130257433 15:82332293-82332315 CGCCTTCCCTGAGCACCACCTGG - Intergenic
1130597512 15:85257672-85257694 CGCCTTCCCTGAGCACCACCTGG + Intergenic
1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG + Exonic
1137408832 16:48210941-48210963 AGGCTACCTTGGACACCACCAGG + Exonic
1137587791 16:49674552-49674574 AGTCCACCCCCTGCACCACCAGG + Intronic
1141281028 16:82629586-82629608 AGGCTTGCCTGAACACCACCAGG - Intronic
1143200775 17:5111763-5111785 CGGCTTCCCCGAGGTCCACCTGG - Intronic
1147337875 17:39738172-39738194 AGGCAACCCCCAGCCGCACCAGG + Intronic
1151474773 17:74339249-74339271 AGGGTAGCCGGAGCACCAGCTGG + Intronic
1152941553 17:83175443-83175465 AGGAGACTCCGAGCACAACCTGG - Intergenic
1154312397 18:13277394-13277416 AGGATACCCGGCGCTCCACCTGG + Intronic
1159245222 18:65797082-65797104 AGGCCACCACTAACACCACCTGG - Intronic
1161325583 19:3662127-3662149 AGGCAGCCCCGGGGACCACCAGG - Intronic
1162058608 19:8081012-8081034 CGGCTTCACCCAGCACCACCAGG - Exonic
1163008229 19:14409492-14409514 AGGCTGCAGGGAGCACCACCAGG - Intronic
1163639019 19:18451120-18451142 AGGCCACCCTGAGCGGCACCTGG - Intronic
1163849480 19:19655126-19655148 CGGCCACACCGCGCACCACCAGG + Exonic
1166851918 19:45765342-45765364 ATACAACCCCCAGCACCACCAGG + Exonic
927200374 2:20574689-20574711 TGGCTTCCCCCAGCAGCACCCGG + Intronic
929576955 2:43057932-43057954 AGGCTTGCCGCAGCACCACCTGG - Intergenic
934307730 2:91840684-91840706 GGGCTACCCGGAGCAGGACCTGG + Intergenic
934845909 2:97661236-97661258 AGGCTAGCCCGAGCCCGGCCTGG - Intronic
942379312 2:175371692-175371714 ACCCTACCCCCAGCCCCACCAGG - Intergenic
1174039226 20:47687248-47687270 CGTCGACCCCAAGCACCACCCGG - Intronic
1175912781 20:62412709-62412731 AGGCCACTACGAGCACGACCGGG - Exonic
1180312788 22:11253218-11253240 AGGCGGCCCCGAGCGGCACCTGG + Intergenic
1180342457 22:11629154-11629176 AGGCGGCCCCGCGCAGCACCTGG - Intergenic
1182621773 22:31622393-31622415 AGGATACCCTGAGCACCAACAGG + Intronic
1184792094 22:46706393-46706415 AGGCTCCCCCGAGATCCAGCGGG + Intronic
1185213130 22:49583187-49583209 AGGCCACCGTGAGCCCCACCAGG - Intronic
950524839 3:13517597-13517619 AGGCCACCCAGTGCACAACCTGG - Intergenic
950723572 3:14901306-14901328 AGGCCACCCCCATCAGCACCTGG + Intronic
956600542 3:71016376-71016398 ACTCTTCCCCGAGCACCACATGG - Intronic
961213187 3:125141353-125141375 AGGCTCCCACGAGCACCCCTTGG - Intronic
961678206 3:128581145-128581167 GGGCGACCCCGAGGAACACCTGG - Intergenic
963787353 3:149548365-149548387 AGGCTGCCCAGAGCACCTCCTGG + Intronic
969629895 4:8329991-8330013 GGGCTTCCCCATGCACCACCCGG - Intergenic
972247146 4:37257108-37257130 AGGCCACAGCCAGCACCACCTGG + Intronic
975506332 4:75142792-75142814 AGGCTACCCCGGAAACCAACTGG + Intergenic
981724126 4:147830019-147830041 AGTCTGCCCCCAGCACCCCCAGG - Intronic
1001403184 5:171458554-171458576 AGGCTACCTCCTGCCCCACCAGG - Intergenic
1001417414 5:171555700-171555722 AGCCTAGCCCGACCTCCACCAGG + Intergenic
1001758113 5:174186283-174186305 AGGCTGCCCCGAGGACCCCCCGG + Intronic
1002103634 5:176869386-176869408 TGGCTACCCCGAGTGCCCCCTGG + Intronic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1011728448 6:90234833-90234855 AGGCTGCCTCTAGCACCATCTGG - Intronic
1013514800 6:110875580-110875602 AGGCGCCCCCGACCCCCACCTGG - Intronic
1016437142 6:144048642-144048664 AGGCTACACAGAGCAGCATCAGG + Intronic
1017900958 6:158718209-158718231 AGGGTACCCTGAGCCCCACAAGG + Exonic
1019360596 7:602458-602480 AGGCTCCCGGGAGCCCCACCTGG - Intronic
1027457803 7:78415639-78415661 AGCCATCCCCAAGCACCACCAGG + Intronic
1028754522 7:94420263-94420285 GGGCTTCCCCGAGGACCAGCAGG - Exonic
1033256371 7:139805102-139805124 AGGACACCCCCAGCACCACCAGG - Intronic
1034429449 7:151033890-151033912 CGGCTACCCCCAGGACCAGCAGG - Exonic
1037217240 8:16470894-16470916 AGGCCAGCCTGAGCACCACAGGG + Intronic
1048840693 8:138563270-138563292 TGGCTACCCAGAGAACAACCAGG - Intergenic
1049956170 9:695188-695210 AAGCCACCCAGAGCACCTCCAGG - Intronic
1052308952 9:27043143-27043165 AGGCTACACCCAGCACCAATAGG - Intronic
1055806080 9:80095299-80095321 AGGCTACCCAGAGCTACTCCTGG + Intergenic
1061529369 9:131198191-131198213 AGGCTACCCCAGCCACCACGGGG + Exonic
1062289596 9:135788614-135788636 AGGCTTCACCGAGCTCCTCCCGG - Intronic
1185805262 X:3051060-3051082 AGGCTCTCCCCAGCCCCACCAGG - Intronic
1187727540 X:22219293-22219315 AGTCTACCCCGATCACCAATGGG - Intronic
1187895135 X:23973584-23973606 AGGCTACCACAAGAACCAACCGG + Intergenic
1187913859 X:24134861-24134883 AGGCTACCACAAGAACCAACCGG + Intergenic
1190060105 X:47205305-47205327 AGACTCCCCCAACCACCACCAGG - Intronic
1201276008 Y:12299544-12299566 AGGCTCTCCCCAGCCCCACCAGG + Intergenic