ID: 1132867361

View in Genome Browser
Species Human (GRCh38)
Location 16:2100117-2100139
Sequence CCACCCTGCCCAACCTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1166
Summary {0: 7, 1: 1, 2: 9, 3: 107, 4: 1042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132867356_1132867361 5 Left 1132867356 16:2100089-2100111 CCGCACTGCAGGAGGCCACGGGG 0: 7
1: 0
2: 0
3: 31
4: 274
Right 1132867361 16:2100117-2100139 CCACCCTGCCCAACCTCCCACGG 0: 7
1: 1
2: 9
3: 107
4: 1042
1132867359_1132867361 -10 Left 1132867359 16:2100104-2100126 CCACGGGGCAGGACCACCCTGCC 0: 7
1: 1
2: 3
3: 24
4: 263
Right 1132867361 16:2100117-2100139 CCACCCTGCCCAACCTCCCACGG 0: 7
1: 1
2: 9
3: 107
4: 1042
1132867351_1132867361 23 Left 1132867351 16:2100071-2100093 CCTAGAAGGCAGGGAGGGCCGCA 0: 7
1: 0
2: 0
3: 34
4: 232
Right 1132867361 16:2100117-2100139 CCACCCTGCCCAACCTCCCACGG 0: 7
1: 1
2: 9
3: 107
4: 1042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132867361 Original CRISPR CCACCCTGCCCAACCTCCCA CGG Intronic
900197719 1:1385532-1385554 CCACCGCGCCCGGCCTCCCACGG + Intergenic
900197732 1:1385576-1385598 CCACCGCGCCCGGCCTCCCACGG + Intergenic
900423774 1:2567092-2567114 CCACCCACCTCAGCCTCCCAAGG + Intergenic
900656623 1:3761951-3761973 ACCCCATGCCCAACCTCGCAGGG - Intronic
900856035 1:5184955-5184977 CCACCCACCTCAGCCTCCCAAGG - Intergenic
900867630 1:5279779-5279801 CCACCCACCTCAGCCTCCCAAGG + Intergenic
900992553 1:6104623-6104645 CCCCCCAGCCCACCCTCCCTGGG + Exonic
901236479 1:7670059-7670081 CCACCCTCAGGAACCTCCCAGGG - Intronic
901583927 1:10270679-10270701 CCACCCGCCTCAGCCTCCCATGG - Intronic
901605140 1:10453393-10453415 CCACCCAGCTCGGCCTCCCAAGG - Intergenic
901606328 1:10462143-10462165 CCACCGCGCCCAGCCTGCCATGG + Intronic
901827483 1:11871767-11871789 CCACCGTGCCCGACCAGCCATGG + Intergenic
901873615 1:12153198-12153220 CCACCCTGCCCAAGCTCCTGCGG + Intergenic
901907513 1:12426771-12426793 CCACCCGCCTCAGCCTCCCAAGG - Intronic
901936306 1:12629558-12629580 CCCTCCTCCCCAACCTGCCAAGG - Intergenic
902048367 1:13542691-13542713 CCAACCTGGCCAACATACCAAGG - Intergenic
902106477 1:14040472-14040494 CCACCGTGCCCAGCCTAGCAAGG - Intergenic
902401059 1:16157013-16157035 CCCGCCTGCCCAGCCACCCACGG + Intergenic
902432094 1:16371297-16371319 CCACCCGCCTCAGCCTCCCAAGG + Intronic
902590130 1:17468073-17468095 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
902730058 1:18363374-18363396 CCACCCTGCCCCAGGTCGCAAGG - Intronic
902827673 1:18988162-18988184 CCACCCGGCCCAGATTCCCAGGG - Intergenic
903079070 1:20794559-20794581 CCACCCACCTCAGCCTCCCAAGG - Intergenic
903224164 1:21885483-21885505 CCACCCCGTCCATCCTCCCTGGG + Intronic
903342606 1:22663877-22663899 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
903579240 1:24358481-24358503 CCACCCTGCCCAGCGTCCCCAGG - Exonic
903656375 1:24950962-24950984 CCACCCACCTCAGCCTCCCAAGG - Intronic
903781590 1:25823446-25823468 ACACCCTGGCCAGCCACCCAAGG - Intronic
903937396 1:26905901-26905923 CCACCCACCTCCACCTCCCAAGG - Intronic
903969535 1:27109777-27109799 CCAGCCTGCACACCCTCCCCAGG - Exonic
903992209 1:27281172-27281194 CCACCGCGCCCAGCCTCACACGG - Intronic
904017660 1:27435231-27435253 CCACCATGCCCAGCCTATCATGG + Intronic
904028612 1:27520292-27520314 TCACTCTGCCCAACCCCACAGGG - Intergenic
904376544 1:30085648-30085670 CCACCCTCCCCACCCTGCCCTGG - Intergenic
904500640 1:30910785-30910807 CCTCCCTGCCCATCTCCCCAAGG - Intergenic
904516695 1:31061328-31061350 CCACCGTGCCCAACCTCCATTGG - Intronic
904552658 1:31332863-31332885 CCACCCGGCTCAGCCTCCGAAGG + Intronic
904646430 1:31970715-31970737 CCACCCATCTCAGCCTCCCAAGG + Intergenic
904759319 1:32790263-32790285 CCACCCACCTCAGCCTCCCAAGG - Intronic
905018891 1:34795039-34795061 CCACCATGCCCCACCTACAATGG + Exonic
905071309 1:35228189-35228211 CTACCCACCTCAACCTCCCAAGG - Intergenic
905253309 1:36664173-36664195 CCACCCTCCCCATGGTCCCAGGG - Intergenic
905459639 1:38114181-38114203 CCACCCTGGCCAACCACCAAGGG - Intergenic
905469671 1:38182378-38182400 CCGCCCACCTCAACCTCCCAAGG - Intergenic
905604627 1:39286706-39286728 CCACCCACCTCAGCCTCCCAAGG + Intronic
905811558 1:40917020-40917042 CCCTCCTGCCCAGCCTCCCTTGG - Intergenic
906047803 1:42846258-42846280 CCAACCTACACAACCTCCAAGGG - Intergenic
906100135 1:43255003-43255025 CCACCATGCCCAGCCTCTGAGGG + Intronic
907242256 1:53087365-53087387 ACATCCAGGCCAACCTCCCATGG - Exonic
907679170 1:56547689-56547711 CCACCCTGCCCAGCTGCCCAAGG + Intronic
908019631 1:59886598-59886620 CCACCCACCCCATCCTACCAGGG - Intergenic
908380992 1:63596498-63596520 CCACCCTCCTCGGCCTCCCAAGG + Intronic
908487243 1:64606804-64606826 CTACCCTGCCCACCATCCAATGG - Intronic
908892587 1:68863319-68863341 CCCCACTGCTCAACCTCCTAGGG + Intergenic
909505629 1:76386563-76386585 CTACCCTGTCCAAGCTCTCAGGG - Intronic
909864802 1:80654082-80654104 CCACCGTGCCCAACCTCTACTGG + Intergenic
910407884 1:86909760-86909782 CCACCCGCCTCAGCCTCCCAAGG - Intronic
910421619 1:87070345-87070367 CCTCCCTCCTCAGCCTCCCAAGG - Intronic
910614023 1:89177530-89177552 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
910773992 1:90856622-90856644 CCCCCCACCCCCACCTCCCAGGG + Intergenic
911364857 1:96925814-96925836 CCAGTCTGCCCAACCCACCAGGG + Intergenic
912323101 1:108733059-108733081 CCATCATGCCCAGCCACCCATGG + Intronic
912503813 1:110141883-110141905 CCCCCTTGCCCAAACTCCAAAGG - Intergenic
912612507 1:111062529-111062551 CCACCCGTCCCCACCTGCCATGG + Intergenic
912811560 1:112799007-112799029 CCACCCTGTCCTACCTCAGATGG + Intergenic
913260319 1:116991843-116991865 CTTCCCTGCGCAGCCTCCCATGG - Intergenic
913509900 1:119551971-119551993 CCATACAGCCCAACCTCCCATGG + Intergenic
914445071 1:147743393-147743415 CCACCATGCCCAGCCTGTCATGG - Intergenic
914785485 1:150825605-150825627 CCACCCACCTCAGCCTCCCAAGG - Intronic
914860440 1:151381585-151381607 CCATGCTGCAGAACCTCCCAGGG + Intergenic
914886413 1:151588160-151588182 CCACCCTCCTCGGCCTCCCAGGG - Intergenic
914909271 1:151771129-151771151 TCACCCTGCCCTCCCTCCCTTGG + Exonic
915027240 1:152842586-152842608 GCAACCCGCCCAGCCTCCCAAGG + Intergenic
915151051 1:153831796-153831818 CTACTCTGCCCAACTTACCATGG - Intronic
915187882 1:154122813-154122835 CCACCCACCTCAGCCTCCCAAGG - Intronic
915347747 1:155206569-155206591 CCACCTGCCTCAACCTCCCAAGG - Intronic
915413808 1:155724390-155724412 CCACCCGTCTCAGCCTCCCAAGG - Intronic
916058491 1:161083748-161083770 CCACCCTGGCCAGGCCCCCACGG + Intronic
916098638 1:161374106-161374128 CCACCGCGCCCGGCCTCCCATGG + Exonic
917415468 1:174804598-174804620 CCACCGTGCCCGGCCTCCCTCGG + Intronic
917450840 1:175146123-175146145 CCACCCTCCCCAGCTTCCCTGGG - Intronic
917665603 1:177222553-177222575 CCACCCACCTCAACCTCCCAAGG + Intronic
918225457 1:182477299-182477321 CCACCAGACCCACCCTCCCATGG + Intronic
918243532 1:182640401-182640423 GCACCCTGCCCGTCCTTCCAGGG - Intergenic
918251407 1:182706707-182706729 CCACCCACCTCAGCCTCCCAAGG + Intergenic
918977656 1:191511710-191511732 CCACCCACCTCAGCCTCCCAAGG + Intergenic
920386720 1:205575100-205575122 CCAGCCTGCCCTAGCTCCCAGGG + Intronic
920444176 1:206003079-206003101 CCACCCTGGAGAAGCTCCCAGGG - Intronic
920561802 1:206944229-206944251 CCACCCACCTCAGCCTCCCAAGG - Intronic
920563955 1:206959194-206959216 CCACTCTGCCCAAACTGCCTTGG - Intronic
921672991 1:217946863-217946885 CCTCCCTGCTCCATCTCCCACGG - Intergenic
921865767 1:220086515-220086537 CCACCCTCCTCGGCCTCCCAAGG + Intronic
922019800 1:221691975-221691997 CCACCCACCTCAGCCTCCCAAGG - Intergenic
922236032 1:223723460-223723482 CCCCCCTTACCAGCCTCCCAGGG + Intronic
922450017 1:225729365-225729387 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
922455681 1:225771754-225771776 CCACCATGCCCAACCTTCTTAGG + Intergenic
922719109 1:227891340-227891362 CGGCCTTGCCCAGCCTCCCACGG - Intergenic
922782352 1:228263450-228263472 CCTCCCAACTCAACCTCCCAAGG - Intronic
922986089 1:229866896-229866918 CCACCCTGCCCAGCCTGGCCTGG - Intergenic
923090278 1:230735520-230735542 CCCCCCTGCCCAACCCCACTTGG + Intergenic
923282825 1:232461191-232461213 CCTTCCTGCCCAAGCTGCCATGG + Intronic
923297183 1:232605302-232605324 CCACTGTGCCCAGCCACCCAAGG + Intergenic
923374996 1:233352672-233352694 CCACCCACCTCAGCCTCCCAAGG + Intronic
923824452 1:237484362-237484384 CCACCATGCCCCACCCCCCATGG - Intronic
924058945 1:240152056-240152078 CCACCATGCCCGGCCTCCAATGG + Intronic
924175981 1:241391449-241391471 CCACCCAGCCCAAGGTCACACGG + Intergenic
924193236 1:241578141-241578163 CCACCCTTACCAAACTTCCATGG + Intronic
924355629 1:243172389-243172411 CCACCCGCCTCAGCCTCCCATGG - Intronic
924761928 1:246995584-246995606 CCACCCACCTCAGCCTCCCAAGG - Intronic
1063590146 10:7387641-7387663 CCACCATGCCCATCCTCCTTTGG - Intronic
1064003410 10:11681971-11681993 CCACCATGCCCAGCCTTCCCCGG - Intergenic
1064127141 10:12672612-12672634 CCACCCACCTCAGCCTCCCAAGG + Intronic
1064261996 10:13793448-13793470 CCACCATGCCCAGCCTACCATGG + Intronic
1064660797 10:17605708-17605730 CCACCCACCTCAACCTTCCAAGG - Intronic
1064720261 10:18221568-18221590 CCTCCCACCCCAGCCTCCCAAGG - Intronic
1064836077 10:19532495-19532517 CCACCCACCTCAGCCTCCCAGGG + Intronic
1065347324 10:24760857-24760879 CCTCCCTCCTCAGCCTCCCAAGG - Intergenic
1065521348 10:26576293-26576315 CCACCGTGCCCAGCCTCTTATGG - Intergenic
1065587576 10:27234642-27234664 CCACCATGCCCAGCCTTCCCAGG - Intronic
1065605925 10:27417824-27417846 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1066292698 10:34028638-34028660 CCACCCACCTCAGCCTCCCAGGG - Intergenic
1066297501 10:34067624-34067646 CCACCCTGCTCACCCTCCATAGG - Intergenic
1066490874 10:35893364-35893386 CCACCGTGCCCAGCCTGACATGG - Intergenic
1066686411 10:37985913-37985935 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1066957653 10:42188344-42188366 CCACCCTGCCTTCTCTCCCACGG + Intergenic
1067054283 10:43042125-43042147 CCAACCTGCCCATGTTCCCAAGG - Intergenic
1067484046 10:46629300-46629322 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1067523543 10:47025524-47025546 CCACCCTGCCGCACCACACAGGG - Intergenic
1067527525 10:47047433-47047455 TCCTCCTGCCCCACCTCCCATGG - Intergenic
1067610713 10:47712344-47712366 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1068289573 10:54985024-54985046 ACACCCTTTCCACCCTCCCAGGG + Intronic
1068536842 10:58249327-58249349 CCTCCCACCCCAGCCTCCCAGGG + Intronic
1068757765 10:60673593-60673615 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1069027789 10:63562498-63562520 CCATCCCCCTCAACCTCCCAAGG + Intronic
1069381117 10:67843893-67843915 CCACCCTCCTCAGCCTCCCAAGG + Intergenic
1069387006 10:67892843-67892865 CCACCCTCCTCGGCCTCCCAAGG + Intronic
1069863211 10:71484031-71484053 CCACCATTCCACACCTCCCACGG + Intronic
1069886356 10:71626379-71626401 CCACCCTGTCCATCCCCACACGG - Intronic
1070228028 10:74532208-74532230 CCACCATGCCCAGCCTCCGAGGG - Intronic
1070275088 10:74998236-74998258 CCACCGTGCCCAGCCTCCAATGG + Intronic
1070742627 10:78912877-78912899 CCACCCTTCCCACCCTCCTTCGG - Intergenic
1070751020 10:78963988-78964010 CCACCCTGCCCTGCCTCCCAGGG + Intergenic
1070802096 10:79249835-79249857 CCTCCCTGCCCAACTACCCGGGG + Intronic
1070911623 10:80123884-80123906 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1071615206 10:87069271-87069293 CCGCCCTCCTCAGCCTCCCAAGG - Intronic
1071626129 10:87172597-87172619 CCACCCACCTCAGCCTCCCAAGG - Intronic
1072149091 10:92671118-92671140 CCTCCCACCCCAGCCTCCCAAGG + Intergenic
1072532180 10:96329932-96329954 CCATCCTTCCCATCCTCCCCAGG - Intronic
1073063077 10:100743842-100743864 CCAACCTGCCTAGCCACCCAAGG + Intronic
1073217305 10:101843597-101843619 CCACCCGGCGCCCCCTCCCACGG - Intronic
1073373380 10:103010854-103010876 CCACTCCCCCCAGCCTCCCAGGG + Intronic
1074037691 10:109757318-109757340 CCAGCGCGCCCAGCCTCCCAGGG + Intergenic
1074139544 10:110659920-110659942 CCTCCCACCTCAACCTCCCAAGG + Intronic
1074279728 10:112039542-112039564 ACACCCTTCCCAGCCTCCCCAGG + Intergenic
1074490948 10:113939154-113939176 CCTCCCTCCTCAGCCTCCCAAGG + Intergenic
1074597703 10:114882536-114882558 CCACCTTGCCCAGCCTCACAAGG - Intronic
1074940553 10:118232537-118232559 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1075338797 10:121629022-121629044 CCACTCTGTCTATCCTCCCACGG - Intergenic
1075399477 10:122150640-122150662 CCATCCTACCCCACCTCCCTGGG - Intronic
1075532243 10:123239493-123239515 CCACCCATCTCAGCCTCCCAAGG - Intergenic
1075676544 10:124299878-124299900 CCTCTCTGCCCCACCTCCCTTGG - Intergenic
1075700722 10:124467995-124468017 CCACCATGCCCAGCCCCCAAGGG + Intronic
1075716482 10:124558639-124558661 CCATGCTACCCAACCCCCCATGG + Intronic
1075783044 10:125029501-125029523 CCACCCACCTCAGCCTCCCAAGG + Intronic
1076093857 10:127714200-127714222 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1076282396 10:129259286-129259308 CCACCCAACCCAGTCTCCCATGG + Intergenic
1076333178 10:129686648-129686670 CCACCGTGCCCGGCCTGCCAGGG + Intronic
1076478610 10:130769417-130769439 GCACCCTGCCCAGCCACCCCTGG + Intergenic
1076672712 10:132131857-132131879 CCACCCTGCACTTCTTCCCATGG - Intronic
1076774899 10:132689867-132689889 CCACCCTGCCCCATCGCCCCAGG - Intronic
1077109701 11:856667-856689 GCAGCCTGCGCACCCTCCCAGGG - Intronic
1077516409 11:3004537-3004559 CCCCCATGGCCCACCTCCCATGG + Intronic
1077888906 11:6405002-6405024 CCTCCCTTCCCCACCCCCCAAGG - Intronic
1078250209 11:9610491-9610513 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1078255733 11:9657109-9657131 CCACCATGCCCAGCCCCTCAAGG + Intergenic
1078387203 11:10903151-10903173 CCACCCGTCTCAACCTCCCAAGG - Intergenic
1078426121 11:11252800-11252822 ACACCCAGGCCGACCTCCCAGGG + Intergenic
1078685045 11:13521629-13521651 CCACCCTCCTCAGCCTCCCAAGG + Intergenic
1078864576 11:15285037-15285059 CCACCCTGCCCAGCCTTTAAAGG + Intergenic
1079031367 11:16988687-16988709 CCACCCACCTCAGCCTCCCAAGG + Intronic
1080299735 11:30770541-30770563 CCTCCCTCCCCCACCTTCCATGG + Intergenic
1080517231 11:33035645-33035667 CCTCCCACCTCAACCTCCCAAGG - Intergenic
1081038273 11:38177211-38177233 CCACCCTGCTCAACCCCTCGGGG - Intergenic
1081280432 11:41203027-41203049 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1081424052 11:42905402-42905424 CCACCCTCCTCGGCCTCCCAAGG - Intergenic
1081892630 11:46556891-46556913 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1081892716 11:46557560-46557582 CCTCCCACCTCAACCTCCCAGGG - Intronic
1081935869 11:46903666-46903688 CCTCCCTGGCCAACATCCCAGGG - Intronic
1082741037 11:56911441-56911463 TCATCCAGTCCAACCTCCCACGG + Intergenic
1082813862 11:57495537-57495559 CCACTGTGCCCAGCCTCCCATGG - Intronic
1082986226 11:59172842-59172864 CCCACCTTCCCAACCTGCCAAGG + Intronic
1083022248 11:59519107-59519129 CCACCCTCCCTGGCCTCCCAAGG - Intergenic
1083132077 11:60633951-60633973 GCACCCTTGCCAAGCTCCCATGG - Intergenic
1083727726 11:64637142-64637164 CCCTCCTGCCCTTCCTCCCAGGG - Intronic
1083827616 11:65212177-65212199 CCCTCCTTCCCAACCTCCCAGGG - Intergenic
1083879568 11:65541346-65541368 CCACCCTGCCCACCCACCACAGG + Intronic
1083919197 11:65772137-65772159 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1083947585 11:65933011-65933033 CCACCGTGCCCAGCCCCCCATGG + Intergenic
1083950261 11:65950803-65950825 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1084065923 11:66704545-66704567 CCCCCCACCCCCACCTCCCAAGG + Intronic
1084161710 11:67353709-67353731 CCAGCCTGCCCCTCCTCCCGCGG - Intronic
1084167751 11:67383991-67384013 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1084202509 11:67570296-67570318 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1084573318 11:69973150-69973172 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1084618092 11:70249971-70249993 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1084671903 11:70611947-70611969 CCCCCCTCCCCCACCTCCCATGG - Intronic
1084741612 11:71143450-71143472 CCACCTTGATCAACCTCCCGTGG - Intronic
1084944383 11:72630973-72630995 CCAGCCTCCCCGTCCTCCCAAGG + Intronic
1084967695 11:72752906-72752928 CCACCCAGCCACACCTCCCAAGG + Intronic
1085264234 11:75227163-75227185 CCACTGTGCCCAGCCTCCCAAGG - Intergenic
1085388800 11:76171839-76171861 CCATCCTGCACTGCCTCCCATGG + Intergenic
1085436215 11:76505612-76505634 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1086106184 11:83149930-83149952 CCACCGTGCCCAGCCTCTTAAGG + Intergenic
1086202861 11:84224331-84224353 CCAGCCTGACAAACCTCCTAAGG + Intronic
1086467659 11:87071941-87071963 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1087377946 11:97367822-97367844 CCACCCTGCCCACCACCCAAGGG - Intergenic
1088014277 11:105039447-105039469 CCACCATGCCCAACCTCTCATGG + Intergenic
1089125619 11:116174597-116174619 CCCCCCTGCCCACCATCCCCTGG + Intergenic
1089257401 11:117201065-117201087 CCCCGCTCCCCAACCACCCAAGG - Intronic
1089705477 11:120274755-120274777 CCACTCTGCACATCCTCCCCAGG - Intronic
1089845437 11:121454418-121454440 CCAACCTGCCCCACATCCCCTGG - Intronic
1090282203 11:125465798-125465820 TCACCCTTCCCACCCTCCCTAGG + Intronic
1090286316 11:125502571-125502593 CCTCCCTCCTCAACCTCCCAAGG - Intergenic
1202813212 11_KI270721v1_random:36122-36144 CCACAGTGCCCAGCTTCCCAGGG - Intergenic
1091516092 12:1183769-1183791 CCTCCCACCTCAACCTCCCAAGG - Intronic
1091818953 12:3460014-3460036 CCACACAGCTTAACCTCCCAGGG - Intronic
1092108840 12:5945070-5945092 CCACCCTGCCCAGGCTCCCTTGG + Intronic
1092243187 12:6848060-6848082 CCACCATGCCCAGCCTGCCCAGG - Intronic
1092246736 12:6868020-6868042 CCACGCGGCCCAGCCTCCCCCGG - Intronic
1092408732 12:8238497-8238519 CCACCCTGCACTGTCTCCCATGG + Intergenic
1092531375 12:9348440-9348462 CCACACAGCTTAACCTCCCAGGG + Intergenic
1092943371 12:13430898-13430920 CCACCCTGCCAACTCTACCAAGG - Intergenic
1093397778 12:18704568-18704590 CCGCCCTCCTCAGCCTCCCAAGG + Intronic
1094141892 12:27189922-27189944 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1094201951 12:27803911-27803933 CCACCGTGCCCAGCCTCAAATGG - Intergenic
1094525628 12:31229003-31229025 ACAGCCTGCCCAAGCTCCCATGG - Intergenic
1094576993 12:31695772-31695794 CCACCATGCCCAACCTAATATGG + Intronic
1094819478 12:34213374-34213396 CCACCCATCTCAGCCTCCCAAGG - Intergenic
1095085389 12:38053903-38053925 CCCCCCTCCCCAACCTCCACCGG - Intergenic
1095249516 12:39961906-39961928 CCTCCCACCTCAACCTCCCAAGG + Intronic
1095775510 12:46005245-46005267 CCTCCCTCCTCAGCCTCCCAAGG + Intergenic
1095847557 12:46761694-46761716 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1096187641 12:49592538-49592560 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1096335335 12:50751056-50751078 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1096350023 12:50890016-50890038 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1096430067 12:51535653-51535675 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1096624692 12:52887243-52887265 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1096742606 12:53704998-53705020 CCACCGCGCCCAACCTCACCTGG - Intergenic
1097206704 12:57328178-57328200 CCTCCCGCCTCAACCTCCCAAGG + Intronic
1097227068 12:57483794-57483816 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1097872468 12:64612135-64612157 CCCCCATGCCCACCCTCCCTGGG + Intronic
1097875123 12:64636223-64636245 CCTCCCCGCTCAGCCTCCCAAGG + Intronic
1097876383 12:64647835-64647857 CCACTGTCCCCAGCCTCCCAAGG + Intronic
1098050895 12:66451651-66451673 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1098081818 12:66794472-66794494 CAACCCTGCTCACTCTCCCAAGG - Intronic
1098285731 12:68905151-68905173 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1098734312 12:74079646-74079668 CCACCCTCCTCAGCCTCCCAAGG - Intergenic
1098757930 12:74389053-74389075 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1099114047 12:78601885-78601907 CCGCCCGCCCCAGCCTCCCAAGG - Intergenic
1099375682 12:81894223-81894245 CCACCCTGCCTTCTCTCCCACGG + Intergenic
1099949170 12:89281391-89281413 CCAGACTGCCCACACTCCCAGGG + Intergenic
1100479266 12:94962215-94962237 CCACCATGCCCAGCCTCCCTAGG - Intronic
1100585772 12:95977978-95978000 CCTTGCTGCCCATCCTCCCATGG + Exonic
1100888839 12:99101803-99101825 CCACCCACCTCAGCCTCCCAAGG + Intronic
1101121196 12:101582007-101582029 GCACCCTGCCCCTCCTCACAGGG - Intronic
1101179632 12:102201180-102201202 CCACCGTGCCCAGCCTAACAAGG - Intergenic
1101677157 12:106927506-106927528 CCACCATGCCCAGCCTCACTAGG + Intergenic
1101690442 12:107074769-107074791 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1101896632 12:108761963-108761985 CCACCGTGCCTGGCCTCCCATGG - Intergenic
1102030386 12:109736907-109736929 CCACCCTGCCCCAACTCCCTAGG + Intronic
1102037472 12:109780356-109780378 CCACCGTGCCCAGCCTGCCTGGG + Intergenic
1102114093 12:110388278-110388300 CCACCCACCTCAGCCTCCCAAGG + Intronic
1102236797 12:111298756-111298778 CTGCCCTCCCCAAGCTCCCAGGG + Intronic
1102409487 12:112704810-112704832 CCACTATGCCCAAGCTCCCCAGG - Intronic
1102880946 12:116484317-116484339 CCACCCCGCCCCCCCTCCCCCGG - Intergenic
1103104056 12:118207081-118207103 CCACCCTCCTCGGCCTCCCAAGG - Intronic
1103109567 12:118263776-118263798 CCACCGTGCCCGGCCTCTCATGG - Intronic
1103420669 12:120779729-120779751 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1103472702 12:121194539-121194561 CCACCCAGCTCGGCCTCCCAAGG - Intergenic
1103526065 12:121569382-121569404 CCACCCTCCCTACCCTCCCATGG + Intronic
1103545586 12:121698849-121698871 CCACCATGCCCACCCTCCAATGG - Intergenic
1104720890 12:131044648-131044670 CCCCGCTGCCCTCCCTCCCACGG + Intronic
1105313182 13:19231321-19231343 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1105464903 13:20630684-20630706 CCACCATGCCCAGCCTTCCAAGG + Intronic
1105753320 13:23441727-23441749 CCACCGTGCCCAGCCACCCTTGG + Intergenic
1105808160 13:23970917-23970939 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1106332768 13:28754623-28754645 CCATCATGTCCAACTTCCCATGG - Intergenic
1106953542 13:34910758-34910780 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1107425009 13:40283839-40283861 CCACCCTGCCCATCTTCCAGGGG - Intergenic
1107644685 13:42481714-42481736 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1107701317 13:43051219-43051241 CCACCCATCTCAGCCTCCCAAGG + Intronic
1107850030 13:44562146-44562168 CCTCCCACCTCAACCTCCCAGGG + Intronic
1108014125 13:46055417-46055439 ACAACCTGCACAACCTTCCATGG + Intronic
1109508212 13:63335082-63335104 TCACCCTCCTCAGCCTCCCATGG - Intergenic
1109583268 13:64367784-64367806 CCACCATGCCCAACCTGGAATGG + Intergenic
1110030252 13:70602651-70602673 CCACCGTGCCCAGCCTTCCAGGG - Intergenic
1110923101 13:81114170-81114192 CCACCCACCCCAGCCTCCCAAGG + Intergenic
1111208999 13:85051432-85051454 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1111448267 13:88379120-88379142 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1111518475 13:89366481-89366503 CCTCCCACCTCAACCTCCCAAGG + Intergenic
1111954477 13:94741630-94741652 CAACCCTGCCTGACCTCTCATGG - Intergenic
1112349604 13:98621970-98621992 CCACCGTGCCCAGCCTCCCCTGG + Intergenic
1112409360 13:99149057-99149079 CCACCCGCCTCAGCCTCCCATGG + Intergenic
1113423943 13:110192514-110192536 CCCCCCTGCCCACACACCCAGGG + Intronic
1113470293 13:110539801-110539823 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1113769463 13:112898939-112898961 CCACCCTGTGCCCCCTCCCAGGG + Intronic
1114279700 14:21180749-21180771 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1114456102 14:22854505-22854527 CCACCCGCCTCAGCCTCCCAGGG - Intergenic
1114651732 14:24289368-24289390 CCACCTTCCTCAACCTCCCAAGG + Intergenic
1114661192 14:24346117-24346139 CCACCATGCCCAGCCTCCTGTGG - Intergenic
1114739303 14:25078927-25078949 GCACTGTGGCCAACCTCCCATGG + Intergenic
1115225871 14:31101547-31101569 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1116229880 14:42202873-42202895 CCACCCTCCTCCGCCTCCCAAGG - Intergenic
1117152644 14:52904944-52904966 CCACCTGCCCCAGCCTCCCAAGG - Intronic
1117259272 14:54013858-54013880 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1118117584 14:62798002-62798024 CCACCATGCCCAGCCTACAATGG + Intronic
1118305681 14:64653230-64653252 CCACCATGCCCAGCCTATCATGG - Intergenic
1118320707 14:64751361-64751383 CCACCCACCTCAGCCTCCCAAGG + Intronic
1118640516 14:67788101-67788123 CCACCGCACCCAACCACCCACGG - Intronic
1118720553 14:68590839-68590861 CCACTCTGCCCCGCCACCCATGG - Intronic
1118781506 14:69011594-69011616 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1119231781 14:72985573-72985595 CCACCCAACTCAGCCTCCCAAGG + Intronic
1119292309 14:73505158-73505180 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1119570138 14:75662624-75662646 CCACCCTGCCCGGCCTGCAAGGG + Intronic
1119600747 14:75974845-75974867 CCACCCACCTCAGCCTCCCAAGG - Intronic
1119800118 14:77436684-77436706 CCACCTGCCTCAACCTCCCAAGG + Intronic
1120443102 14:84562855-84562877 CCACCCTGTCCAATCTGCAATGG - Intergenic
1120453070 14:84695694-84695716 CCACCCACCTCAACCTTCCAAGG - Intergenic
1120604608 14:86559092-86559114 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1120881461 14:89417511-89417533 CCCACCTGCCCCACCGCCCACGG - Intronic
1120957419 14:90094932-90094954 CCACCATGCCCAGCCTATCAGGG + Intronic
1121021043 14:90580395-90580417 ACACCCTGCCCAAGTTCTCAGGG + Intronic
1121039149 14:90730738-90730760 CCACGCAGCCCAACCTCACCAGG - Intronic
1121074560 14:91057120-91057142 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1121102385 14:91258854-91258876 CCTCCCACCTCAACCTCCCAAGG - Intergenic
1121176902 14:91897270-91897292 CCACCGAGCACAGCCTCCCAGGG + Intronic
1121635951 14:95453978-95454000 CCACCCTCCTGAGCCTCCCAAGG - Intronic
1122149677 14:99718186-99718208 CCACCTGCCCCCACCTCCCATGG + Intronic
1122350134 14:101084240-101084262 CCTGCCTGCACAACCTGCCAAGG - Intergenic
1122462704 14:101908615-101908637 CCACCCGCCTCAGCCTCCCACGG + Intronic
1122482003 14:102053368-102053390 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1122695273 14:103549369-103549391 CCAGCCTGCCCAACCTGGGAAGG + Intergenic
1122742407 14:103879950-103879972 CCACCCTCCCTGACCTCACACGG + Intergenic
1122938278 14:104969960-104969982 CCACCCTCCACAGCCACCCAGGG + Intronic
1123121843 14:105920357-105920379 CCACCCTGTCCCACGGCCCAAGG - Intronic
1202901026 14_GL000194v1_random:39189-39211 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1123462863 15:20489680-20489702 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1123655195 15:22510739-22510761 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1123686126 15:22798603-22798625 CCACCCGTCTCAGCCTCCCAAGG - Intronic
1123906503 15:24926759-24926781 CCACCCATCTCAGCCTCCCACGG - Intronic
1124309105 15:28605940-28605962 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1124348747 15:28940223-28940245 CCACCACGCCCAGCCTCCCGAGG - Intronic
1124624548 15:31300505-31300527 CCACCCCGCCCAACCCCTCCAGG + Intergenic
1124808266 15:32907819-32907841 CGACCCTGCCCAGCTTTCCAGGG - Intronic
1125637360 15:41200277-41200299 CCACCCACCTCAGCCTCCCAAGG - Intronic
1125695028 15:41628850-41628872 CCACCGTGCCCGGCCTCCAACGG - Intronic
1125932213 15:43608480-43608502 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1125945310 15:43707954-43707976 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1126100016 15:45113277-45113299 TCTCCCCGCCCCACCTCCCAGGG + Intronic
1126600591 15:50423894-50423916 CCACCGTGCCCAGCCTCGCCGGG + Intergenic
1126747019 15:51836481-51836503 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1126837990 15:52687160-52687182 CCACCCACCTCAGCCTCCCAAGG - Intronic
1126881535 15:53103839-53103861 CCACCCCCCTCAGCCTCCCAAGG - Intergenic
1127439540 15:58992572-58992594 CCACCTTCCTCAGCCTCCCAAGG - Intronic
1127446809 15:59071437-59071459 CCACCCGTCTCAGCCTCCCAAGG - Intronic
1127538794 15:59917016-59917038 CCACCCATCTCAGCCTCCCAAGG - Intergenic
1127864542 15:63021291-63021313 ACATCCTGCCCATCCTCCAAAGG - Intergenic
1128226821 15:66007504-66007526 CCACCCACCTCAGCCTCCCAGGG - Intronic
1128251551 15:66167352-66167374 CCACCGTGCCCAGCCATCCATGG - Intronic
1128766253 15:70252955-70252977 CCTCCCTGCCCACTCTCCCCAGG + Intergenic
1128920603 15:71606825-71606847 CCACCATGCCCAGCCTCAAATGG + Intronic
1129041210 15:72687682-72687704 CCACCCACCTCAGCCTCCCAAGG - Intronic
1129397972 15:75263190-75263212 CAACCCTCCTCAAGCTCCCAAGG - Intronic
1129401583 15:75287471-75287493 CAACCCTCCTCAAGCTCCCAAGG - Intronic
1129406078 15:75319067-75319089 CCTCCCACCCCAGCCTCCCAAGG + Intergenic
1129814457 15:78539921-78539943 CCACCCGCCTCGACCTCCCAAGG + Intergenic
1129873607 15:78957598-78957620 CCACCGTGCCCAGCCTCCTTGGG + Intergenic
1130064981 15:80595761-80595783 AAACCCTGCACATCCTCCCAGGG + Exonic
1130404500 15:83585944-83585966 TCACCCTGCCTAACCAACCATGG - Intronic
1131131183 15:89901433-89901455 CCACCCCCCTCCACCTCCCAAGG - Exonic
1131141792 15:89982429-89982451 CCACCCTCCTCGGCCTCCCAAGG + Intergenic
1132714209 16:1282683-1282705 CCACACAGCCCAGCCTCCCGGGG - Intergenic
1132760288 16:1505640-1505662 CCGCCCTTCCCACCCACCCACGG - Intronic
1132826015 16:1906063-1906085 CCGCCCGCCTCAACCTCCCAAGG + Intergenic
1132827038 16:1910270-1910292 CAGCCCTGCCCAGCCTCCCAGGG + Intergenic
1132867361 16:2100117-2100139 CCACCCTGCCCAACCTCCCACGG + Intronic
1132968922 16:2675429-2675451 CCACCCAGCCCAGCCTCTCCTGG - Intergenic
1132973423 16:2700083-2700105 CCACCCCACCCGAACTCCCAAGG - Intronic
1132988283 16:2779318-2779340 GCACACTCCCCAACCTCCCAAGG - Intergenic
1133270997 16:4610750-4610772 CCACCCACCCCAACTGCCCAAGG - Intronic
1133304681 16:4801729-4801751 AGACCCTGCCCAAGCCCCCAGGG + Intronic
1133425110 16:5681634-5681656 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1133797478 16:9057876-9057898 CCACCATGCCCAGCCGGCCATGG - Intergenic
1133928203 16:10210993-10211015 TCCCACAGCCCAACCTCCCATGG - Intergenic
1133947586 16:10362110-10362132 CCACCATGCCCAGCCTTCCCAGG + Intronic
1134270615 16:12729968-12729990 CCTCCCAGCTCAGCCTCCCAAGG + Intronic
1134524416 16:14932998-14933020 CCACCCTGCCCAACCTCCCACGG - Intronic
1134548485 16:15127943-15127965 CCACCCTGCCCAACCTCCCACGG + Intronic
1134712004 16:16331485-16331507 CCACCCTGCCCAACCTCCCACGG - Intergenic
1134719861 16:16374778-16374800 CCACCCTGCCCAACCTCCCACGG - Intergenic
1134947565 16:18337107-18337129 CCACCCTGCCCAACCTCCCACGG + Intergenic
1134954824 16:18377209-18377231 CCACCCTGCCCAACCTCCCACGG + Intergenic
1135064166 16:19295444-19295466 CCACCCACCTCAGCCTCCCAAGG + Intronic
1135278108 16:21130546-21130568 CCACCCACCTCAGCCTCCCAAGG + Intronic
1135391165 16:22094675-22094697 CCACCACGCCCAACCTGCCTTGG - Intronic
1135537278 16:23303670-23303692 CCGCCCTCCTCAGCCTCCCAAGG - Intronic
1135590222 16:23699708-23699730 CCACCATGCCCAACCTAAAAGGG + Intronic
1136339691 16:29634092-29634114 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1136381236 16:29896911-29896933 CCACCCAGCCCTGCCTCCCCAGG - Exonic
1136459855 16:30403204-30403226 CCACCTGCCTCAACCTCCCAAGG + Intergenic
1136496931 16:30650715-30650737 CAACGCTGCCCAACCGCCGATGG - Intronic
1137330707 16:47492623-47492645 CCACCCTCCCCTCCCTGCCAAGG - Intronic
1137394580 16:48107712-48107734 CCACCATGCCCGACCTTCCTTGG - Intronic
1137500166 16:49004893-49004915 CCACCAACCCCTACCTCCCAGGG - Intergenic
1137726240 16:50658586-50658608 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1137780521 16:51094436-51094458 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1138095038 16:54204953-54204975 CCGCTCTGCCCAGCCTGCCATGG - Intergenic
1138278969 16:55758247-55758269 CCACAGTGCCCAGCCTCCCCTGG + Intergenic
1138289569 16:55835427-55835449 CCACAGTGCCCAGCCTCCCCTGG - Intergenic
1138372401 16:56537789-56537811 CCGCCCTCCTCAGCCTCCCAAGG + Intergenic
1138489543 16:57368333-57368355 CCTCCCAGCTCAACCTCCCGAGG - Intergenic
1138557783 16:57782698-57782720 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1138567083 16:57841420-57841442 CTACCCACCTCAACCTCCCAAGG - Intronic
1138630827 16:58293151-58293173 CCGCCCTGCCCTGCCTCCCTGGG - Intronic
1138673743 16:58636021-58636043 CCTCCCTGGACATCCTCCCAGGG - Intergenic
1139113930 16:63926153-63926175 CCACCCTCCTCGGCCTCCCACGG + Intergenic
1139388332 16:66588896-66588918 CCACCCGCCTCAGCCTCCCAGGG + Intergenic
1139480166 16:67226370-67226392 CCACTCTGCCCCATCTGCCAGGG - Intronic
1139621557 16:68148762-68148784 CCACCCGCCTCAACCTCCTAAGG - Intronic
1139674402 16:68513160-68513182 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1139738261 16:69012267-69012289 CCACCGTGCCCAACCTCCTCAGG - Intronic
1140229325 16:73104515-73104537 CCACCATGCCCAGCCTCCTGTGG + Intergenic
1140381138 16:74488904-74488926 CCACCATGCCCAGCCTCACTTGG + Intronic
1140434618 16:74936167-74936189 CCACCATGCCCGACCACCCTTGG + Intronic
1140443489 16:75004857-75004879 CCTCCCACCTCAACCTCCCAAGG + Intronic
1140681093 16:77385579-77385601 CAACCCTGCCCTGCCTCCCTTGG + Intronic
1140973155 16:80033023-80033045 CCACCCACCTCGACCTCCCAAGG - Intergenic
1140986164 16:80159942-80159964 CCACCCATCTCAGCCTCCCAAGG - Intergenic
1141635377 16:85311489-85311511 CCTCCCTCCCCAATGTCCCACGG - Intergenic
1141682142 16:85551001-85551023 CCACGCTGCACACCCACCCAAGG - Intergenic
1141690611 16:85594222-85594244 CCCCCCCCCCCAACCCCCCAGGG - Intergenic
1141825875 16:86480097-86480119 ACACCCTGCCCAGCCTCCGGGGG + Intergenic
1141901479 16:86993944-86993966 GCGCCCTGGACAACCTCCCAAGG + Intergenic
1142068210 16:88074691-88074713 CCCCCTACCCCAACCTCCCATGG + Intronic
1142068686 16:88077369-88077391 CCAGCGAGCCCAACCCCCCAGGG - Intronic
1142115714 16:88355077-88355099 GCCCCCTGCCCACCCTCCCCAGG - Intergenic
1142311074 16:89314146-89314168 CCACCCTGCCCCACTGCCCCAGG - Intronic
1142361283 16:89628543-89628565 CCACCTTGCCCAGCCCCCAAAGG + Intronic
1142656366 17:1397140-1397162 CCACCCGCCTCGACCTCCCAAGG + Intronic
1142678211 17:1528848-1528870 CCACCATGCCCAGCCACTCAGGG - Intronic
1142678333 17:1529609-1529631 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1143161614 17:4875527-4875549 CCACCCACCTCAGCCTCCCAAGG - Intronic
1143214397 17:5213601-5213623 CCACCCGCCTCGACCTCCCAAGG - Intronic
1143284093 17:5776384-5776406 CCAGCCCGCCCAACCATCCAGGG - Intronic
1143355131 17:6322074-6322096 CCACCCATCTCAGCCTCCCAAGG - Intergenic
1143374991 17:6462079-6462101 CAACCCTCCCCAACCTCCCACGG + Intronic
1143406594 17:6681819-6681841 CCACCCGTCTCAGCCTCCCAAGG + Intergenic
1143515259 17:7416366-7416388 CCCCCCTGCCCGACCCCCCTAGG + Intronic
1143826591 17:9613760-9613782 CCACCCACCTCAGCCTCCCAAGG + Intronic
1143899113 17:10160147-10160169 CCACCCACCTCAGCCTCCCAAGG + Intronic
1144598434 17:16591206-16591228 CCACCCTCCTCGGCCTCCCAAGG + Intergenic
1144767576 17:17740950-17740972 CCACCCCTCCCACCCGCCCACGG - Intronic
1144783073 17:17817457-17817479 CCACCCTGCCCAACCCCACCAGG - Exonic
1145004398 17:19329179-19329201 CCAGCCTGCCCAGCCCCCCAGGG - Intronic
1145253025 17:21306768-21306790 CCACCACGCCCAGCCTCACATGG + Intronic
1145323547 17:21781151-21781173 CCACCATGCCCAGCCTCACATGG - Intergenic
1145873854 17:28300704-28300726 CTCCCCTCACCAACCTCCCAGGG + Intergenic
1145995657 17:29103441-29103463 CCACCCCGCCCAGCCACTCAGGG - Intronic
1146035659 17:29404403-29404425 CCACCCAGCTCAATCTCCCAAGG + Intronic
1146144595 17:30402276-30402298 CCACCACGCCCAGCCTTCCAAGG - Intronic
1146401657 17:32504498-32504520 CCACCCACCCCAGCCACCCAGGG - Intronic
1146594558 17:34157362-34157384 CCGCCCTGCCCTTCCCCCCAAGG - Intronic
1146875168 17:36403957-36403979 CCACCCACCTCAGCCTCCCAAGG - Intronic
1147064220 17:37908913-37908935 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1147273587 17:39295496-39295518 CCACCCACCTCAGCCTCCCAAGG + Intronic
1147323007 17:39657280-39657302 CCACCCACCTCAGCCTCCCAAGG - Intronic
1147696366 17:42357426-42357448 CTACCCTCCTCAGCCTCCCAAGG - Intronic
1147702070 17:42402586-42402608 CCACAATCCCCAACCTCCCTCGG + Exonic
1147896800 17:43756590-43756612 TCCCCCAGCCCAGCCTCCCATGG - Intronic
1148291856 17:46458826-46458848 CCACCGTGCCCGGCCTCCCATGG + Intergenic
1148314046 17:46676517-46676539 CCACCATGCCCGGCCTCCCATGG + Intronic
1148371458 17:47102751-47102773 CCACCCACCTCAGCCTCCCAGGG - Intergenic
1148498877 17:48073581-48073603 CCACCCACCTCAGCCTCCCAAGG - Intronic
1148625999 17:49069328-49069350 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1148808500 17:50276223-50276245 CCACCCACCTCAGCCTCCCAAGG + Intronic
1148869465 17:50647748-50647770 ACACCATGCCCAGCCTCCAAGGG - Intronic
1149660445 17:58331814-58331836 CCAGCCTCCCCAACAGCCCAGGG + Intergenic
1149812700 17:59692879-59692901 CCACCCTCCTCGGCCTCCCACGG + Intronic
1150363301 17:64558110-64558132 CCACCGTCCCCAGCCTCACATGG - Intronic
1150861248 17:68802981-68803003 CCACCCTCCTCGGCCTCCCAAGG + Intergenic
1151017169 17:70568816-70568838 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1151489367 17:74423615-74423637 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1151499902 17:74481889-74481911 CCCTTCTGCCCACCCTCCCAGGG - Intronic
1151628177 17:75290969-75290991 CCACCCAGCTCGGCCTCCCAAGG + Intergenic
1151750642 17:76035487-76035509 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1151822203 17:76502385-76502407 CCACCCTGCCCCCCAACCCAAGG + Intergenic
1152441060 17:80310038-80310060 CCACCACGCCCAGCCTCCCATGG + Intronic
1152678103 17:81651814-81651836 GCCTCCTCCCCAACCTCCCAGGG + Intronic
1152769515 17:82158442-82158464 CCACCCTCCTCGGCCTCCCAAGG - Intronic
1152869752 17:82746511-82746533 CCACCATGCCCAGCCTCTGAAGG - Intronic
1153153278 18:2120370-2120392 CCACCCTCCCTAGCCTCCCAAGG + Intergenic
1153200793 18:2645672-2645694 CCACCCACCTCAGCCTCCCAGGG - Intergenic
1153624564 18:7011929-7011951 CCACCCCCACCCACCTCCCAGGG + Intronic
1153762407 18:8344697-8344719 ACCCCCTGCCCAGCCTCCTAAGG - Intronic
1154129815 18:11727159-11727181 CCACCCTGCCCAGCCCTGCAAGG + Intronic
1154301273 18:13194753-13194775 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1155078160 18:22381343-22381365 CCTCCCGCCCCTACCTCCCAAGG - Intergenic
1155261499 18:24047334-24047356 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1155729149 18:29130393-29130415 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1155923718 18:31631293-31631315 CCACCCACCTCAGCCTCCCAAGG + Intronic
1156016272 18:32550700-32550722 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1156411976 18:36839018-36839040 CCACCATGCCCATCCTACCTTGG + Intronic
1156774884 18:40775215-40775237 CCACCCTCCTCAGCCTCCCAAGG - Intergenic
1157103123 18:44748005-44748027 CCACCCCACTCAGCCTCCCAAGG - Intronic
1157268054 18:46246230-46246252 CCACCCCGCCTCACCCCCCATGG - Intronic
1157293863 18:46427877-46427899 CCACCCTGCCCACCAGCCCCAGG - Intronic
1157421790 18:47554040-47554062 CCACCATGCCCAGCCTACCTAGG - Intergenic
1157575023 18:48737966-48737988 CCAGCCTTCTCAACATCCCACGG + Intronic
1157824496 18:50800639-50800661 CCACCCACCTCAGCCTCCCAAGG - Intronic
1157849472 18:51034492-51034514 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1158265815 18:55659701-55659723 CCACCATGCCCAGCCTCCATGGG - Intronic
1158457915 18:57623582-57623604 CCACCCGCCTCAACCTCCCAAGG - Intergenic
1158472067 18:57745902-57745924 CCTCCCACCTCAACCTCCCAAGG + Intronic
1158489061 18:57893781-57893803 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1158861265 18:61594470-61594492 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1159256591 18:65955021-65955043 CCACCCTCCTCAGCCTCACAAGG - Intergenic
1159681218 18:71354865-71354887 CCACAGTGCCCAACCTGCAAAGG - Intergenic
1159879448 18:73844800-73844822 CCCCATTTCCCAACCTCCCAGGG - Intergenic
1159958896 18:74540401-74540423 CCACCCGCCTCATCCTCCCAAGG + Intronic
1160079746 18:75714203-75714225 CCACCAGGCCCCACCTCCCCAGG - Intergenic
1160304823 18:77722544-77722566 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1160340786 18:78087129-78087151 CCACACTGCCCAGGCCCCCAGGG - Intergenic
1160619575 18:80161291-80161313 CCAATATGCCCAGCCTCCCATGG + Intronic
1160859246 19:1230754-1230776 CCGCCCCGCCCATGCTCCCAAGG - Exonic
1160904824 19:1447127-1447149 CCACCCTCCCCCACCTCCGGTGG + Intronic
1160957946 19:1702717-1702739 CCACCCTGGCCAACGTAGCAAGG + Intergenic
1161031102 19:2058112-2058134 CCACCTCCCTCAACCTCCCAGGG + Intergenic
1161042829 19:2119112-2119134 CCATCCTGCTTATCCTCCCAGGG - Intronic
1161415185 19:4142716-4142738 CCACCACGCCCAGCCTGCCAGGG + Intergenic
1161417758 19:4157177-4157199 CCATCCTGCCCAGCCTGGCAAGG + Exonic
1161437569 19:4272983-4273005 CTGCCCTGCCCCACCTCTCAGGG + Intergenic
1161654927 19:5508314-5508336 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1161722855 19:5913351-5913373 CCACCCAGGCCCACCTCCAAGGG - Intronic
1161755901 19:6134145-6134167 CCACCCGCCTCAACCTTCCATGG - Intronic
1161767764 19:6216513-6216535 CCTCCCTGCCCCGCCTCCCCAGG - Exonic
1161813872 19:6487168-6487190 CCTCCCATCCCAGCCTCCCAAGG + Intergenic
1161880379 19:6946660-6946682 CCACCATGCCCAGCCTCTAATGG - Intergenic
1161924229 19:7289286-7289308 CCACCCTGTCCAGCTTCCCCAGG - Intronic
1161950079 19:7463075-7463097 CCACCCTCCTCTGCCTCCCAAGG + Intronic
1161992721 19:7694077-7694099 CCACCACGCCCACCCTCACATGG + Intronic
1162055524 19:8061430-8061452 CCACCATGCCCAGCCAACCAGGG + Intronic
1162170437 19:8784850-8784872 CCACCCTGCACAACTGCCCCTGG - Intergenic
1162273200 19:9633009-9633031 CAACCCTTCCCCACCTCCTAGGG + Intronic
1162507453 19:11094712-11094734 CCTCCCTCCTCAGCCTCCCAAGG + Intronic
1162521230 19:11180840-11180862 CCACCCACCTCAGCCTCCCAAGG - Intronic
1162523654 19:11195555-11195577 CTACCTGGCCCATCCTCCCAAGG - Exonic
1162720641 19:12660260-12660282 CCACCCCGCTCGGCCTCCCAAGG - Intronic
1162737400 19:12754313-12754335 CCACCCTCCTCAGCCTCCCAAGG + Intronic
1163140442 19:15344445-15344467 CCACCCACCTCAGCCTCCCAGGG + Intergenic
1163399548 19:17083892-17083914 CCACCCACCTCAGCCTCCCAAGG + Intronic
1163840319 19:19604181-19604203 CCACCATGCCCAACCTCTCATGG - Intronic
1163957897 19:20661133-20661155 CTCCCCTGCCCACCCTCCCCTGG + Intronic
1164023368 19:21328897-21328919 CTCCCCTGACCACCCTCCCATGG + Intronic
1164035014 19:21445870-21445892 CCACCCACCTCAGCCTCCCAAGG + Intronic
1164164562 19:22658303-22658325 CCTCCCTCCTCAATCTCCCAAGG - Intronic
1164178866 19:22802296-22802318 CCACCCTCCCCTACACCCCAGGG + Intergenic
1164444659 19:28307104-28307126 CCACTGTGCCCAGCCTCACATGG + Intergenic
1164461698 19:28454580-28454602 CCACCCAGCCGGACCTCCCCAGG + Intergenic
1164860944 19:31561774-31561796 CCACCATGCCCAGCCTTCCAAGG + Intergenic
1164972783 19:32546784-32546806 CCACCCACCCCAGTCTCCCAGGG + Intergenic
1165459466 19:35936285-35936307 CGCCCCGGCCCCACCTCCCATGG - Intronic
1165749656 19:38252189-38252211 CCACCCGGCCCCACCACCCCCGG - Intronic
1165801807 19:38556631-38556653 CCACCCTCCTCAGCCACCCAAGG + Intronic
1166550504 19:43662821-43662843 CCTCCCGCCTCAACCTCCCAAGG + Intronic
1166753125 19:45174345-45174367 CCACCCATCCCCACCTGCCACGG + Intronic
1166770907 19:45281600-45281622 CCACCCACCTCAGCCTCCCAAGG + Intronic
1167004689 19:46767788-46767810 CCACCCACCTCAGCCTCCCAAGG - Intronic
1167013739 19:46826046-46826068 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1167167986 19:47812351-47812373 CCACCCACCTCAGCCTCCCAAGG - Intronic
1167242020 19:48349708-48349730 ACATCCTGCCCAACCACACAGGG - Intronic
1167278334 19:48552234-48552256 CCACCCTCACCCACCTGCCATGG + Exonic
1167401137 19:49270746-49270768 CCACCATGCCCAGCCTCCACAGG - Intergenic
1167509234 19:49887622-49887644 CCTCTCCGCCCAACCTCCCAGGG - Intronic
1167671028 19:50853706-50853728 CCACCCATCTCAGCCTCCCATGG - Intergenic
1168081593 19:54014162-54014184 CCACCCGCCTCGACCTCCCAAGG - Intergenic
1168104417 19:54157951-54157973 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1168209292 19:54878202-54878224 CCACCGTGCCCAGCCTGCTAAGG + Intronic
1168512942 19:56987965-56987987 CCACCGTGCCCAGCCTACCTGGG + Intergenic
925115170 2:1372507-1372529 CCAAGCTGCCCATCCACCCAAGG - Intergenic
925761482 2:7188632-7188654 CCACCCTTCCCTCCTTCCCATGG - Intergenic
925821520 2:7803784-7803806 CTTCCCTCCCCAACCACCCAAGG + Intergenic
925838339 2:7966817-7966839 CCTCCTTGCCCAACCTGCCAGGG + Intergenic
925909891 2:8566816-8566838 CCATCCTGCCCAGTCTCCCAAGG + Intergenic
926009357 2:9396054-9396076 CTGCCCTGCCCAACCTACTAAGG - Intronic
927179625 2:20435559-20435581 CCACCCGCCTCGACCTCCCAAGG + Intergenic
927687334 2:25180406-25180428 CCACCCACCTCAGCCTCCCAAGG - Intergenic
927750510 2:25665381-25665403 CCACCCGCCTCAGCCTCCCAAGG - Intronic
928146029 2:28776501-28776523 CCACCCACCTCAACCTCCCAAGG + Intronic
928651317 2:33406289-33406311 CCACCCACCTCAACCTCCCAAGG + Intergenic
928693272 2:33822664-33822686 CCACCCACCTCAGCCTCCCAAGG + Intergenic
929156021 2:38789314-38789336 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
929183748 2:39071109-39071131 CCACCCACCTCCACCTCCCAAGG + Intronic
929217308 2:39428824-39428846 CCACCCGCCTCAGCCTCCCAAGG - Intronic
929544456 2:42846604-42846626 CCACCCACCTCAGCCTCCCAAGG + Intergenic
929856461 2:45642417-45642439 CCACCCAGCCCTGCTTCCCAGGG - Intergenic
930041105 2:47125131-47125153 CCACCATGCCCAACCTCAATAGG - Intronic
930479485 2:51927788-51927810 CCACCATGCCCAACCACAAAGGG + Intergenic
930652393 2:53975543-53975565 CCACCCAGCCCAGCCTCAAAAGG - Intronic
930785588 2:55268900-55268922 CCTCACTTCCCAGCCTCCCATGG - Intronic
931045183 2:58343261-58343283 CCACCCTCCTCGGCCTCCCAAGG - Intergenic
931396502 2:61892447-61892469 CCACCCTCCTCCGCCTCCCAAGG - Intronic
931436178 2:62249094-62249116 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
931453417 2:62387692-62387714 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
931867937 2:66432355-66432377 CCAGCCAGCGCAGCCTCCCAAGG + Intergenic
932222079 2:70007272-70007294 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
932579052 2:72981734-72981756 CAGCCCAGCCCAACCTTCCATGG + Intronic
932783907 2:74582775-74582797 CCACCCACCTCAGCCTCCCAAGG - Intronic
934147696 2:89111576-89111598 CCACTGTGCCCAGCCTCCCAAGG - Intergenic
934152100 2:89156655-89156677 ACACCCTCCCCCACCTTCCAGGG - Intergenic
934215151 2:90025251-90025273 ACACCCTCCCCCACCTTCCAGGG + Intergenic
934221579 2:90089025-90089047 CCACTGTGCCCAGCCTCCCAAGG + Intergenic
934465870 2:94262464-94262486 CCACCCTGCCTTCTCTCCCACGG - Intergenic
935753633 2:106260649-106260671 CCACCCACCTCAGCCTCCCAAGG + Intergenic
936166081 2:110120792-110120814 CCGCCCTGGCCGCCCTCCCATGG + Intergenic
936365267 2:111848531-111848553 CCACCCGCCTCAGCCTCCCAAGG - Intronic
936405849 2:112201612-112201634 GAAACCTGCCCAACCTCCCCTGG - Intergenic
936978899 2:118245756-118245778 CCACCCCCCTCAGCCTCCCAAGG - Intergenic
937185021 2:120031890-120031912 CCTCCTACCCCAACCTCCCAAGG - Intronic
937295301 2:120806546-120806568 CCTCCCTCCCCACACTCCCAGGG - Intronic
937521710 2:122720534-122720556 CCCCTCTGGCCACCCTCCCAAGG - Intergenic
938398764 2:130970299-130970321 CCACCATGCCCAACCTAGAATGG - Intronic
938576137 2:132606453-132606475 CCACACTGCCCAAACCCCAAGGG + Intronic
938653369 2:133406857-133406879 CCACCTTGCCCTTCCTTCCAGGG + Intronic
939332695 2:140785587-140785609 CCACCCTTCCCAAATTCCTAGGG - Intronic
939749710 2:146028078-146028100 CCACCCTGCCCGGCCTGACATGG - Intergenic
940940549 2:159555376-159555398 CCACCGCGCCCAGCCTACCAAGG + Intronic
941653074 2:168114497-168114519 CCCACCTTCCCAACCTCCAAGGG - Intronic
941973930 2:171382827-171382849 CCACCCACCTCAGCCTCCCAAGG - Intronic
942076668 2:172362488-172362510 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
942486324 2:176443448-176443470 CCACCCACCTCAGCCTCCCAAGG - Intergenic
942488867 2:176469506-176469528 CCACCCACCTCAGCCTCCCAAGG + Intergenic
942705710 2:178769549-178769571 CCACCCTGCCCACCCAATCAAGG + Intronic
944180766 2:196890176-196890198 CCACCCACCTCAGCCTCCCAAGG + Intronic
944454101 2:199875800-199875822 CCACCATGCCCAACCCCACAAGG - Intergenic
945246648 2:207723630-207723652 CCACCCACCTCAGCCTCCCAAGG - Intronic
945248135 2:207739471-207739493 CCACCCGCCTCAGCCTCCCAAGG + Intronic
945611622 2:212011505-212011527 CCACCCGTCTCAGCCTCCCAGGG - Intronic
945648804 2:212536289-212536311 CCACCCTGCCGCACCTGGCAGGG - Intronic
945868483 2:215202537-215202559 CCACCGTGCCCAGCCTCACTGGG - Intergenic
946107555 2:217385144-217385166 CCACCAGCCCCATCCTCCCAAGG - Intronic
947153303 2:227135885-227135907 CCACCCACCTCAGCCTCCCAGGG + Intronic
947201580 2:227619078-227619100 CCACCCGCCTCAGCCTCCCAAGG + Intronic
947549144 2:231033956-231033978 CCACCCACCCCAACCTCCCAAGG + Intergenic
947573649 2:231255476-231255498 TCTCCCTGACCAAACTCCCAGGG - Intronic
947654976 2:231819326-231819348 CTACCCTGTCCACCCTCCCTGGG + Intergenic
948032465 2:234830202-234830224 CCACCCTCCTCTGCCTCCCAAGG + Intergenic
948079280 2:235192139-235192161 CCGCCCTTCCCAGCCTCCCTGGG + Intergenic
948191958 2:236066094-236066116 CCACCCTGCCCAAGCTCTGGAGG + Intronic
948273114 2:236688860-236688882 TCTCCCTGCCCTCCCTCCCATGG + Intergenic
948280273 2:236741618-236741640 CCACCCTGTCTGACCTCTCAAGG + Intergenic
948417341 2:237820758-237820780 CCACCTTGCCCAACCCCACTTGG - Intronic
948479949 2:238242989-238243011 CCACCCTGCCCAGCCTCTGCTGG - Intergenic
948553952 2:238794697-238794719 CCACCCTAACCAACCCCACAGGG + Intergenic
948553981 2:238794827-238794849 CCACCCTAACCAACCCCACAGGG + Intergenic
948554024 2:238795021-238795043 CCACCCTAACCAACCCCACAGGG + Intergenic
948554082 2:238795277-238795299 CCACCCTAACCAACCCCACAGGG + Intergenic
948554111 2:238795405-238795427 CCACCCTAACCAACCCCACAGGG + Intergenic
948636995 2:239345000-239345022 CCACCTTGTCCAAGCTCCCCTGG + Intronic
948779481 2:240310129-240310151 CCCACCTCCCCTACCTCCCAGGG + Intergenic
949047230 2:241877683-241877705 CCCCCCTCCCCGACCTCCCCAGG + Intergenic
1169147306 20:3261278-3261300 CCTCCCTCCACAGCCTCCCAAGG + Intronic
1170032814 20:11959989-11960011 GCACCCTGCCCAGACCCCCAGGG - Intergenic
1171186230 20:23126176-23126198 CCACTCTCCCCAAGCACCCAAGG + Intergenic
1171499434 20:25582012-25582034 CCACCCCGCTCGGCCTCCCAAGG - Intronic
1171844333 20:30255786-30255808 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1172590051 20:36111496-36111518 CCACCATGCCCGGCCTCCCTCGG - Intronic
1172604793 20:36207136-36207158 TCTCCAAGCCCAACCTCCCATGG + Intronic
1172963297 20:38814038-38814060 CCACCCGGCTCGGCCTCCCAGGG + Intronic
1173136135 20:40440811-40440833 CCACCCTCCTCAGCCTCCCAAGG + Intergenic
1173576960 20:44118472-44118494 CTACCCTGCCCATCCTTCCCTGG + Intronic
1173632635 20:44528165-44528187 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1173916274 20:46710552-46710574 CCACCCTGACCACCTACCCAAGG - Intronic
1174311028 20:49654817-49654839 CCACCATACCCAGCCTCCTATGG - Intronic
1174406963 20:50309009-50309031 CAAGCCTGCCCTCCCTCCCAGGG + Intergenic
1175062342 20:56255121-56255143 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1175085252 20:56452850-56452872 CCACCATGACAAACCTCTCAAGG - Exonic
1175094606 20:56531542-56531564 CCACCCACCTCACCCTCCCAAGG + Intergenic
1175202150 20:57285450-57285472 CCACCGCACCCAGCCTCCCAGGG + Intergenic
1175297138 20:57916189-57916211 CCACACTGTCCCTCCTCCCAGGG - Intergenic
1175326503 20:58132735-58132757 CCTCCCTCCTCAGCCTCCCAAGG - Intergenic
1175487875 20:59358280-59358302 ACCCCCTGCCCGACCTCCCTGGG - Intergenic
1175527786 20:59647452-59647474 CCACCCTCCCCAACCTCAGGGGG - Intronic
1175867392 20:62186814-62186836 CCACCGTGCCCAGCCTTCCCTGG + Intronic
1175902012 20:62363701-62363723 CTACCCCGCCCAGCCTCCCTTGG + Intronic
1176095217 20:63338890-63338912 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1176596870 21:8705668-8705690 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1176620400 21:9053967-9053989 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1177774414 21:25551892-25551914 CCACCAGGCCCTACCTCCAAGGG + Intergenic
1177777753 21:25588066-25588088 CCACCCCCCTCAGCCTCCCAAGG - Intronic
1177807631 21:25889595-25889617 CCGCCCTCCCCAACCTCCCAAGG - Intronic
1178244091 21:30935531-30935553 CCACCCTGCCCACGGTACCAGGG + Intergenic
1178429018 21:32502871-32502893 CCACCCACCTCATCCTCCCAAGG + Intronic
1178558343 21:33614196-33614218 CCACCATGCCCAACCCATCAGGG - Intronic
1178725966 21:35051870-35051892 CCACCCCGCCCCCCCACCCATGG - Intronic
1178806103 21:35840954-35840976 CCACCTGCCCCAGCCTCCCAAGG + Intronic
1178887143 21:36493322-36493344 CCTCCGTGCCCTGCCTCCCAGGG - Intronic
1178891290 21:36523042-36523064 CCACCCCTCCCCACCTCCCCAGG + Intronic
1179124894 21:38581798-38581820 CCACCCTCCTCGGCCTCCCAAGG - Intronic
1179576612 21:42312312-42312334 CCACGCTGCCCAGCTTCCCAAGG + Intronic
1179580448 21:42340127-42340149 CCACCATGCCCAGCCACACAAGG + Intergenic
1179832860 21:44009030-44009052 CCACCGTGCCCAGCCTCCTTTGG + Intergenic
1179995730 21:44973313-44973335 TCACCCTGCCCACCCTCTCCAGG + Intronic
1180279790 22:10683110-10683132 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1180587008 22:16901636-16901658 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1180648522 22:17359702-17359724 CAACGCTGACAAACCTCCCATGG + Intergenic
1181059684 22:20276424-20276446 CCCCCCTGCCCAACCTTCACAGG + Intronic
1181141396 22:20807820-20807842 CCACACTGTCCATCATCCCAAGG + Intronic
1181162646 22:20967220-20967242 CCTCCCTGCCCGGCCTTCCAAGG + Intronic
1181175533 22:21032670-21032692 CCACTCTGCCCGACCTCGCAAGG + Intronic
1181327058 22:22058037-22058059 CCACCCCCCCCAAACTCCCCAGG + Intergenic
1181347737 22:22232365-22232387 CCACCCACCTCAGCCTCCCATGG - Intergenic
1181425700 22:22836905-22836927 CCTCCCTGCTCAACCTCCCAAGG + Intronic
1181433393 22:22896217-22896239 ACACCCCACCCAACCTGCCAGGG + Intergenic
1181530910 22:23516839-23516861 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1181668727 22:24415746-24415768 CCACCATGCCCGCCCTCCCCAGG + Exonic
1182033341 22:27177889-27177911 CCACCATGCCCAGCCTCCAGTGG - Intergenic
1182286463 22:29251323-29251345 CCACCCACCTCAGCCTCCCAGGG + Intronic
1182335649 22:29581647-29581669 CCACCATGCCCAGCCTACCAAGG + Intergenic
1182724059 22:32428419-32428441 CCACCCTGCCCGGCCTCTCATGG + Intronic
1182807161 22:33082780-33082802 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1183142432 22:35955540-35955562 CCACCCTACCCCACCCCCCATGG - Intronic
1183202787 22:36397428-36397450 CCACCGTGCCCAACCACCTAGGG + Intergenic
1183347769 22:37317414-37317436 TCACCTGGCCCAACCTCTCAGGG - Intergenic
1183639954 22:39086760-39086782 CCACCCTCCCCGCCCTCCCCAGG - Intronic
1183661520 22:39224350-39224372 ACACCCTGCACAACCTTACATGG + Exonic
1183886172 22:40884575-40884597 CCACCCCCCTCAGCCTCCCAGGG + Intronic
1184103434 22:42353782-42353804 CCACCTCGCCCAGCCACCCATGG + Intergenic
1184160321 22:42693734-42693756 CCCCCCACCCCACCCTCCCACGG - Exonic
1184184147 22:42853005-42853027 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1184291140 22:43498741-43498763 CCACCCAGCCCAACATCCCCAGG + Intronic
1184341904 22:43890892-43890914 CCACCCTGCCGACCCTCTCTGGG + Intronic
1184650905 22:45919090-45919112 CTGCCCTGCACATCCTCCCAGGG - Intergenic
1185173065 22:49304669-49304691 CCACCCCGAGCAACCTCCCTGGG + Intergenic
1185246773 22:49776897-49776919 CCACCCTGGCCAACCTCCCGGGG - Intronic
1185313680 22:50170042-50170064 CACCCCTGCCCACCCTCCCGCGG + Intergenic
1185373221 22:50470326-50470348 CCACTCTGCCCATCCTCCTGGGG - Intronic
949464147 3:4326806-4326828 CCACCATGCCCAGCCTCCAAGGG + Intronic
949866662 3:8552964-8552986 CCACCCGCCTCAGCCTCCCAAGG + Intronic
950019014 3:9773284-9773306 CCACCCGCCTCAGCCTCCCAAGG - Intronic
950409586 3:12826690-12826712 CCATCATGCCCAACCTACCTGGG + Intronic
950424410 3:12917013-12917035 CCACCCTGCCCCACCTGCTCAGG - Intronic
950779626 3:15380096-15380118 CCACCATGCCCAACCAGCCTGGG + Intergenic
951558761 3:23945685-23945707 CCACCCCGCCCCACCGGCCATGG - Intronic
952217703 3:31294300-31294322 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
952457837 3:33490804-33490826 CCACTCTGCTCTACCTCCCTTGG + Intergenic
952615432 3:35266193-35266215 CCACCCGTCTCAGCCTCCCAAGG - Intergenic
953182455 3:40608677-40608699 CCACTCTGGAAAACCTCCCAAGG + Intergenic
953334495 3:42082353-42082375 CCACCCACCTCAGCCTCCCAAGG - Intronic
953436652 3:42882503-42882525 CTGCCCTCCCCACCCTCCCAAGG - Intronic
953475007 3:43197960-43197982 CTCCCTTGCCCCACCTCCCAAGG - Intergenic
953504072 3:43466127-43466149 CCACCCTCCTCAGCCTCCCAAGG - Intronic
953563868 3:44014631-44014653 CCACCCTGCCCCACCACCTCAGG + Intergenic
953726278 3:45401857-45401879 CCACCCACCTCAGCCTCCCAAGG + Intronic
954065757 3:48104652-48104674 CCACCGTGCCCAGCCTCCCTCGG + Intergenic
954467564 3:50665382-50665404 CCACCCTGCCCCCACCCCCAAGG + Intergenic
954615370 3:51966657-51966679 CCACCCGGCCCCAGCACCCAGGG - Intronic
954724041 3:52592066-52592088 CCACCCGCCTCAGCCTCCCAAGG + Intronic
954812567 3:53257040-53257062 CCACCATGCCCAGCCACTCAGGG + Intergenic
954892874 3:53947199-53947221 CCTCCCACCTCAACCTCCCAAGG - Intergenic
954942944 3:54391796-54391818 CCACCATGCCCAGCCTGGCAGGG + Intronic
954980554 3:54741497-54741519 CCACCCACCTCAGCCTCCCAGGG - Intronic
955151487 3:56371668-56371690 CCTCTCTACCCCACCTCCCAAGG + Intronic
955689687 3:61578858-61578880 CCACCCTGCCAAACATTCCCTGG - Intronic
955721863 3:61891074-61891096 CCACCCACCTCAGCCTCCCAAGG - Intronic
955828843 3:62980045-62980067 CCTCCCACCCCAGCCTCCCAAGG + Intergenic
955856606 3:63279032-63279054 CCCCCCTCCCCTATCTCCCAAGG - Intronic
955875641 3:63487798-63487820 CCACCGATGCCAACCTCCCAAGG - Intronic
955914329 3:63891564-63891586 CCTCCCTCCTCAGCCTCCCAAGG + Intronic
957605361 3:82391807-82391829 CCACCGTGCCCAGCCGCCTAAGG - Intergenic
958614541 3:96474752-96474774 CCAGACTGCCAAACCTCCCATGG - Intergenic
959013283 3:101103900-101103922 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
961252419 3:125518757-125518779 CCACCCTCCTCGGCCTCCCAAGG - Intronic
961558827 3:127714934-127714956 ACACCCATCCCAACATCCCAGGG + Intronic
961865822 3:129952906-129952928 TCACCCTGCCACACATCCCAAGG - Intergenic
961867484 3:129964249-129964271 CCATGCTGTCCAACCTCTCAGGG - Intergenic
962560468 3:136601102-136601124 CCACCCGCCTCAGCCTCCCAAGG + Intronic
963180868 3:142354772-142354794 CCACCCACCCCAGCCTCTCAAGG + Intronic
963384069 3:144568523-144568545 CCACCGCGCCCAGCCTCCGATGG - Intergenic
964147809 3:153487023-153487045 CCACCGCGCCCAACCTGACATGG - Intronic
964308633 3:155368483-155368505 CCACCATGCCCAGCCTCACTGGG + Intergenic
965497906 3:169420388-169420410 ACACCCAGCCCAACTTACCATGG - Intronic
966051281 3:175619933-175619955 CCAACATGCCCAACCCCCCGAGG + Intronic
966516091 3:180822136-180822158 CCACCCTCCACCAACTCCCAGGG - Intronic
966594580 3:181713594-181713616 CCGCCCTCCCCACCCTCCCCAGG - Exonic
966838105 3:184065297-184065319 CCACCATGCCCAGCCTCTTATGG + Intergenic
967008477 3:185408326-185408348 CCACCCGCCTCAGCCTCCCAAGG - Intronic
967310602 3:188102621-188102643 CCACCCACCTCAGCCTCCCAAGG + Intergenic
967860705 3:194149190-194149212 CCACCGTGCCCGGCCTCCCTGGG + Intergenic
968177630 3:196565285-196565307 CCACCACGCCCAGCCTCCCCTGG - Intronic
968285857 3:197508377-197508399 CCACCCTGCCTATCCTGCCTGGG + Intergenic
968314152 3:197708377-197708399 CCACCCACCTCAGCCTCCCAAGG + Intronic
968456204 4:701442-701464 CCTCCCACCTCAACCTCCCAAGG + Intergenic
968548419 4:1210327-1210349 CCACCCTTCCCACCCTGCCCAGG + Intergenic
968574354 4:1358101-1358123 CCACCCTGACCCAGCGCCCAGGG + Intronic
968630892 4:1650737-1650759 CCACCCGCCTCAGCCTCCCAAGG + Intronic
968651071 4:1760537-1760559 GCACCCAGCCCAACCAACCATGG - Intergenic
968681116 4:1920624-1920646 CCTCCCACCTCAACCTCCCAAGG - Intronic
968738720 4:2315558-2315580 CCACTGTGCCCAACCTCCTTCGG + Intronic
968936179 4:3611677-3611699 CCACCCTGCCCCACCACCCCCGG - Intergenic
968983398 4:3863030-3863052 CCACCTTTTGCAACCTCCCATGG - Intergenic
971379774 4:26086016-26086038 GCAACCTGCACAACCTTCCATGG - Intergenic
971382650 4:26113038-26113060 CCACCGTGCCCAACCTATAAGGG + Intergenic
971384442 4:26130146-26130168 CCACCATGCCCAGCCTCAGAGGG + Intergenic
971422930 4:26490511-26490533 TCACCCCGCCCCACCTCCCCCGG + Intergenic
973260343 4:48157479-48157501 CCACCCTGTGCCACATCCCAAGG + Intronic
973262747 4:48181350-48181372 CAGCCCTGCCTAACCTCCCAGGG - Intronic
973699776 4:53525236-53525258 CCGCCCTCCTCACCCTCCCAAGG - Intronic
974531307 4:63111093-63111115 CCACCCACCTCAGCCTCCCAAGG - Intergenic
974565849 4:63577634-63577656 CTACCCTGTCCAATCTGCCATGG - Intergenic
975237663 4:72018937-72018959 CCACCCACCTCAGCCTCCCAAGG + Intergenic
976366171 4:84234811-84234833 TCACCCTTCTCAGCCTCCCAAGG - Intergenic
976933364 4:90597797-90597819 TCTCCCTGCCCCACCTGCCATGG + Intronic
977034383 4:91931353-91931375 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
977395961 4:96470554-96470576 CCACCCACCTCAGCCTCCCAAGG - Intergenic
978018784 4:103782917-103782939 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
979063912 4:116102352-116102374 CCACCATGCCCAGCCTCCTCTGG - Intergenic
979246180 4:118507242-118507264 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
979277721 4:118831957-118831979 CCACCCGCCTCCACCTCCCAAGG - Intronic
980793529 4:137651101-137651123 CCACCATGCCCGACCTCCACAGG - Intergenic
981532702 4:145767426-145767448 CCACCCTCCCCACCCCACCAGGG - Intronic
981692804 4:147528465-147528487 CCTCCCACCCCAGCCTCCCAAGG + Intronic
981766068 4:148251320-148251342 CCATCCTTCCCATCCTGCCAAGG + Intronic
982006263 4:151065624-151065646 CCACCCGTCTCGACCTCCCAAGG - Intergenic
982352075 4:154426688-154426710 CCTCCCTCCTCAGCCTCCCAAGG - Intronic
982748534 4:159131395-159131417 CCACCGCGCCCAGCCTCGCATGG + Intronic
982754288 4:159200222-159200244 CCACCCACCTCAGCCTCCCAAGG - Intronic
983217822 4:165018451-165018473 CCACCCGCCTCAGCCTCCCACGG - Intergenic
983554393 4:169046835-169046857 CCACCGTGCCCAGCCACACATGG + Intergenic
983610797 4:169642808-169642830 CCACCGTGCCCGTCCTCACAGGG + Intronic
984127590 4:175831597-175831619 CCACCCTTCTCCACCTCCTAGGG + Intronic
984789355 4:183600725-183600747 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
984926519 4:184811973-184811995 GCAACCGGCCCAACCTTCCAGGG + Intronic
984989157 4:185361492-185361514 CCACCCGCCTCAGCCTCCCAAGG - Intronic
985087858 4:186332394-186332416 CCACCGTGCCCGGCCTCCCCTGG + Intergenic
985113491 4:186569492-186569514 CCACCCTGAGCAACATCGCAAGG + Intergenic
985362198 4:189187338-189187360 CCACCGTGCCCAGCCTAACAAGG + Intergenic
985513379 5:324540-324562 CCACCCGCCTCAGCCTCCCAAGG - Intronic
985521593 5:376277-376299 CCCTCCTGCCCAACCCCCCAGGG - Intronic
985590239 5:760812-760834 TGACCCGGCCCACCCTCCCAAGG + Intronic
985784719 5:1887644-1887666 CCCCCCTCCCCCACCCCCCAAGG + Intergenic
986064753 5:4224173-4224195 CCACCCTGCCCCAACTACCAGGG - Intergenic
986068437 5:4258902-4258924 CCATCCGCCTCAACCTCCCAAGG + Intergenic
986345042 5:6826979-6827001 CCACCATGCCCATCCTACCAGGG + Intergenic
986751951 5:10795175-10795197 CCGCCATGTCCAACCTCACAAGG - Intergenic
986864212 5:11965822-11965844 CCACCCACCTCAGCCTCCCAAGG + Intergenic
987322755 5:16785624-16785646 CCACCCGCCTCAGCCTCCCATGG - Intronic
988075741 5:26352225-26352247 CCACCGTGCCCAGCCTGCAAAGG - Intergenic
988204436 5:28115685-28115707 CCACCCCGCCCTGCCTCCCATGG + Intergenic
988456764 5:31393837-31393859 CCACCCTCCTCAGCCTCCCACGG - Intergenic
988506444 5:31827447-31827469 CCACCCACCTCAGCCTCCCAAGG - Intronic
988553846 5:32219966-32219988 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
988776218 5:34480115-34480137 CCAGCCTCCCCACCCTCCCTGGG - Intergenic
988882307 5:35516814-35516836 CCAACCCTCCCAACCTTCCATGG + Intergenic
989585612 5:43072021-43072043 CCATCCTCCTCAGCCTCCCAAGG + Intronic
990244595 5:53851939-53851961 CCACCCGCCTCAGCCTCCCACGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990494546 5:56334559-56334581 CCACCATGCCCAACCTCAGATGG - Intergenic
990675350 5:58178170-58178192 CCACCCACCTCAGCCTCCCAAGG + Intergenic
990741177 5:58914390-58914412 CCACCCTCCTCAGCCTCCCAAGG - Intergenic
991566458 5:68010213-68010235 CCACCCCCCTCAGCCTCCCAAGG + Intergenic
991696302 5:69276270-69276292 CCACCCGCCTCAGCCTCCCAAGG + Intronic
991700917 5:69315511-69315533 CCACCCTCCTCAGCCTCCCAAGG - Intronic
992329977 5:75706670-75706692 CCTCCCACCCCAGCCTCCCAAGG + Intronic
992400813 5:76409532-76409554 CCACCATGCCCAGCCTTACATGG + Intronic
992448629 5:76855880-76855902 CCACCAGGCCCCACCTCCAATGG - Intronic
992772854 5:80064621-80064643 CCTCCCACCTCAACCTCCCAAGG - Intronic
993093496 5:83455951-83455973 CCACCCACCTCAGCCTCCCAAGG - Intergenic
995019928 5:107354706-107354728 CCACCGTGCCCAGCCTTCTAGGG + Intergenic
995114783 5:108467535-108467557 CCACCCACCTCAGCCTCCCAAGG + Intergenic
996304740 5:122034065-122034087 CCACCCGCCTCAGCCTCCCATGG + Intronic
996538292 5:124601656-124601678 CCACCCACCTCAGCCTCCCAAGG + Intergenic
996555892 5:124778564-124778586 CCACCCACCTCAGCCTCCCAAGG + Intergenic
996815074 5:127565521-127565543 CCAGCCAGCCCCACCTCACACGG - Intergenic
997170574 5:131715240-131715262 CCACCCACCTCAGCCTCCCAAGG - Intronic
997986110 5:138502736-138502758 CCACTGTGCCCAGCCTCCCCAGG - Intergenic
998435424 5:142103997-142104019 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
999045433 5:148463421-148463443 CCACCCAGCTCGACCTCCCAAGG + Intronic
999164471 5:149536238-149536260 CCACCGTGCCCAGCCTCAAATGG + Intronic
999323404 5:150628308-150628330 CTACCCTGTCCAGCCTCCCAGGG + Intronic
999395792 5:151226635-151226657 CCACCCGCCTCAGCCTCCCAAGG - Intronic
999771707 5:154780816-154780838 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1001497752 5:172201763-172201785 CCTCCCTTCTCAGCCTCCCAGGG - Intronic
1001590153 5:172859368-172859390 CCACCCACCCCCAACTCCCATGG + Intronic
1001643206 5:173260193-173260215 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1001758220 5:174186850-174186872 CCTCCCTGCCCAAATTCTCAGGG - Intronic
1002012918 5:176298327-176298349 CCACCCACCTCGACCTCCCAAGG + Intronic
1002096567 5:176834783-176834805 TGAGCCTGCCCCACCTCCCAGGG + Intronic
1002436510 5:179234946-179234968 CCTGCCTGCCAACCCTCCCAGGG + Intronic
1003083628 6:3043155-3043177 CCACCCTCCTCAGCCTCCCAAGG - Intergenic
1003113165 6:3265574-3265596 ACACCCTGCCCTATATCCCAGGG - Intronic
1003277423 6:4664517-4664539 CCACCCAGCCCCACTTCCCAAGG + Intergenic
1003497873 6:6679791-6679813 CCTCCCTGCCCACCCTGGCAGGG - Intergenic
1003559334 6:7167971-7167993 CCACCGTGCCCAGCCTGACATGG - Intronic
1004141558 6:13022771-13022793 CCACCCATCTCAGCCTCCCAAGG - Intronic
1004865513 6:19849740-19849762 CCACCATGCCCAGCCTCAAAAGG - Intergenic
1005034305 6:21541716-21541738 CCACCGTGCCCAGCCCTCCATGG - Intergenic
1005038695 6:21581723-21581745 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1005508207 6:26488768-26488790 CCACCCTCCTCGCCCTCCCAAGG - Intergenic
1005634950 6:27744385-27744407 CCACTGTGCCCAGCCTCTCACGG + Intergenic
1006047060 6:31307577-31307599 CCTCCCTCCCCACCCACCCATGG + Intronic
1006370541 6:33641287-33641309 CCACCCTGCCCAACACGCCCAGG - Intronic
1006374047 6:33662220-33662242 ACACCCTGCCTAACCTCTAACGG - Intronic
1006651295 6:35554005-35554027 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1006798176 6:36743973-36743995 CCACCCTCCCCAGACTCCCAGGG + Intronic
1006851906 6:37104498-37104520 CCACCGCACCCAACCTCCCTCGG + Intergenic
1006934231 6:37706014-37706036 CCTCCATGCCCACCATCCCAGGG + Intergenic
1007128584 6:39448416-39448438 CCACCCGCCTCATCCTCCCAAGG + Intronic
1007336126 6:41156517-41156539 CCACCCCACTCAGCCTCCCAAGG + Intergenic
1007425976 6:41746378-41746400 CCACCCAGGCCAACTTCCCGTGG - Intronic
1007497705 6:42272350-42272372 CCACCCTCCCCTTCCACCCACGG - Intronic
1007591399 6:43022989-43023011 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1008094607 6:47326910-47326932 CCACCCTCCCCGACAACCCAAGG - Intergenic
1008160256 6:48068313-48068335 TCACCCTGCCATACCTCCCAGGG + Exonic
1008209255 6:48701573-48701595 TCACCCTGCCATACCACCCAGGG + Intergenic
1008616242 6:53229259-53229281 CCACCCGCCTCAGCCTCCCAGGG - Intergenic
1010214823 6:73392545-73392567 CTACCCACCTCAACCTCCCAAGG + Intronic
1010800200 6:80166410-80166432 CCACCCGCCTCGACCTCCCACGG - Intronic
1010990842 6:82478467-82478489 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1011613348 6:89175051-89175073 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1011658881 6:89577040-89577062 CCACCATGCCCAGCCTTCCTGGG + Intronic
1011914730 6:92489101-92489123 CCACCCTGCCCCCCATCCCCAGG - Intergenic
1012917630 6:105187562-105187584 CCACCCACCTCAACCTCCCAGGG - Intergenic
1013182089 6:107726288-107726310 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1014098544 6:117484590-117484612 CCACCCACCCCGGCCTCCCAAGG + Intronic
1015985306 6:138878688-138878710 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1016381059 6:143480765-143480787 CCACCCACCTCAGCCTCCCAAGG - Intronic
1016955494 6:149622745-149622767 CCCCCCTGCCAGGCCTCCCAAGG - Intronic
1016979838 6:149843965-149843987 CCACCGTGCCCAACCAAGCATGG - Intronic
1017905244 6:158753485-158753507 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1018560581 6:165097899-165097921 CAACCCTGCCCAATCTGCAATGG + Intergenic
1018788476 6:167127742-167127764 CCACCCACCTCAGCCTCCCAAGG + Intronic
1018957288 6:168418761-168418783 CCTCCCTGCCCAGGCTCCCCAGG + Intergenic
1019034149 6:169040863-169040885 GCACCCTGCCCACCCTGCGATGG + Intergenic
1019616421 7:1964955-1964977 TCACCCAGGCCAGCCTCCCACGG + Intronic
1019750147 7:2724160-2724182 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1019766872 7:2857915-2857937 CCACCCACCTCAGCCTCCCAGGG - Intergenic
1020104150 7:5413395-5413417 CTTACCTGCCCAACCTCCAAAGG + Intronic
1020195370 7:6034072-6034094 CCACCCACCTCAGCCTCCCATGG - Intronic
1020217873 7:6208768-6208790 CCTCCCTCCTCAGCCTCCCAAGG + Intronic
1020234223 7:6343131-6343153 CCACCCTCCTCGGCCTCCCAAGG - Intronic
1020246728 7:6435198-6435220 CCACCATGCCCAGCCTCATAAGG - Intronic
1020259201 7:6521256-6521278 CCACCATGCCCAGCCTCACTGGG + Intronic
1020920644 7:14259667-14259689 CCACCCACCTCAGCCTCCCAAGG + Intronic
1021121692 7:16802939-16802961 CCTCCCTCCTCAGCCTCCCAAGG + Intronic
1021551922 7:21879839-21879861 CCACCCTGCTCGGCCTCCCAAGG - Intronic
1021721752 7:23511126-23511148 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1022484603 7:30768662-30768684 TCCTCCTGCCTAACCTCCCAAGG - Intronic
1022724194 7:32965903-32965925 CCACCGCGCCCAGCCCCCCATGG - Intronic
1022979867 7:35594365-35594387 CCTCCCTGCTCACCTTCCCAAGG + Intergenic
1023064962 7:36367774-36367796 CCACCGTGGCCCGCCTCCCATGG - Intronic
1023692662 7:42807529-42807551 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1023726015 7:43143212-43143234 CCACCCACCTCAGCCTCCCAAGG + Intronic
1023953762 7:44869160-44869182 CCACCCCGCCCAGCCTCCTGAGG - Intergenic
1024066999 7:45746708-45746730 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1024190953 7:47009301-47009323 CCACCCATCTCAGCCTCCCAAGG - Intergenic
1025042729 7:55662306-55662328 CCAGCCTGCCCAACCCACCAGGG + Intergenic
1025049418 7:55721933-55721955 CCACCTCGCCCAGCCCCCCAGGG + Intergenic
1025171987 7:56767382-56767404 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1025625776 7:63219911-63219933 CCACCCTCCTCGGCCTCCCAAGG - Intergenic
1025656343 7:63523263-63523285 CCACCCTCCTCGGCCTCCCAAGG + Intergenic
1025699879 7:63808171-63808193 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1025704729 7:63852604-63852626 CCAACATGCCCGGCCTCCCATGG + Intergenic
1025766625 7:64460634-64460656 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1025832869 7:65069360-65069382 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1025900767 7:65742728-65742750 CCACCGCGCCCAGCCTCCCATGG + Intergenic
1026148807 7:67771146-67771168 CCTCCCTCCTCAACCTCCAAAGG + Intergenic
1026155283 7:67820842-67820864 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1026875189 7:73875379-73875401 CCACCGTGCCCGGCCTCCCCTGG + Intergenic
1027137699 7:75636984-75637006 CTACCCCACCCAACCTCCAAGGG + Intronic
1027821462 7:83050658-83050680 CCACCCACCTCAGCCTCCCAAGG - Intronic
1028213182 7:88100800-88100822 CCACCATGCCCAGCCTCCCAAGG + Intronic
1028787413 7:94811355-94811377 CCCCCCTGCCCTGCCTCCCCAGG - Intergenic
1028917305 7:96273353-96273375 CCTCCCTTCCCAACCTCAAATGG - Intronic
1028996836 7:97110154-97110176 CCACCCGCCTCAGCCTCCCAGGG - Intergenic
1029159905 7:98544210-98544232 CCACCCTGAACAGCCTGCCAGGG - Intergenic
1029303710 7:99603446-99603468 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1029359709 7:100079804-100079826 CCTCCCAGCTCAGCCTCCCAAGG + Intronic
1029478943 7:100801514-100801536 CCTCCCCTCCCAGCCTCCCAAGG - Intergenic
1030313112 7:108087571-108087593 CCTCACGGCCCAGCCTCCCATGG - Intronic
1030400253 7:109040399-109040421 CCACCGTGCCCGGCCTGCCATGG - Intergenic
1031342742 7:120624491-120624513 CCACCATGCCCAGCCCACCATGG - Intronic
1031718183 7:125134783-125134805 GCTCCCTGCCCAACCACCCCAGG + Intergenic
1032147805 7:129399967-129399989 CCACCCACCTCAGCCTCCCAAGG + Intronic
1032160484 7:129505763-129505785 CCACCATGCCCAGCCTGTCAAGG + Intronic
1032229466 7:130061684-130061706 CCACCCGCCTCACCCTCCCAAGG + Intergenic
1032312566 7:130802288-130802310 CCACCCTGTCAAACTTCCCGTGG + Intergenic
1032393872 7:131575146-131575168 CCACCCTTCTCGGCCTCCCAAGG - Intergenic
1032587400 7:133159782-133159804 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1032677054 7:134140897-134140919 CCTCCCTGCCCAGCTTCCCCAGG + Intronic
1032715594 7:134506473-134506495 CCACCCACCTCAACCTCCCAAGG - Intergenic
1033335322 7:140447358-140447380 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1033852520 7:145514861-145514883 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1033865610 7:145687363-145687385 CCACCCTCCCCTCCCTGCCAGGG + Intergenic
1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG + Intergenic
1034298813 7:149997155-149997177 CCACCCTCCCCGACCACCCCAGG + Intergenic
1034426693 7:151017830-151017852 CCACCCAGCCCAAACCCCCAGGG + Intronic
1034437251 7:151068894-151068916 CCACCCACCTCAGCCTCCCAAGG - Intronic
1034441735 7:151089074-151089096 CCCCCCTGCCCAGCCTCTCCTGG + Intronic
1034630443 7:152526341-152526363 CCACCCACCTCAGCCTCCCACGG - Intergenic
1034807204 7:154099626-154099648 CCACCCTCCCCGACCACCCCAGG - Intronic
1034949008 7:155284559-155284581 CCTCCGTGTCCAAGCTCCCAGGG + Intergenic
1035293170 7:157853023-157853045 CCACCCTCCCCATTCACCCATGG - Intronic
1035768072 8:2124339-2124361 CCACCCTGCCCTTCCATCCAGGG - Intronic
1036063582 8:5353662-5353684 CCACCCACCTCCACCTCCCAAGG + Intergenic
1036113574 8:5933434-5933456 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1036161029 8:6388666-6388688 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1036243266 8:7096399-7096421 CCACCCAGCTCGGCCTCCCAAGG + Intergenic
1036380437 8:8233022-8233044 CCACCCTGCACTGTCTCCCATGG - Intergenic
1036849128 8:12189638-12189660 CCACCCTGCACTGTCTCCCATGG + Intronic
1036870489 8:12431912-12431934 CCACCCTGCACTGTCTCCCATGG + Intronic
1036898565 8:12655031-12655053 CCACCCAGCTCGGCCTCCCAAGG - Intergenic
1037120496 8:15280127-15280149 CCACCCAGCTCAGCCTCCCAAGG + Intergenic
1037350890 8:17954182-17954204 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1037361470 8:18079031-18079053 CCACCCACCTCAGCCTCCCAAGG - Intronic
1037462012 8:19120666-19120688 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1037526286 8:19727592-19727614 CCAACCGCCTCAACCTCCCAAGG + Intronic
1037858675 8:22389456-22389478 CCAGCCTACCCCACCTCCCCCGG - Intronic
1037991507 8:23324439-23324461 CCACCCTGCCCAACCCCCCACGG - Intronic
1038556499 8:28523055-28523077 CCACCGTGCCCAGCCTCAAAGGG + Intronic
1038584680 8:28778104-28778126 CCAGCCTGCCCCTCCTTCCACGG - Intronic
1038756209 8:30343150-30343172 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1039055856 8:33535870-33535892 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1039546858 8:38416696-38416718 CCACCCGCCTCACCCTCCCAAGG + Intronic
1039621677 8:39002865-39002887 CCAGCCTGGGCAACCTCCGAGGG - Intronic
1039998771 8:42559171-42559193 CCACCTGCCCCAGCCTCCCAAGG + Intergenic
1040021644 8:42746127-42746149 CCACCCTGTCACACTTCCCATGG - Intergenic
1040360258 8:46658417-46658439 TCACCATGCCCAGCCTCCAAGGG + Intergenic
1040965543 8:53077725-53077747 CCACCATGCCCAAGCCCCCCCGG - Intergenic
1041673042 8:60512125-60512147 CCACCTGCCCCGACCTCCCAAGG + Intergenic
1042214510 8:66416658-66416680 CCATCCTTTCCACCCTCCCAGGG - Intergenic
1042218619 8:66451973-66451995 CCACCCTGCCCTACCACCTGCGG + Exonic
1042579836 8:70264384-70264406 CCACCCACCTCAGCCTCCCAAGG - Intronic
1042655575 8:71091872-71091894 CCACCCTGTCCCACATACCAAGG - Intergenic
1042832602 8:73048403-73048425 CCATCCACCTCAACCTCCCAAGG + Intergenic
1043408044 8:79959953-79959975 CAACACTGCCAAATCTCCCACGG + Intronic
1043923802 8:86014301-86014323 CCTCTCTGCCCAGACTCCCAGGG + Intronic
1043974726 8:86571597-86571619 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1044239410 8:89871039-89871061 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1044434483 8:92146087-92146109 CCACCGTGCCCAACCTCTCCTGG - Intergenic
1044851963 8:96437256-96437278 CCACCATGCTCAACCCCCTATGG + Intergenic
1045154007 8:99445354-99445376 CCTCCCACCTCAACCTCCCATGG - Intronic
1045272506 8:100674101-100674123 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1045366381 8:101479872-101479894 CCACCCACCTCGACCTCCCAGGG + Intergenic
1045455112 8:102370408-102370430 CCACCCACCTCAGCCTCCCAGGG + Intronic
1045557739 8:103231027-103231049 CAACCCACCCCCACCTCCCAGGG + Intergenic
1045747521 8:105440906-105440928 CCACCCGCCTCAGCCTCCCATGG - Intronic
1046966273 8:120169097-120169119 CCACCTTCCTCTACCTCCCAAGG + Intronic
1047012071 8:120683531-120683553 CCACCCTACCCACTTTCCCAGGG - Intronic
1047205727 8:122801957-122801979 TCACCCTGCCCAGCCACCCACGG + Intronic
1048314561 8:133352496-133352518 CCACCTTCCCCAACCTGCCCTGG - Intergenic
1049298432 8:141856018-141856040 CTCCCCAGCCCACCCTCCCATGG - Intergenic
1049299278 8:141861234-141861256 CCAGCCTGCCCAGCACCCCATGG - Intergenic
1049311951 8:141938087-141938109 CCACCCTGCTCAGCCTGCCCAGG + Intergenic
1049518511 8:143075458-143075480 CCACCCTCCTCGGCCTCCCAAGG - Intergenic
1049544837 8:143225770-143225792 GCACCCTGCCCAGCACCCCAAGG - Intergenic
1049742818 8:144249175-144249197 CCACCCTGCCCAGCCCTCCTCGG + Intronic
1049748695 8:144273664-144273686 CCACCCCGGCCCACCTCCCCGGG + Intronic
1049830595 8:144699146-144699168 CCTCACTGCCCCATCTCCCAGGG - Intergenic
1049912764 9:285465-285487 CCACCACCCCCAACCTCCCTTGG + Intronic
1050251971 9:3754083-3754105 CCACCTGCCTCAACCTCCCAAGG + Intergenic
1050295662 9:4202392-4202414 CCACCCACCTCAGCCTCCCAAGG + Intronic
1050709593 9:8446069-8446091 CCACACTCTCCAACCTCACAAGG + Intronic
1051096403 9:13470986-13471008 CTCCCCTACCCATCCTCCCATGG + Intergenic
1051822412 9:21182982-21183004 CCAGCCTGCCCAGCCTCCCCGGG - Intergenic
1051823648 9:21195037-21195059 CCAGCCTGCCCAGCCTCCCCGGG - Intergenic
1051825466 9:21213573-21213595 CCAGCCTGCCCAGCCTCCCCGGG - Intronic
1051827450 9:21235635-21235657 CCAGCCTGCCCAGCCTCCCCGGG - Intronic
1051830182 9:21267333-21267355 CCAGCCTGGCCAGCCTCCAAGGG - Intergenic
1051838102 9:21363428-21363450 CCAGCCTGTGCAGCCTCCCAGGG - Intergenic
1052000815 9:23277981-23278003 CCACCCTCCTCAGCCTCCCAAGG - Intergenic
1052908485 9:33858647-33858669 CCACCCACCCCAGCCTCCCAGGG + Intronic
1052974392 9:34400671-34400693 GCACCCTGCCCCGCTTCCCAGGG - Exonic
1053424935 9:38004445-38004467 CCCCCCAGCCCACCCTCCCAGGG + Intronic
1053695927 9:40639240-40639262 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1053942912 9:43270278-43270300 CCACCCTGCCTTCTCTCCCACGG - Intergenic
1054307174 9:63438458-63438480 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1054405907 9:64762450-64762472 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1054439533 9:65247937-65247959 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1054490874 9:65774002-65774024 CCACCCTGCCTTCTCTCCCATGG + Intergenic
1054717867 9:68575143-68575165 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1054811901 9:69441712-69441734 CAACCCTCCCCATTCTCCCAAGG - Intronic
1054959029 9:70946378-70946400 CTAACTTGCCCAAGCTCCCATGG - Intronic
1055027585 9:71738594-71738616 CCACCCGCCTCAGCCTCCCAAGG - Intronic
1055445098 9:76374678-76374700 TCACCCTGCCTGACCTCCCTGGG + Intergenic
1055445171 9:76375292-76375314 TCACCCTGCCTGACCTCCCTGGG + Intergenic
1055603435 9:77943908-77943930 CCACCCACCTCAGCCTCCCAAGG + Intronic
1055818110 9:80231533-80231555 CCACCCACCCCAACCACCCTGGG - Intergenic
1056361459 9:85861724-85861746 CCACCGTGCCCAGCCTTCTAAGG + Intergenic
1056387558 9:86111764-86111786 CCACCCACCCCAGCCTCCCAAGG + Intergenic
1056423968 9:86457723-86457745 CCTCCCTGGCCTACATCCCAGGG - Intergenic
1056537841 9:87546456-87546478 CCACCCACCCCTACCTCCTATGG - Intronic
1056740595 9:89251202-89251224 TCTCTCTGCCCACCCTCCCATGG + Intergenic
1056795950 9:89659108-89659130 ACACTCTGCCACACCTCCCAAGG - Intergenic
1057107088 9:92429541-92429563 CCGCCCTCCTCAGCCTCCCAAGG - Intronic
1057141800 9:92731000-92731022 CCACCCTGGCCAGCCACCCCGGG + Intronic
1057223223 9:93268855-93268877 TCACCCTGCCCTGTCTCCCATGG + Exonic
1057393564 9:94659568-94659590 CCACTGTGCCCAGCCTCTCATGG + Intergenic
1058447545 9:105067126-105067148 CCACCGCGCCCAGCCTTCCATGG - Intergenic
1058812528 9:108655055-108655077 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1059406531 9:114101502-114101524 CCACCATGCCCAACCTTGAAAGG + Intergenic
1059805240 9:117792357-117792379 CCCCCCTCCCCAATCCCCCAGGG - Intergenic
1060048180 9:120357668-120357690 CCACCCTGCCCAGGGACCCAAGG - Intergenic
1060372604 9:123088577-123088599 CCTCCCGCCCCAGCCTCCCAAGG - Intronic
1060488715 9:124065989-124066011 CCACCACGCCCAGCCTCTCATGG - Intergenic
1060680968 9:125563996-125564018 CCACCATGCCCAACCAGCAAAGG + Intronic
1060751268 9:126171038-126171060 CCTCCCTTCTCAACCCCCCAAGG + Intergenic
1060855556 9:126912816-126912838 CCACCGCGCCCAACCTGCCTCGG - Intergenic
1060990783 9:127847691-127847713 CCACCCATCTCAGCCTCCCAAGG + Intronic
1061516819 9:131094947-131094969 CCAACCAGCCCAACCGGCCAGGG + Intergenic
1061649127 9:132032108-132032130 CCCCCGTGCCCAGGCTCCCATGG - Intronic
1061658342 9:132110163-132110185 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1061678995 9:132233395-132233417 ACAATCTGCCCAGCCTCCCACGG - Intronic
1061707429 9:132463720-132463742 CCATTCAGCCCAACCACCCAGGG + Intronic
1062029573 9:134356142-134356164 CCACCCTGCTCCACCTGGCAGGG - Intronic
1062088847 9:134663439-134663461 CCGCCCTGGCCAACCTGGCAGGG + Intronic
1062138027 9:134939956-134939978 CCACCCTGTCCATCCTCCTGTGG - Intergenic
1062155158 9:135044022-135044044 CCACCCGCCTCGACCTCCCAAGG + Intergenic
1062349089 9:136130408-136130430 CCTCCCTGTCCATCCCCCCAGGG - Intergenic
1062395391 9:136350668-136350690 CCACCCTGCCCTACCCCACCTGG + Intronic
1062560858 9:137141300-137141322 CCTCTCTCCCCAGCCTCCCAAGG - Intronic
1202778374 9_KI270717v1_random:12853-12875 CCACCCTGCCTTCTCTCCCATGG - Intergenic
1185517920 X:714963-714985 CCAACCAACTCAACCTCCCAAGG - Intergenic
1185714048 X:2327054-2327076 CCACCCGCCTCAGCCTCCCAAGG + Intronic
1186416604 X:9388931-9388953 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1186468610 X:9804012-9804034 CCACCCAGTCCATCTTCCCAAGG - Intronic
1187249540 X:17584303-17584325 CCACCCTGCCCTCCCTCCCCAGG - Intronic
1187377762 X:18771869-18771891 CCACCCACCTCAACCTCCCAAGG - Intronic
1187731792 X:22262930-22262952 CCAGCCTGCCGTATCTCCCATGG - Intergenic
1187877048 X:23813006-23813028 CCACCTTGCCCAGCCTGACATGG - Intergenic
1188482059 X:30646392-30646414 CCTCCCACCTCAACCTCCCAAGG - Intergenic
1188860057 X:35244891-35244913 ACACACTGCCCACCCTGCCAAGG - Intergenic
1189342208 X:40212570-40212592 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1189468590 X:41297086-41297108 CCTCCCTCCTCAGCCTCCCAAGG + Intergenic
1189497098 X:41518688-41518710 ACACCCTGCACATCCTGCCAAGG + Intronic
1190167755 X:48087306-48087328 CCACCATGCTCAGCCTCCCCAGG - Intergenic
1190313737 X:49135895-49135917 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1190773114 X:53531552-53531574 CCACCCGCCTCAGCCTCCCAAGG + Intergenic
1191608655 X:63088047-63088069 CCACCCTGCCCAAGGTAACAAGG + Intergenic
1191868058 X:65721793-65721815 CCACCATGCCCAACCTAGCTAGG - Intronic
1191930359 X:66365381-66365403 GCTGCCTGCCCCACCTCCCAGGG + Intergenic
1192359925 X:70433012-70433034 CCACCCTCCCCCTCCTCCCCAGG + Exonic
1193034273 X:76932679-76932701 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1193183000 X:78480872-78480894 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1193406752 X:81109666-81109688 CTACCCTGCCCAACCCACCCTGG - Intergenic
1195257344 X:103103397-103103419 CCACCCGCCTCAACCTCCCAAGG + Intergenic
1195570254 X:106392522-106392544 CCACCCTACCCTACTTCTCAAGG + Intergenic
1195860064 X:109373969-109373991 CCTCCCTGGCCAACCCCACAGGG + Intronic
1196917689 X:120555696-120555718 CCACCCGCCTCCACCTCCCAAGG - Intronic
1197186580 X:123593823-123593845 TTTACCTGCCCAACCTCCCAGGG + Intergenic
1197210268 X:123822502-123822524 CCACCCACCTCAGCCTCCCAAGG + Intergenic
1198404010 X:136294640-136294662 CCACCCATCTCATCCTCCCAAGG - Intergenic
1198954938 X:142118522-142118544 CCACCCGCCTCAGCCTCCCAAGG - Intergenic
1198967453 X:142243338-142243360 CCACCCACCTCAGCCTCCCAAGG - Intergenic
1199758008 X:150882882-150882904 CCACCATGCCCGGCCTCTCATGG - Intronic
1200097531 X:153671222-153671244 CCACCCTCCCCAACCCAGCAGGG + Intronic
1201193687 Y:11471157-11471179 CCACCCTGCCTTCTCTCCCACGG - Intergenic