ID: 1132867999

View in Genome Browser
Species Human (GRCh38)
Location 16:2103338-2103360
Sequence CACCGACGGAGGCCTGGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 7, 1: 0, 2: 0, 3: 22, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132867987_1132867999 15 Left 1132867987 16:2103300-2103322 CCCGGCCGCAGGGTTGCTGCTGT 0: 1
1: 0
2: 1
3: 25
4: 190
Right 1132867999 16:2103338-2103360 CACCGACGGAGGCCTGGGGCTGG 0: 7
1: 0
2: 0
3: 22
4: 230
1132867992_1132867999 -8 Left 1132867992 16:2103323-2103345 CCAGGGTGACCACAGCACCGACG 0: 7
1: 0
2: 1
3: 10
4: 106
Right 1132867999 16:2103338-2103360 CACCGACGGAGGCCTGGGGCTGG 0: 7
1: 0
2: 0
3: 22
4: 230
1132867989_1132867999 10 Left 1132867989 16:2103305-2103327 CCGCAGGGTTGCTGCTGTCCAGG 0: 6
1: 1
2: 1
3: 39
4: 389
Right 1132867999 16:2103338-2103360 CACCGACGGAGGCCTGGGGCTGG 0: 7
1: 0
2: 0
3: 22
4: 230
1132867988_1132867999 14 Left 1132867988 16:2103301-2103323 CCGGCCGCAGGGTTGCTGCTGTC 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1132867999 16:2103338-2103360 CACCGACGGAGGCCTGGGGCTGG 0: 7
1: 0
2: 0
3: 22
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132867999 Original CRISPR CACCGACGGAGGCCTGGGGC TGG Exonic
900123760 1:1060434-1060456 CGCCGAGGGGGGCCGGGGGCAGG + Intergenic
900407472 1:2498910-2498932 CACTGAGGGAGGCCTGGGCAGGG - Intronic
900410304 1:2509677-2509699 CCCCGAAGGTGGCCTGGGGAGGG - Intronic
903065394 1:20696693-20696715 CACAGATGGAGGGGTGGGGCGGG - Intronic
903926207 1:26832558-26832580 CACAGACAGTGGCCCGGGGCAGG - Exonic
905580861 1:39081902-39081924 CAGCGGCCGAGCCCTGGGGCCGG - Intronic
905657894 1:39697565-39697587 CACCCATTGAGGCCTGGGGGTGG - Intronic
907012631 1:50977929-50977951 CAGCGAAGGAGGCCAGTGGCCGG + Intergenic
910369782 1:86503511-86503533 TGCCCACAGAGGCCTGGGGCAGG + Intergenic
914825885 1:151137919-151137941 CACAGAGGGAGGACTGTGGCGGG - Intronic
915073685 1:153292473-153292495 CACCCCCGCAGCCCTGGGGCAGG + Intergenic
915623357 1:157099414-157099436 CTCCAACGGTGGCCTAGGGCAGG - Intronic
918428960 1:184438578-184438600 CATGGACTGAGGTCTGGGGCTGG + Intronic
919070693 1:192751502-192751524 CTCCGCCGCAGCCCTGGGGCGGG + Intergenic
919809470 1:201399562-201399584 GAACGACGGACGCCCGGGGCCGG + Exonic
922239936 1:223748909-223748931 CAGCGGCCGAGGCCTGGGGTGGG - Intronic
922420854 1:225460405-225460427 CACCAACAGAGGCCCGGGGTGGG - Intergenic
922727334 1:227928527-227928549 CAATGAAGGAGGCATGGGGCAGG - Intronic
1063654737 10:7976645-7976667 CACCTTGGGAGGCCTGAGGCAGG - Intronic
1067177106 10:43957910-43957932 CATGGAGGGAGGCCTGGGGTGGG + Intergenic
1068092762 10:52453356-52453378 CACACACGGGGGCCTGTGGCGGG - Intergenic
1072020622 10:91395974-91395996 CACTGAGGCAGGCCTGGTGCTGG - Intergenic
1077008133 11:368888-368910 CACCGAGCGCGGCCTGAGGCAGG - Intergenic
1077222412 11:1423658-1423680 CAGCGGGGGAGGCTTGGGGCAGG - Intronic
1077406942 11:2386896-2386918 CCTCGGCAGAGGCCTGGGGCCGG + Intronic
1079773709 11:24497086-24497108 CACGAACGGACGCCTGGGGAAGG - Intronic
1080791431 11:35525633-35525655 GACCCAGGGAGGCCGGGGGCAGG + Intronic
1081597588 11:44469775-44469797 CACAGACGGAGGACGGGTGCTGG - Intergenic
1083616515 11:64029056-64029078 CACAGATGGTGCCCTGGGGCGGG - Intronic
1083621836 11:64053151-64053173 CCCAGACGGAGAGCTGGGGCTGG + Intronic
1083661336 11:64252825-64252847 TGCTGACGGAGGCTTGGGGCAGG + Intronic
1083726549 11:64631340-64631362 CAGGGACGGAGGCCTGGAGAAGG + Intronic
1085095951 11:73760841-73760863 CACCGAGCGAGGCCCGCGGCTGG + Exonic
1089080953 11:115775891-115775913 CAGAGATGGAGCCCTGGGGCAGG - Intergenic
1089604900 11:119636111-119636133 GAGCGATGGGGGCCTGGGGCTGG - Intronic
1090699714 11:129282720-129282742 CACGGTCAGAGCCCTGGGGCAGG - Intergenic
1091346574 11:134858182-134858204 CACTGACGGCAGCCTGGGACAGG + Intergenic
1094127143 12:27034995-27035017 CACTTAGGGAGGCCAGGGGCAGG - Intronic
1095866977 12:46983145-46983167 CACTGTGGCAGGCCTGGGGCAGG + Intergenic
1096069295 12:48766098-48766120 GGCCCACGGAGCCCTGGGGCAGG + Intergenic
1103601884 12:122059702-122059724 CTCCGATGAAGTCCTGGGGCAGG - Exonic
1103764595 12:123271458-123271480 CGCCCGCGGAGGCCGGGGGCGGG - Intronic
1103920144 12:124395085-124395107 CCCCGAGGGAGGGGTGGGGCTGG + Intronic
1104049346 12:125185777-125185799 CAGCGAAGGCGGCCTGGGGATGG - Intergenic
1104735021 12:131131263-131131285 CACAGCCGCAGGCCTGGGCCGGG + Intronic
1104932161 12:132345546-132345568 GACCGACTGAGACCTGGGGAGGG - Intergenic
1105437786 13:20391885-20391907 CAGCCAAGGAGGCCTCGGGCTGG - Intergenic
1108680945 13:52779662-52779684 CACCCACAGAGACCTGGGGTGGG - Intergenic
1110254977 13:73423349-73423371 CATCCAAGGAGGCCAGGGGCTGG + Intergenic
1110480943 13:75975407-75975429 CACAGAGGGAGGCAAGGGGCAGG + Intergenic
1113805984 13:113110208-113110230 CCAGGACGGAGGCCTGGGGAAGG + Intronic
1113868316 13:113543308-113543330 CACAGAGGGAGGGCGGGGGCAGG - Intronic
1117472789 14:56063242-56063264 CACAGGAGGAGGCCTGGAGCAGG - Intergenic
1121574368 14:94971403-94971425 CAGCCACTGAGGCCTGGGGGAGG - Intergenic
1122226921 14:100285673-100285695 CTCCGCCCGAGGCCTCGGGCAGG - Intergenic
1122399324 14:101457974-101457996 CACACACGCAGGCCTGGGCCGGG + Intergenic
1122939598 14:104975303-104975325 CACTGCCTGAGGCTTGGGGCAGG + Intronic
1124619409 15:31265331-31265353 CACAGAGAGAGGTCTGGGGCAGG + Intergenic
1125604686 15:40933161-40933183 CACCGGCGCAGGCCTGGGTAGGG + Intronic
1128139198 15:65286786-65286808 CCTCCGCGGAGGCCTGGGGCGGG + Exonic
1128520744 15:68373147-68373169 CACCGACGGCTTCCTGGAGCAGG - Intronic
1128525592 15:68410242-68410264 AACCAGTGGAGGCCTGGGGCAGG - Intronic
1129667585 15:77588192-77588214 CCCTGAGGGAGGCCAGGGGCTGG - Intergenic
1129842605 15:78753018-78753040 CACAGCAGGTGGCCTGGGGCAGG - Intergenic
1130571692 15:85051629-85051651 CACACACTGAGGCCTGTGGCAGG - Intronic
1130911777 15:88275907-88275929 CACCCACGGAGGCTGGGAGCTGG - Intergenic
1131252886 15:90842152-90842174 CACTGAGGGAGCCCAGGGGCTGG - Intergenic
1132554631 16:567086-567108 CACCGAGAGAGGCCGGGGGGAGG - Intronic
1132567499 16:630174-630196 CGCCGACGGGGGGCTGGGGCAGG + Intronic
1132801658 16:1757706-1757728 CGCAGACGCAGGCCTGGAGCTGG - Intronic
1132867999 16:2103338-2103360 CACCGACGGAGGCCTGGGGCTGG + Exonic
1132982063 16:2743297-2743319 CACCCACAGAGGGCTGGGGTGGG - Intergenic
1134169308 16:11955939-11955961 GACCAGAGGAGGCCTGGGGCTGG - Intronic
1134523772 16:14929776-14929798 CACCGACGGAGGCCTGGGGCTGG - Intronic
1134549130 16:15131159-15131181 CACCGACGGAGGCCTGGGGCTGG + Intronic
1134711363 16:16328261-16328283 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134719213 16:16371564-16371586 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134948213 16:18340321-18340343 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1134955466 16:18380432-18380454 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1135969400 16:27061351-27061373 CACTGAGGGAGCCCTGGGGAGGG - Intergenic
1136452215 16:30359756-30359778 CAGCCACGGGGGCCTGGGCCTGG + Exonic
1136517298 16:30775708-30775730 CACCGAGGCAGGACTGGGGCTGG + Exonic
1136622263 16:31436980-31437002 CAGCCCCCGAGGCCTGGGGCCGG - Exonic
1137055834 16:35746342-35746364 CGCCTAGGGAGACCTGGGGCTGG + Intergenic
1137675253 16:50300896-50300918 CAGGGACAGAGGCCTGGGGCTGG + Intronic
1137686303 16:50389379-50389401 CACCTACTCAGGCCAGGGGCAGG + Intergenic
1139748708 16:69095327-69095349 CACCGTGGCAGGCCTGGTGCTGG + Intergenic
1141426510 16:83947745-83947767 GGCCGAGGGAGGCCTGGGGAGGG + Intronic
1141548317 16:84787071-84787093 CACCCAGGAGGGCCTGGGGCTGG + Intergenic
1141716765 16:85731404-85731426 AACCCAGGGAGGCCTGGAGCTGG + Intronic
1143410166 17:6703908-6703930 CACCGAGGCCGGCCTGGAGCTGG - Exonic
1144950166 17:18989642-18989664 GCCCGACGGGGGGCTGGGGCGGG + Intronic
1147725182 17:42562508-42562530 CAGAGAAGGAGGCCTGGAGCAGG - Intronic
1149459976 17:56820573-56820595 CACAGACAGTGGCCCGGGGCTGG + Intronic
1150255268 17:63739878-63739900 CTCCGACGAAGGCCCGGGCCTGG + Intronic
1150255553 17:63741645-63741667 CTCCGACGAAGGCCCGGGCCTGG + Intronic
1151578637 17:74965079-74965101 CAGAGCCGGAGGCCTGTGGCGGG - Intronic
1152616759 17:81341525-81341547 GGCCGACGGAGGACCGGGGCGGG - Intergenic
1153278869 18:3395334-3395356 CACCCATGGAGGCCTGGAGCTGG + Intergenic
1153791133 18:8580809-8580831 CACCTTGGGAGGCCTGAGGCAGG + Intergenic
1155093700 18:22535803-22535825 CAGCTACTGAGTCCTGGGGCTGG - Intergenic
1160453694 18:78980964-78980986 CAGCGGCGGCGGCCTGGGCCTGG + Intronic
1160718261 19:586120-586142 CAGACACGGAGGCCTGGGGCAGG + Intergenic
1161086573 19:2338287-2338309 AATCCACGGAGGCCTGGTGCAGG + Intronic
1161219838 19:3113498-3113520 CACCGCTGGCGGCCTGGGGACGG + Intronic
1161319224 19:3633334-3633356 CAGGGACTGAGGCCCGGGGCGGG - Intronic
1162470916 19:10871639-10871661 CAGCGGCGGCGGCCTGGGCCCGG + Exonic
1162585225 19:11554147-11554169 CACCAAGGGAGGCAAGGGGCAGG + Intronic
1163086040 19:14980035-14980057 CCTCGGCGGAGGCCTGGGGAAGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165490608 19:36120963-36120985 GACAGACGGAGGCCTGGGGTGGG + Intronic
1165992692 19:39825567-39825589 CACTGATTGGGGCCTGGGGCAGG - Exonic
1167007998 19:46787890-46787912 CGCCAACGGGGGCCTGGCGCTGG - Exonic
1167213022 19:48145454-48145476 TACAGATGTAGGCCTGGGGCTGG - Intronic
1167383428 19:49150975-49150997 CACTGAGTGACGCCTGGGGCGGG - Exonic
1168115391 19:54219428-54219450 CCTCGCTGGAGGCCTGGGGCAGG - Intronic
1168115431 19:54219576-54219598 CAGTGACGGTGACCTGGGGCAGG - Intronic
1168121260 19:54253798-54253820 CAGTGACGGTGACCTGGGGCAGG - Intronic
1168124749 19:54277256-54277278 CAGAGACGGTGACCTGGGGCAGG - Intronic
1168132780 19:54331883-54331905 CAGAGACGGTGACCTGGGGCAGG - Intergenic
1168145006 19:54415772-54415794 CTCCGCCGGAGGCTGGGGGCCGG + Intronic
1168152402 19:54456082-54456104 CAGCGAGGGACGCCCGGGGCTGG + Exonic
1168177238 19:54634292-54634314 CAGAGACGGTGACCTGGGGCAGG + Intronic
1168181544 19:54665451-54665473 CAGAGACGGTGACCTGGGGCAGG + Intronic
926171650 2:10556477-10556499 CACCCATGGAGGCCTGGGATGGG - Intergenic
932337015 2:70937364-70937386 CACCTCCTGAGGCCTGAGGCAGG + Intronic
932821045 2:74900973-74900995 GACAGACAGAGGCTTGGGGCAGG - Intergenic
934747792 2:96770853-96770875 CAGCGACAGAGGCCTGGCCCAGG - Intronic
934990109 2:98914750-98914772 CATGGACTGAGGCCTGAGGCTGG + Intronic
936083215 2:109449260-109449282 CACCGAGTGGGGCCTGAGGCTGG - Exonic
938389631 2:130894533-130894555 CACGGAGGCAGGACTGGGGCAGG + Intronic
938444098 2:131363926-131363948 CACCGAGCGAGGCCCGCGGCTGG + Intergenic
940985691 2:160049940-160049962 CACACACTGAGGCCTGTGGCAGG + Intronic
941225213 2:162839251-162839273 CAGGGACGGAGCCCTGTGGCCGG - Intergenic
943037616 2:182766562-182766584 TACCCACAGAGGCCTGGGGCAGG + Intronic
946416323 2:219541801-219541823 CGCCGATGAAGTCCTGGGGCCGG + Exonic
948446613 2:238038358-238038380 CACCGACGGATGGCAGGGGTCGG - Intronic
948487263 2:238288823-238288845 CAATGGCGGAGGCCGGGGGCGGG - Intronic
948783876 2:240340860-240340882 CAGAAACAGAGGCCTGGGGCAGG + Intergenic
948988679 2:241541173-241541195 CACCGGCCGCGGCCAGGGGCGGG + Intergenic
949006445 2:241651950-241651972 CACCGGCGGAGAACTGAGGCCGG + Intronic
1170921961 20:20687582-20687604 CACTGACGGTTGCCTGGGGTTGG - Intronic
1172621282 20:36320027-36320049 CACAGAGGGAGGCCTGGGAGAGG - Intronic
1172621298 20:36320081-36320103 CACAGAGGGAGGCCTGGAGGAGG - Intronic
1172888374 20:38246797-38246819 CACCGAGGTAGGACTGGGGGAGG - Intronic
1174224175 20:48983568-48983590 CAGCAAGGGAGGCCAGGGGCTGG - Intronic
1176119277 20:63446719-63446741 CCCCGAGGGAGGGCGGGGGCTGG - Intronic
1176135907 20:63521895-63521917 CGCCTCCGCAGGCCTGGGGCTGG - Exonic
1176547247 21:8207316-8207338 CGCCGAGGGACGCCTGGGGAAGG - Intergenic
1176555152 21:8251525-8251547 CGCCGAGGGACGCCTGGGGAAGG - Intergenic
1176566198 21:8390363-8390385 CGCCGAGGGACGCCTGGGGAAGG - Intergenic
1176574072 21:8434549-8434571 CGCCGAGGGACGCCTGGGGAAGG - Intergenic
1181045512 22:20212321-20212343 CACCCAGGGAAGCCTGGGGCCGG - Intergenic
1181307796 22:21926878-21926900 CACTGCGGGAGGCCTGGGGGAGG + Intronic
1181720778 22:24772941-24772963 CACCCAGGGAGGCCTGGGGAGGG - Intronic
1182280279 22:29214410-29214432 CACCAGCAAAGGCCTGGGGCAGG + Intronic
1183020703 22:35023886-35023908 CACCAAGGGAGGCCATGGGCAGG + Intergenic
1183912856 22:41092125-41092147 CACCGCCGGCGGCCAGGTGCTGG - Exonic
1183980857 22:41539306-41539328 GGCGGAGGGAGGCCTGGGGCAGG + Intronic
1184468680 22:44683563-44683585 CCCCGAAGGAGGGCAGGGGCTGG + Intronic
1184985923 22:48134079-48134101 CACCAAGGCAGGGCTGGGGCAGG - Intergenic
1185138400 22:49086838-49086860 CCCCGACGGCCTCCTGGGGCTGG - Intergenic
1203252120 22_KI270733v1_random:123601-123623 CGCCGAGGGACGCCTGGGGAAGG - Intergenic
1203260174 22_KI270733v1_random:168684-168706 CGCCGAGGGACGCCTGGGGAAGG - Intergenic
950397362 3:12743926-12743948 CATCGACGGAGCCTGGGGGCTGG - Exonic
952485689 3:33807544-33807566 CACCTACGGCCCCCTGGGGCAGG + Intronic
954333540 3:49903441-49903463 CTCCGCCGGAGGCCTGGTACAGG - Exonic
954339351 3:49940426-49940448 AACCGTCGCGGGCCTGGGGCGGG + Intronic
954814507 3:53270136-53270158 CACCCTAGAAGGCCTGGGGCTGG + Intergenic
955768010 3:62365109-62365131 CACCTCCAAAGGCCTGGGGCTGG + Intergenic
961621022 3:128225173-128225195 CACTGACCTAGGGCTGGGGCTGG - Intronic
961621039 3:128225282-128225304 CACTGACCCAGGGCTGGGGCTGG - Intronic
961645953 3:128392896-128392918 CACTGAAGGAGGTCTGGGGAGGG - Intronic
964720500 3:159764301-159764323 CCCCCAAGGAGGCCTGGGGGCGG - Intronic
966249874 3:177852995-177853017 CACACACGGAGGCCTGTTGCGGG + Intergenic
967025602 3:185561356-185561378 TGCCTACAGAGGCCTGGGGCAGG + Intergenic
968728449 4:2258982-2259004 CACGGAAGGTGGCCTGGAGCTGG - Intronic
968751392 4:2391126-2391148 CACAGAGGGAGGGCTGCGGCGGG - Intronic
968897672 4:3414205-3414227 CACCGACGGGGTCCTGCAGCAGG - Exonic
969530267 4:7726607-7726629 CACCCAGGGAGGCATGGGGCGGG - Intronic
972508951 4:39749415-39749437 CACCTAGGGAGGCAGGGGGCAGG + Intronic
975839628 4:78459782-78459804 CAAGGAGAGAGGCCTGGGGCGGG - Intronic
975843154 4:78498091-78498113 CAGGGACGGGGGCCTGGGGAAGG + Intronic
977616087 4:99088751-99088773 CAGCGACGGAGGCATGGGCGTGG + Exonic
981987363 4:150874504-150874526 CCCCGTCGCAGGCCTGGGGTGGG + Intronic
983577077 4:169271216-169271238 CCCCGCCGGAGCCCGGGGGCGGG + Intergenic
984658305 4:182343907-182343929 CACTGAGGGAGGTCTGGAGCAGG + Intronic
984668070 4:182449099-182449121 CGGCGGCGGCGGCCTGGGGCGGG + Intronic
985648452 5:1096246-1096268 GAAAGACGGAGACCTGGGGCAGG + Intronic
992648922 5:78838234-78838256 CACAGAGGGAGACATGGGGCTGG + Intronic
992739790 5:79762228-79762250 CACCCAAGTTGGCCTGGGGCAGG + Intronic
992913737 5:81425917-81425939 CACAGAAGGAGGCCTGGGAAGGG - Intronic
998205983 5:140157256-140157278 CAGGGAGGGAGGCCCGGGGCTGG - Intergenic
999733860 5:154498010-154498032 CACAGATGGAGATCTGGGGCAGG - Intergenic
1001518666 5:172375111-172375133 CACTTTGGGAGGCCTGGGGCAGG + Intronic
1003556036 6:7141138-7141160 CACCGCGGGAGCCCTGGGGGCGG - Intronic
1003682319 6:8268290-8268312 CTCCTACGGTGGCCTGGGTCAGG + Intergenic
1005915249 6:30345481-30345503 CACCGAGGGATCCCTGGGGGCGG - Exonic
1006084714 6:31587648-31587670 TATCTACGGGGGCCTGGGGCTGG + Exonic
1007431312 6:41779106-41779128 CACCGACGGGGGCACGGCGCGGG + Intronic
1013225956 6:108119503-108119525 CACCGAGGAAGGCGTGGGGCAGG + Intronic
1013287034 6:108690741-108690763 CAGCTTTGGAGGCCTGGGGCAGG - Intergenic
1013754211 6:113441816-113441838 AACCGAGGGAGGACTGGGGGAGG + Intergenic
1016021978 6:139245578-139245600 TACCCACGGAGGCCAGAGGCTGG + Intronic
1018765817 6:166932115-166932137 CTCCTATGGAGGCCTGAGGCAGG + Intronic
1019309733 7:354108-354130 TGGAGACGGAGGCCTGGGGCCGG + Intergenic
1019325874 7:437996-438018 CACTGGCAGAGGCCTGGGTCAGG + Intergenic
1019442030 7:1052369-1052391 CACCGACGTGGGCCTGGGGAGGG + Intronic
1024247668 7:47482384-47482406 CTCAGACGGATGTCTGGGGCAGG + Intronic
1026047954 7:66921156-66921178 CACCGTCGGACGCCCGGGGTCGG + Intergenic
1026543005 7:71297244-71297266 CACCAAAAGACGCCTGGGGCCGG + Intronic
1033214581 7:139483929-139483951 CACCAGCGGAGGCTTGTGGCAGG + Intergenic
1034340261 7:150348326-150348348 CACCCAGGGAGGTCTGGGGCAGG + Intergenic
1034956534 7:155338722-155338744 CATTTACGGAGGCCTGGAGCCGG + Intergenic
1037635893 8:20700851-20700873 TTCCCAGGGAGGCCTGGGGCTGG + Intergenic
1038741488 8:30220767-30220789 CACCGAAGGAGGCTGTGGGCAGG - Intergenic
1040042888 8:42934553-42934575 CACCCACTGGGGCCTGGTGCGGG - Intronic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1047521905 8:125601443-125601465 CACAGACACAGGCCTGGGGAGGG + Intergenic
1047529769 8:125664355-125664377 AAGGGAGGGAGGCCTGGGGCTGG - Intergenic
1049103619 8:140597485-140597507 CAGGCAGGGAGGCCTGGGGCGGG - Intronic
1049181588 8:141225825-141225847 TGCCCAGGGAGGCCTGGGGCCGG - Intronic
1049454908 8:142681844-142681866 GACAGGAGGAGGCCTGGGGCAGG + Intronic
1049799934 8:144513013-144513035 CTCCGAGGGCGGCCTGGTGCAGG + Exonic
1049818919 8:144622367-144622389 CACAGAAGGAAGCCTGTGGCGGG - Intergenic
1049848733 8:144819477-144819499 CCCCAACAGTGGCCTGGGGCAGG - Intergenic
1051403088 9:16704850-16704872 CAGGGACGGAGGCCAGGGGAGGG + Intronic
1053009209 9:34623847-34623869 CACCCAGTGAGGCCAGGGGCGGG - Exonic
1053129243 9:35605703-35605725 CACGGGCGGAGGCCCGGGCCGGG + Exonic
1057274612 9:93669737-93669759 CACAGAGGGAGTCCTAGGGCTGG - Intronic
1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG + Intronic
1061057656 9:128232921-128232943 CCCCGAGGCAGGGCTGGGGCAGG - Intronic
1061059012 9:128241188-128241210 GACCCAAGGAGGCCTGGGGCTGG - Intronic
1061398914 9:130357923-130357945 CACCAACGGAGGCTTGGGGTGGG - Intronic
1061539914 9:131272606-131272628 CATCACAGGAGGCCTGGGGCAGG + Intronic
1061721150 9:132552190-132552212 CACAGATGCAGACCTGGGGCGGG - Intronic
1061773846 9:132947301-132947323 CACCTGCTGTGGCCTGGGGCTGG - Intronic
1061926050 9:133806546-133806568 GACAGAAAGAGGCCTGGGGCGGG - Intronic
1062245070 9:135561924-135561946 TACTGTGGGAGGCCTGGGGCGGG + Intronic
1062249741 9:135588124-135588146 TACCGTGGGAAGCCTGGGGCTGG + Intergenic
1062280525 9:135749763-135749785 CACCCACGGAGGCTTGGGCGAGG + Intronic
1062420092 9:136476549-136476571 CACCCACTGGGGGCTGGGGCCGG - Exonic
1062669009 9:137695354-137695376 CATGGACGGAGCCCTGGAGCTGG + Intronic
1203468523 Un_GL000220v1:106751-106773 CGCCGAGGGACGCCTGGGGAAGG - Intergenic
1203476344 Un_GL000220v1:150723-150745 CGCCGAGGGACGCCTGGGGAAGG - Intergenic
1191252025 X:58264321-58264343 CACCCACGCGGGCCTGGCGCAGG - Intergenic
1192507574 X:71698312-71698334 TGCCCACAGAGGCCTGGGGCAGG + Intergenic
1192519122 X:71783240-71783262 TGCCCACAGAGGCCTGGGGCAGG - Intergenic
1197853332 X:130888368-130888390 AACCGAAGGAGCACTGGGGCTGG + Intronic
1199951991 X:152714689-152714711 CGCCGAGGGAGGACTGAGGCGGG + Intronic
1199957692 X:152753759-152753781 CGCCGAGGGAGGACTGAGGCGGG - Intronic
1200042417 X:153379758-153379780 CACAGTGGGAGGCCTGGGGGAGG + Intergenic
1200988672 Y:9328208-9328230 CACCAGCTGAGGCCTGAGGCCGG + Intergenic
1202119315 Y:21507984-21508006 CACCGGCTGAGGCCTGAGGCCGG - Intergenic
1202121767 Y:21531524-21531546 CACCGGCTGAGGCCTGAGGCCGG - Intronic
1202157239 Y:21897858-21897880 CACCGGCTGAGGCCTGAGGCCGG + Intronic
1202159685 Y:21921399-21921421 CACCGGCTGAGGCCTGAGGCCGG + Intergenic
1202186131 Y:22186314-22186336 CACCGGCTGAGGCCTGAGGCCGG + Intergenic
1202205228 Y:22400082-22400104 CACCGGCTGAGGCCTGAGGCCGG - Intronic