ID: 1132870041

View in Genome Browser
Species Human (GRCh38)
Location 16:2111920-2111942
Sequence GGGGCTTCTGCCGAGCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 6, 1: 1, 2: 0, 3: 12, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132870041_1132870046 -6 Left 1132870041 16:2111920-2111942 CCCACCCGCTCGGCAGAAGCCCC 0: 6
1: 1
2: 0
3: 12
4: 128
Right 1132870046 16:2111937-2111959 AGCCCCCCGCCTGAGGAGCCCGG 0: 6
1: 0
2: 1
3: 13
4: 252
1132870041_1132870058 15 Left 1132870041 16:2111920-2111942 CCCACCCGCTCGGCAGAAGCCCC 0: 6
1: 1
2: 0
3: 12
4: 128
Right 1132870058 16:2111958-2111980 GGGGTGAACGGCTGCACCTGCGG 0: 5
1: 1
2: 1
3: 9
4: 116
1132870041_1132870047 -5 Left 1132870041 16:2111920-2111942 CCCACCCGCTCGGCAGAAGCCCC 0: 6
1: 1
2: 0
3: 12
4: 128
Right 1132870047 16:2111938-2111960 GCCCCCCGCCTGAGGAGCCCGGG 0: 6
1: 0
2: 1
3: 22
4: 234
1132870041_1132870049 -4 Left 1132870041 16:2111920-2111942 CCCACCCGCTCGGCAGAAGCCCC 0: 6
1: 1
2: 0
3: 12
4: 128
Right 1132870049 16:2111939-2111961 CCCCCCGCCTGAGGAGCCCGGGG 0: 6
1: 0
2: 3
3: 23
4: 192
1132870041_1132870060 29 Left 1132870041 16:2111920-2111942 CCCACCCGCTCGGCAGAAGCCCC 0: 6
1: 1
2: 0
3: 12
4: 128
Right 1132870060 16:2111972-2111994 CACCTGCGGCCCAGCCTTAAGGG 0: 5
1: 1
2: 0
3: 8
4: 87
1132870041_1132870059 28 Left 1132870041 16:2111920-2111942 CCCACCCGCTCGGCAGAAGCCCC 0: 6
1: 1
2: 0
3: 12
4: 128
Right 1132870059 16:2111971-2111993 GCACCTGCGGCCCAGCCTTAAGG 0: 5
1: 1
2: 0
3: 8
4: 129
1132870041_1132870055 3 Left 1132870041 16:2111920-2111942 CCCACCCGCTCGGCAGAAGCCCC 0: 6
1: 1
2: 0
3: 12
4: 128
Right 1132870055 16:2111946-2111968 CCTGAGGAGCCCGGGGTGAACGG 0: 6
1: 0
2: 1
3: 20
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132870041 Original CRISPR GGGGCTTCTGCCGAGCGGGT GGG (reversed) Intronic
900202876 1:1419225-1419247 GGGGCTTCTGCTGAGCCGAGGGG - Exonic
901121367 1:6896850-6896872 GGAGCTTCTGCCAAGCAGATGGG - Intronic
901197647 1:7449073-7449095 GGGGCCACTGCCGAGCAGGAAGG + Intronic
902451392 1:16499019-16499041 GGGGCATCTGCGGAGCCCGTCGG + Intergenic
903845918 1:26279958-26279980 GGGGCCTCTGGCGTGCGGGGCGG + Exonic
904326696 1:29731184-29731206 GGGGCTCCTGCAGAGTGTGTGGG + Intergenic
904371767 1:30052170-30052192 GGGGCTCCTGCAGAGTGTGTGGG - Intergenic
905734564 1:40316646-40316668 GGGGCTGCGGGCGCGCGGGTAGG - Intronic
910936146 1:92485578-92485600 GGGGCCTGGGCCGAGCGCGTGGG + Intronic
915244462 1:154546565-154546587 GGGGCTTGTGCCCAGTGGGCAGG + Intronic
1063067088 10:2621065-2621087 GGGGCCTCTGCAGAGCTGGCTGG + Intergenic
1067078738 10:43202460-43202482 CGGGCATCTTCCGAGAGGGTCGG - Intronic
1067834890 10:49632455-49632477 AGGGCTTCAGCTGAGAGGGTTGG - Intronic
1067912084 10:50355985-50356007 GGGGCAGCTGCCGAGCGGAGGGG - Intronic
1072166813 10:92821531-92821553 GGGGCTTCTGCTCAGCTTGTTGG + Intergenic
1074570076 10:114616277-114616299 GGGACTGCTGCAGAGCAGGTGGG + Intronic
1076293516 10:129366092-129366114 GGGGCTTGTGCTGAATGGGTGGG + Intergenic
1077201630 11:1310190-1310212 GGGGCTCCTGCGGAGCGGCGCGG - Intergenic
1077338403 11:2015555-2015577 GGGGCTTCTGCTGAGGGAGATGG - Intergenic
1083187655 11:61026932-61026954 GGGTCCTCTGCGGAGGGGGTGGG - Intergenic
1083596166 11:63919121-63919143 GAGGCTTCTGCCTAGGAGGTGGG + Intergenic
1083872701 11:65499067-65499089 GGGGCTTCTGCTGAGGGGGCAGG + Intergenic
1084630091 11:70342252-70342274 GAGGCTGCTGCCCAGCAGGTGGG + Intronic
1202821387 11_KI270721v1_random:70737-70759 GGGGCTTCTGCTGAGGGAGATGG - Intergenic
1093612708 12:21182310-21182332 GGGGCATCTGCCCAGAGAGTAGG + Intronic
1095113898 12:38330523-38330545 GGGGCGGCTGCCGAGCGGAGGGG + Intergenic
1102001542 12:109560915-109560937 GGGGCCTCTGCACAGCGGGCAGG - Intronic
1102284399 12:111643925-111643947 GGGGCTTCTACCAAGCAGGAAGG + Exonic
1102571428 12:113829338-113829360 GGTCCTTGTGCAGAGCGGGTGGG + Intronic
1104371471 12:128227585-128227607 GGGGCTTCTTACGAGCTGGGGGG + Intergenic
1105808419 13:23972665-23972687 GGGGCGGCTGCCGGGCGGATGGG + Intergenic
1109300406 13:60584972-60584994 GTGGTTTCTGCAGAGTGGGTAGG - Intergenic
1112574421 13:100622883-100622905 GGGACTTCTGCAGAGGGGGAAGG + Intronic
1119646235 14:76350507-76350529 GTGGCTTCTGCCGTCCTGGTAGG - Intronic
1121915264 14:97832535-97832557 GGGGCTTCTCCCGAGTGCCTGGG + Intergenic
1122388556 14:101365073-101365095 GGGGCTGCTGCTGGCCGGGTGGG + Intergenic
1122721501 14:103724939-103724961 GGGCCTGCTGGGGAGCGGGTGGG + Intronic
1123010265 14:105346610-105346632 GGGGGTGATGCCGTGCGGGTGGG - Intronic
1123010283 14:105346656-105346678 GGGGGTGATGCCGTGCGGGTGGG - Intronic
1123010382 14:105346898-105346920 GGGGGTGATGCCGTGCGGGTGGG - Intronic
1123057091 14:105575734-105575756 GGGGCTTCTGGGGTGGGGGTTGG - Intergenic
1123081155 14:105696157-105696179 GGGGCTTCTGGGGTGGGGGTTGG + Intergenic
1126849762 15:52789789-52789811 GGGGCTGCCGCCCAGCAGGTCGG + Exonic
1131200060 15:90388465-90388487 GGGGGCTCGGCCGGGCGGGTGGG + Intronic
1132694234 16:1194882-1194904 GGGGCTCCGGCTGACCGGGTGGG + Intronic
1132865100 16:2089405-2089427 GGGACATCTGCCCAGGGGGTGGG + Exonic
1132870041 16:2111920-2111942 GGGGCTTCTGCCGAGCGGGTGGG - Intronic
1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG + Intronic
1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134717382 16:16363681-16363703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134949435 16:18344964-18344986 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1134957370 16:18388478-18388500 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1139478951 16:67217757-67217779 AGGGCTTCAGCAGAGAGGGTTGG - Intronic
1139623219 16:68163606-68163628 GGGGCGGCTGCCGGGCGGATGGG + Intronic
1141083766 16:81076984-81077006 GGGGCTTCCCCAGAGCGGGCGGG - Intronic
1141655902 16:85416433-85416455 GCGGCTCCTCCCGAGCAGGTGGG + Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1144109972 17:12021365-12021387 GGGGCTGCGGCGGAGCGGGAGGG + Intronic
1144585753 17:16486633-16486655 GGGGCCTCTGCCGAGGTGGCGGG - Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147652209 17:42069125-42069147 GAGGCTGCTGCAGAGAGGGTAGG + Intergenic
1151322644 17:73361034-73361056 GGGCGTTCTGCGGAGGGGGTGGG + Intronic
1151887689 17:76932805-76932827 GGGGCCTGTGCCGAGCAGGCTGG - Intronic
1152226193 17:79094008-79094030 GGGGCTGCAGCAGTGCGGGTGGG + Intronic
1153781101 18:8495741-8495763 GGGGCTCCTGCAGAGAGGGCAGG - Intergenic
1156501931 18:37565561-37565583 CGGGCTGCTGCCGAGCCCGTTGG + Exonic
1157666469 18:49491942-49491964 GGGGTTTCTGTAGAGCGGGAGGG - Intronic
1160715034 19:572695-572717 GGGGCTGGTGAGGAGCGGGTAGG + Exonic
1161344169 19:3759774-3759796 GGGGCCTCTGCTGAGCAGGAGGG - Exonic
1161494896 19:4581429-4581451 GGGGCGTCTGCGGAGGGGGTTGG - Intergenic
1161510934 19:4670504-4670526 GGGACTTTTGCCGAGGGGGCGGG + Intergenic
1164600875 19:29562507-29562529 GGGGCTGCAGCCCAGCTGGTGGG + Intronic
1165056018 19:33176751-33176773 GGGGGTTCTCCGGAGTGGGTAGG + Intergenic
1166855796 19:45782154-45782176 GGGGCTCCTGCAGATGGGGTGGG - Intronic
1166892290 19:46000884-46000906 GGGGTTTCTGCCGAGCAGTGGGG + Intronic
933812082 2:86039070-86039092 GTGGCCTCAGCAGAGCGGGTAGG + Intronic
933948939 2:87311856-87311878 GCAGCTTTTGCCCAGCGGGTAGG + Intergenic
934888065 2:98041792-98041814 GGGACTTCTGCCGAGAGAGTAGG + Intergenic
936331260 2:111549740-111549762 GCAGCTTTTGCCCAGCGGGTAGG - Intergenic
937004144 2:118496140-118496162 GGGGCTCCTGACAAGTGGGTTGG - Intergenic
938836210 2:135105943-135105965 GGGGCGGCTGCCGAGCGGAGGGG - Intronic
944547532 2:200812319-200812341 GGGGCTTCCGGCGGGCGGGGCGG + Intronic
947702789 2:232249181-232249203 TGGGCTTCTCCTAAGCGGGTTGG + Intronic
1170106949 20:12762037-12762059 GGGGCTGCTACAGAGAGGGTTGG - Intergenic
1171796009 20:29567370-29567392 GAGGCTGCTGACGGGCGGGTGGG + Intergenic
1172146870 20:32763161-32763183 GGGGTTTCTGCCATGCAGGTGGG + Intronic
1176140447 20:63542575-63542597 GGGCCTTCTGCAGGGAGGGTGGG + Exonic
1178704810 21:34864439-34864461 GGGGCTGCTGCCGAGAGGGCCGG + Intronic
1179888587 21:44324975-44324997 GGGGCTGCTGAGGAGCGGCTGGG + Intronic
1182343047 22:29639907-29639929 AGGACTTCAGCCGGGCGGGTTGG + Intronic
1183330268 22:37216218-37216240 GGAGCAATTGCCGAGCGGGTGGG - Intergenic
1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG + Intronic
1184017920 22:41800027-41800049 GGGGCCCCTGCCGGGCGGGAAGG - Intergenic
1184067656 22:42129542-42129564 GGGGCTTGTGACGAGTGGGCGGG - Intronic
1184337429 22:43862112-43862134 GGGGCTTCTGCTGGGCCGGGTGG - Intronic
1184639374 22:45861145-45861167 GGGGCTCCTGCAGAGTGGGGTGG + Intergenic
952383242 3:32820052-32820074 CGGGCTCTTGCCGAGGGGGTCGG + Intronic
960955535 3:123027991-123028013 GGGGCTTCGGCCCACCGGGCTGG - Intronic
961498087 3:127309004-127309026 GGGGCGGCTGCCGGGCGGATGGG - Intergenic
968487651 4:871626-871648 GGGGTGTCGGCCGTGCGGGTGGG + Intronic
968603184 4:1520083-1520105 GGGGCTTCTGCCTAGCGGAGGGG + Intergenic
968736679 4:2300853-2300875 GGGGCGTCTGCCGGGCGAGCGGG + Intronic
969378996 4:6782461-6782483 GGGGCTGGTGCCTGGCGGGTGGG - Intronic
982288647 4:153759426-153759448 GGGGCTTCCGCCGAGGAGGGAGG + Intronic
984655014 4:182308227-182308249 GGGTCATCTGCTGAGGGGGTTGG - Intronic
987331748 5:16863286-16863308 TGGGCTTCTCCCCAGTGGGTGGG - Intronic
999821513 5:155233551-155233573 AGGGCTTCTGCCCAGAGGGCTGG + Intergenic
1002115757 5:176961422-176961444 GGGGCAGCTGCCGGGCGGGGGGG - Intronic
1005571203 6:27147240-27147262 GGTAATTATGCCGAGCGGGTTGG + Exonic
1006925023 6:37649291-37649313 GGGGCCTCTCCCCAGCGAGTGGG + Intronic
1019120702 6:169801503-169801525 GGGGTTGCTGCGGAGCGGGCAGG + Intergenic
1019174536 6:170153560-170153582 GGGCCTTCTGCAGAGCTAGTGGG - Intergenic
1019558041 7:1642237-1642259 GGGGCTTCTGCGGAGAGGAAGGG - Intergenic
1019729359 7:2622015-2622037 GGGGCTGCAGCTGAGCAGGTGGG + Intergenic
1021668675 7:23013706-23013728 GGGGCGGCTGGCGGGCGGGTGGG - Intronic
1022005405 7:26262095-26262117 GGGGCGGCTGCCGGGCGGGGAGG - Intergenic
1022792461 7:33702595-33702617 CTGGCTTCTGCCCAGCGTGTGGG + Intergenic
1024989204 7:55220394-55220416 GGGGCAGCTGCCGGGCGGGGGGG + Intronic
1025803669 7:64809662-64809684 GGGGCTGCTGCCGGGCGGAGGGG + Intronic
1029126462 7:98298136-98298158 GGGGCTTCTCCCAAGGGGGCAGG - Intronic
1029207494 7:98878429-98878451 GGGGCGTCCGCCGTCCGGGTGGG - Intronic
1029535302 7:101154410-101154432 GGGGCTTCGGGCGAGAGGGAGGG + Exonic
1029735839 7:102465312-102465334 GGGGCTCCCGGCGAGCGGGTGGG - Intronic
1031973801 7:128081566-128081588 GGGGCCTCTGCCCAGTGGGTGGG + Intronic
1034967585 7:155400736-155400758 GGGGCTTCTGCAGAGGGAGTGGG - Intergenic
1036552653 8:9828748-9828770 CAGGCTTCAGCAGAGCGGGTGGG - Intergenic
1037782483 8:21879902-21879924 GGTGCTTCTGCAGAAGGGGTGGG - Intergenic
1045021923 8:98051838-98051860 GGGGCTGCTGCCGGGCGGAGGGG + Intergenic
1047731356 8:127731488-127731510 GGAGCTGCTGCTGAGTGGGTTGG - Intergenic
1048574482 8:135680004-135680026 GGGGTGTCTGCTCAGCGGGTTGG + Intergenic
1049479883 8:142816905-142816927 GGGGCGTCTGCAGAGCAGATGGG - Intergenic
1049616548 8:143578045-143578067 GGGGTTTCTGCCGGGCGTGGGGG + Intronic
1049976010 9:861790-861812 GGGGCGGCTGCCGGGCGGGGGGG + Intronic
1050558167 9:6807673-6807695 GGGGCAGCTGCCGGGCGGATGGG - Intronic
1052274836 9:26664443-26664465 GGGGCTGCTGCCGGGCGGAGGGG - Intergenic
1053482186 9:38424016-38424038 GGGGCGTGTGCCGAGCGCGCAGG + Exonic
1061177674 9:129007426-129007448 GGGGCTTCTGAAGAGGGGATCGG - Intronic
1061947692 9:133917917-133917939 GGGGATTCAGCCGGGAGGGTGGG - Intronic
1062027539 9:134347470-134347492 CGGGCTTCTGCCGAGCAGGAGGG + Intronic
1062340120 9:136090427-136090449 GGGGCTTCCGCCCAGTGGGCTGG - Intronic
1062403013 9:136380632-136380654 GGGGCTGCGGTGGAGCGGGTGGG + Intronic
1062462117 9:136666366-136666388 GGGGCTGCTGCCGGGCAGGTGGG + Intronic
1185464530 X:346611-346633 GGGGCTTCTGCGGACGGGGCGGG - Intronic
1192452690 X:71253673-71253695 GGGGCTCCTGCAGAGTGGGGAGG - Intronic