ID: 1132870929

View in Genome Browser
Species Human (GRCh38)
Location 16:2115470-2115492
Sequence AGCCATTGGCGCAGGCCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 4, 1: 0, 2: 1, 3: 10, 4: 210}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132870920_1132870929 -6 Left 1132870920 16:2115453-2115475 CCCTGGCCCTGACGTGCAGCCAT 0: 4
1: 0
2: 2
3: 7
4: 130
Right 1132870929 16:2115470-2115492 AGCCATTGGCGCAGGCCTGGGGG 0: 4
1: 0
2: 1
3: 10
4: 210
1132870919_1132870929 2 Left 1132870919 16:2115445-2115467 CCGGGTAGCCCTGGCCCTGACGT 0: 1
1: 3
2: 1
3: 13
4: 147
Right 1132870929 16:2115470-2115492 AGCCATTGGCGCAGGCCTGGGGG 0: 4
1: 0
2: 1
3: 10
4: 210
1132870913_1132870929 21 Left 1132870913 16:2115426-2115448 CCATAGCGCATAGGGGGCCCCGG 0: 1
1: 3
2: 2
3: 4
4: 23
Right 1132870929 16:2115470-2115492 AGCCATTGGCGCAGGCCTGGGGG 0: 4
1: 0
2: 1
3: 10
4: 210
1132870917_1132870929 4 Left 1132870917 16:2115443-2115465 CCCCGGGTAGCCCTGGCCCTGAC 0: 1
1: 1
2: 0
3: 18
4: 199
Right 1132870929 16:2115470-2115492 AGCCATTGGCGCAGGCCTGGGGG 0: 4
1: 0
2: 1
3: 10
4: 210
1132870918_1132870929 3 Left 1132870918 16:2115444-2115466 CCCGGGTAGCCCTGGCCCTGACG 0: 1
1: 3
2: 1
3: 17
4: 191
Right 1132870929 16:2115470-2115492 AGCCATTGGCGCAGGCCTGGGGG 0: 4
1: 0
2: 1
3: 10
4: 210
1132870921_1132870929 -7 Left 1132870921 16:2115454-2115476 CCTGGCCCTGACGTGCAGCCATT 0: 4
1: 0
2: 0
3: 10
4: 128
Right 1132870929 16:2115470-2115492 AGCCATTGGCGCAGGCCTGGGGG 0: 4
1: 0
2: 1
3: 10
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132870929 Original CRISPR AGCCATTGGCGCAGGCCTGG GGG Exonic
900483414 1:2910261-2910283 AGCCCTTGGGGCAGAGCTGGTGG - Intergenic
901449057 1:9325193-9325215 AGGCATTGGCTCAGGCCGGAGGG - Intronic
901686948 1:10948347-10948369 AGCCATTGGCGAGGCCCTGGCGG - Exonic
901703106 1:11055911-11055933 AGCCACTGGCACTCGCCTGGGGG + Exonic
902527972 1:17071564-17071586 AGCAGTTAGCCCAGGCCTGGAGG - Intronic
903963639 1:27072777-27072799 AGGCATGGGGGCAGGCATGGGGG + Intergenic
903963670 1:27072861-27072883 AGGCATGGGGGCAGGCATGGGGG + Intergenic
903963673 1:27072873-27072895 AGGCATGGGGGCAGGCATGGAGG + Intergenic
904292580 1:29497533-29497555 GGCGATGGGCCCAGGCCTGGTGG - Intergenic
904302129 1:29561261-29561283 AGCTACAGGCTCAGGCCTGGGGG - Intergenic
904401281 1:30258210-30258232 AGTCACAGGCTCAGGCCTGGGGG + Intergenic
907317142 1:53579702-53579724 AGCCATGGGGGCAGCCGTGGGGG + Intronic
908122783 1:61001684-61001706 AGCCACATGCACAGGCCTGGAGG + Intronic
908351029 1:63286464-63286486 ATCCTCTGGGGCAGGCCTGGAGG - Intergenic
913366661 1:118047399-118047421 TGGCATTGGGGCAGGCATGGAGG - Intronic
913961771 1:143344425-143344447 AGACATTGGCGTGGGCATGGAGG - Intergenic
914056126 1:144169997-144170019 AGACATTGGCGTGGGCATGGAGG - Intergenic
914123020 1:144796365-144796387 AGACATTGGCGTGGGCATGGAGG + Intergenic
914644287 1:149639055-149639077 ATCCGCTGGCCCAGGCCTGGCGG + Intergenic
915071503 1:153272627-153272649 GGCCATAGGAGCTGGCCTGGAGG + Intergenic
915737574 1:158094637-158094659 AGCCATTGGTGGGGTCCTGGGGG - Exonic
917117044 1:171613399-171613421 AACCATTTCTGCAGGCCTGGAGG + Intergenic
921222936 1:212986626-212986648 AGCCACTGCTACAGGCCTGGAGG - Intronic
922955521 1:229595985-229596007 AACCATTGGTTCAGGCATGGTGG + Intronic
1062919265 10:1266741-1266763 AGCCACTGCCCCTGGCCTGGAGG + Intronic
1065632560 10:27695335-27695357 AGCCACTGTCGCAGGCCTCTGGG + Intronic
1066229903 10:33422214-33422236 AGCCATGGGCCCAGGCATGCCGG - Intergenic
1067238979 10:44474559-44474581 AGCCATTTGACCAGGCATGGTGG - Intergenic
1070594382 10:77821822-77821844 AGGCACTGGGACAGGCCTGGGGG + Exonic
1070836510 10:79450324-79450346 AGTCACTGGAGCAGGCCTAGTGG + Intergenic
1075597369 10:123741918-123741940 AGGTCTCGGCGCAGGCCTGGGGG - Intronic
1075606912 10:123818266-123818288 AGCCATGGGGGCAGGGATGGAGG + Intronic
1077385262 11:2266660-2266682 AGCCAATGGCGCAGTCCTCAGGG - Intergenic
1078358932 11:10653460-10653482 ACCCATTGGCTCAGGTCTGTTGG - Intronic
1078591280 11:12642143-12642165 AGCAATTGGAGCAGACGTGGGGG + Intergenic
1079864920 11:25722918-25722940 ATCCTTTAGGGCAGGCCTGGTGG + Intergenic
1083310197 11:61779997-61780019 GCCCATGGGCTCAGGCCTGGGGG + Intronic
1083434611 11:62633883-62633905 AGCCATTGTGTCAGGCCAGGAGG - Intronic
1083616969 11:64031089-64031111 AGGCACTGGAGCAGGGCTGGAGG + Intronic
1083805641 11:65072319-65072341 AGGCTTTGGCTCAGGCCTGGTGG - Intronic
1084206130 11:67594172-67594194 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1084558827 11:69891363-69891385 GGCCATGGGTGCAGGGCTGGAGG - Intergenic
1086551690 11:88059824-88059846 AGCCTTGGGCCCAGGCCAGGAGG + Intergenic
1088589988 11:111395128-111395150 AGAAATTGGCCCAGGCCAGGTGG + Intronic
1090101772 11:123805195-123805217 TGCCATTGGGGGAGGGCTGGGGG + Intergenic
1091825634 12:3510666-3510688 AGCCACTGGAGCTGGCCTTGTGG - Intronic
1092319142 12:7453020-7453042 GGCCATTGGGGTAGGTCTGGTGG - Intronic
1093982231 12:25487809-25487831 AGCTTTTAGGGCAGGCCTGGTGG + Intronic
1095527820 12:43148943-43148965 ATCCATTGCCTCAGGCCTAGGGG - Intergenic
1099978330 12:89569936-89569958 AGCCCTTGGGGCAGCCCGGGAGG + Intergenic
1101455701 12:104827962-104827984 GTCCATGGGCACAGGCCTGGGGG - Intronic
1102444317 12:112989989-112990011 AGCCATTGCCCCATCCCTGGTGG - Intronic
1102453431 12:113057283-113057305 TTCCCTTGGGGCAGGCCTGGAGG - Intronic
1102678319 12:114673418-114673440 AGGGACTGGGGCAGGCCTGGAGG - Intronic
1103725873 12:122997128-122997150 AGCCATGGGCCCAGGCCTCCTGG + Intronic
1115421284 14:33198715-33198737 GGCGAATGGCGCAGGGCTGGCGG - Intronic
1121456594 14:94042575-94042597 GGCCCTTGGAGCAGCCCTGGAGG + Intronic
1121511020 14:94513674-94513696 AGCCATTGGTCCAGCCCTTGGGG - Intronic
1202904074 14_GL000194v1_random:58654-58676 TGCAGTTGGCGAAGGCCTGGCGG + Intergenic
1125344248 15:38702846-38702868 ATCCATTGGCCAAGGCCTGTGGG + Intergenic
1126132536 15:45356405-45356427 AGCCACTGGGCCAGGCATGGTGG + Intergenic
1127393304 15:58523780-58523802 AGCTAGTGGAGCAGGGCTGGTGG + Intronic
1129308492 15:74686831-74686853 AGCCATTGCGGCTGGCCTGGAGG - Intronic
1129392312 15:75226531-75226553 AGTCAGTGGCTCCGGCCTGGTGG + Intergenic
1129596361 15:76967472-76967494 TCCCATTGGCGCAGGCTTTGGGG - Intergenic
1130530927 15:84747897-84747919 GGACATTCGCGCAGGCTTGGAGG - Intergenic
1131400253 15:92119634-92119656 AGCCACTGGGGCTGGACTGGAGG + Intronic
1132565108 16:618605-618627 AGCCATGTGCACAGGTCTGGCGG + Intronic
1132565164 16:618969-618991 AGGCATTTGCACAGGTCTGGCGG + Intronic
1132565219 16:619340-619362 AGCCATGTGCACAGGTCTGGCGG + Intronic
1132870929 16:2115470-2115492 AGCCATTGGCGCAGGCCTGGGGG + Exonic
1133061229 16:3175557-3175579 CGCCTTTGGGGCAGGCCTGAGGG + Intergenic
1134521599 16:14921413-14921435 AGCCATTGGCGCAGGCCTGGGGG - Intronic
1134709270 16:16320064-16320086 AGCCATTGGCGCAGGCCTGGGGG - Intergenic
1134950335 16:18348581-18348603 AGCCATTGGCGCAGGCCTGGGGG + Intergenic
1136669043 16:31839526-31839548 GGCCACTGGGGCTGGCCTGGTGG - Intergenic
1137703554 16:50517802-50517824 GTCCATAGGGGCAGGCCTGGAGG + Intergenic
1139005996 16:62572280-62572302 AGCTAATGGGGCAGGCCTTGTGG + Intergenic
1139426078 16:66880731-66880753 AGCCGGTGCCGCAGGCCGGGAGG - Intronic
1139471549 16:67180528-67180550 AGCCTATGGCGCAGGGATGGGGG + Exonic
1140487847 16:75308161-75308183 AGCCATTGGGGCTAGCCTGAAGG + Intronic
1142151593 16:88514834-88514856 AACCAATGGCCCAGGCCTTGGGG + Intronic
1143147969 17:4789030-4789052 AACCAGTGCCGCAGGGCTGGGGG - Exonic
1146180630 17:30696074-30696096 AGCCACTGGTCCAGGCGTGGTGG - Intergenic
1146862691 17:36318213-36318235 ATCCTTTGGCCCAGGCATGGTGG + Intronic
1147093019 17:38122309-38122331 ATCCTTTGGCCCAGGCATGGTGG + Intergenic
1147104189 17:38198179-38198201 ATCCTTTGGCCCAGGCATGGTGG - Intergenic
1147268885 17:39252972-39252994 AGCATTTGGAGCAGGCCTAGTGG + Intergenic
1147419771 17:40316752-40316774 AGCCATTGGCGCATTCCTGCCGG + Intronic
1150228026 17:63534324-63534346 AGCCATGGCTGCTGGCCTGGAGG - Intronic
1150262299 17:63803933-63803955 AGCCACTGCTCCAGGCCTGGAGG + Intronic
1151032047 17:70752637-70752659 AGGCAGTGGCGCGGGCCTGTTGG + Intergenic
1151243704 17:72778190-72778212 AGACAATGGGCCAGGCCTGGTGG - Intronic
1151363879 17:73604823-73604845 AGCCATTGCAGCAGGCGTGGTGG + Intronic
1152048585 17:77955442-77955464 AGCCAATGCCGCTGGTCTGGGGG + Intergenic
1154201238 18:12302134-12302156 AGCAGTGGGCACAGGCCTGGTGG - Intergenic
1156465557 18:37346191-37346213 AGACATTGGGGCAGGCCAGTTGG - Intronic
1156742091 18:40343396-40343418 AGAGACTGGCGCAGGCCTTGTGG - Intergenic
1157535089 18:48452092-48452114 GTCCGTTGGCACAGGCCTGGGGG + Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1159655896 18:71030228-71030250 ACCCAGTGGCTCAGGCATGGCGG + Intergenic
1160510460 18:79450735-79450757 TGACATTGGCGCAGGCGAGGGGG - Intronic
1162672519 19:12269029-12269051 AGCCAGGGGCCCAGGCATGGTGG - Intronic
1163266707 19:16226414-16226436 TGCCGTTGGCGCTGACCTGGGGG - Exonic
1165435753 19:35793891-35793913 GGGGATTGGCGGAGGCCTGGAGG - Intergenic
1166302982 19:41922621-41922643 AGGCAGTGGGGCAGGCCTGAGGG + Intronic
1166626889 19:44366060-44366082 AGCAATTAGGCCAGGCCTGGTGG + Intronic
1167354220 19:48993379-48993401 CGCCATTGGCCCACGCCCGGGGG + Intergenic
1202695609 1_KI270712v1_random:122682-122704 AGACATTGGCGTGGGCATGGAGG - Intergenic
925092452 2:1166654-1166676 GTCCATGGGCACAGGCCTGGGGG - Intronic
925279986 2:2677143-2677165 GGCCATTGGCGCAGGCTGGGGGG - Intergenic
926042112 2:9681600-9681622 TGCCATGGGCCCAGGCCTGAAGG + Intergenic
929249053 2:39732705-39732727 AGCAACTGGGGCAGACCTGGAGG - Intergenic
929409796 2:41685282-41685304 AGACATTGGCCCAGGCACGGTGG + Intergenic
934276774 2:91579723-91579745 AGACATTGGCGTGGGCATGGAGG - Intergenic
934939668 2:98491381-98491403 AGCCAATGGTGAGGGCCTGGGGG - Intronic
938255793 2:129858803-129858825 AGGCTTTGGGGCAGGCGTGGGGG + Intergenic
938546613 2:132338472-132338494 AGCAATTGGGCCAGGCCTGGTGG - Intergenic
938578001 2:132621565-132621587 GGCCATTTGCCCAGGCCTGTAGG - Intronic
941106894 2:161364444-161364466 GTCCATGAGCGCAGGCCTGGTGG + Intronic
941256787 2:163241629-163241651 TGGCATTGGGGCAGACCTGGAGG + Intergenic
941698766 2:168581304-168581326 AGCAATTGGGCCAGGCATGGTGG - Intronic
944763592 2:202841701-202841723 AGCAGTTGCCGAAGGCCTGGGGG + Intronic
946819230 2:223613301-223613323 AGGCGGTGGCTCAGGCCTGGAGG - Intergenic
949075704 2:242056125-242056147 AGCCATTCTCGCTGGCCAGGCGG - Intergenic
1170777492 20:19390530-19390552 TGGCACTGGGGCAGGCCTGGAGG + Intronic
1171875477 20:30571206-30571228 AGCAATTGGGCCAGGCCTGGTGG - Intergenic
1172447563 20:35001176-35001198 AGTCCTTGGCGCAGGCAGGGTGG + Intronic
1173211697 20:41038696-41038718 AATCTTTGGGGCAGGCCTGGAGG + Intronic
1173718920 20:45236209-45236231 AGCCACTGGTGTGGGCCTGGTGG + Intergenic
1174010442 20:47445286-47445308 AGCCATTCGGCCAGGCATGGTGG - Intergenic
1174500286 20:50979270-50979292 AGCCATTGCAGCAGGCCAGAAGG - Intergenic
1174631417 20:51961211-51961233 AGCCTTAGGCGCAGGGCTGAAGG + Intergenic
1175164377 20:57032978-57033000 AGGCATTGTCCTAGGCCTGGAGG + Intergenic
1175392777 20:58637590-58637612 TGCCATTGGCCCAGCCCTGCTGG + Intergenic
1179247067 21:39643168-39643190 GGCCATTGGCGAGGGCCTTGTGG + Intronic
1179547560 21:42122929-42122951 AGCCGCTGGGGCAGGCCTTGGGG - Exonic
1179948232 21:44695010-44695032 AGCCTGTGGCAGAGGCCTGGAGG - Intronic
1180077283 21:45469168-45469190 AGGGCTTGGCACAGGCCTGGGGG - Intronic
1180501658 22:15935206-15935228 AGCCACAGGCACAGGGCTGGTGG + Intergenic
1181412511 22:22734247-22734269 TGCCATGTGCCCAGGCCTGGAGG + Intergenic
1181973472 22:26711375-26711397 AGCCATTGGTTGAGGGCTGGGGG + Intergenic
1185255470 22:49828530-49828552 GGCCATTGGCCCAGGAATGGGGG + Intergenic
950242957 3:11388130-11388152 AGCCATAGGGGCAGCCATGGTGG - Intronic
950458431 3:13106307-13106329 AGGCAGTGGCTGAGGCCTGGGGG - Intergenic
952827544 3:37536900-37536922 ATCCACTGGTGCAGACCTGGAGG - Intronic
954463856 3:50643229-50643251 AGCCATTTGCTGAGCCCTGGAGG + Intronic
956700759 3:71956634-71956656 AGCCATTGGCTGAGGGCTGTAGG + Intergenic
957792031 3:84953720-84953742 CGCCATTGACTCTGGCCTGGGGG + Intergenic
959890046 3:111544426-111544448 AGCCACTGCGCCAGGCCTGGAGG + Intronic
962676677 3:137763163-137763185 AACCATTGTCCCAGGCCCGGCGG - Intergenic
963289429 3:143472907-143472929 AGCCTGTGGGGCAGGCCTGAGGG - Intronic
966915169 3:184580661-184580683 AGCCAGGGGCTCGGGCCTGGGGG + Intronic
967179204 3:186888608-186888630 AGGCACTGGCGCAGTCCTGTGGG - Intergenic
967325447 3:188234142-188234164 AGCCCTTGGAGCAGGGGTGGGGG - Intronic
968127460 3:196170222-196170244 AGCCACTGGGCCAGGCCTGATGG + Intergenic
968441040 4:624748-624770 TGGCATGGGCGCCGGCCTGGCGG - Intergenic
968958820 4:3732464-3732486 AGTCGTTGCCACAGGCCTGGGGG - Intergenic
969033991 4:4236665-4236687 AGACATTGGCGTGGGCATGGAGG + Intronic
970574296 4:17412346-17412368 ATCCATGGGCACAGGCCTGAGGG + Intergenic
971761347 4:30770071-30770093 GGCCATTGGAACAGGCTTGGTGG + Intronic
973014563 4:45121715-45121737 AGCAATTGGAGCAGGCCAGTTGG - Intergenic
974039436 4:56845171-56845193 AGGCATTGGCCCAGGGCTAGAGG - Intergenic
974250145 4:59375230-59375252 GTCCATAGGCACAGGCCTGGGGG + Intergenic
975024634 4:69532973-69532995 AGCCATTGTGGCAGGAATGGAGG + Intergenic
977995797 4:103496537-103496559 AGCCAGGGGTGAAGGCCTGGGGG + Intergenic
979335427 4:119455887-119455909 AGTAATTGGGCCAGGCCTGGTGG + Intergenic
984785043 4:183560039-183560061 AGCCATGGGCACAGGCAGGGTGG - Intergenic
987368764 5:17174139-17174161 AGCTGTTGGCCCAGGCATGGTGG + Intronic
991253238 5:64586537-64586559 GGGCATTGGCCCAGGCTTGGAGG - Intronic
994896299 5:105707524-105707546 AGCCATTGGCCCAGCCCTAGAGG + Intergenic
996575824 5:124976093-124976115 AGCGCGTGGCGCAGGACTGGCGG - Intergenic
996759809 5:126975924-126975946 AGGCATTGGCACAGGCCTACTGG - Intronic
996802199 5:127416313-127416335 AGCCCTTGGGCCAGGCATGGTGG - Intronic
996813144 5:127543049-127543071 AGCTTTTAGGGCAGGCCTGGTGG + Intronic
999317149 5:150591394-150591416 AGCCCCTGGGGCAGGCCTGCAGG - Intergenic
1001107430 5:168866935-168866957 AGCAATTGGCTCAGGACTAGTGG + Intronic
1001879690 5:175232591-175232613 AGCATTTGGGCCAGGCCTGGAGG - Intergenic
1002477061 5:179473015-179473037 GTCCGTGGGCGCAGGCCTGGGGG + Intergenic
1003749752 6:9042114-9042136 AGCCATTTTCCCATGCCTGGTGG - Intergenic
1003809964 6:9768314-9768336 GTCCATGGGCACAGGCCTGGGGG + Intronic
1005532576 6:26722543-26722565 ATCCATGGGCACAGGCCCGGCGG - Intergenic
1005538219 6:26779122-26779144 ATCCATGGGCACAGGCCCGGCGG + Intergenic
1007065246 6:38984503-38984525 AGCAATTGGGCCAGGCATGGTGG + Intronic
1008089727 6:47281666-47281688 ACCTATTGGCCCAGGCGTGGTGG - Intronic
1008662437 6:53681963-53681985 AGCCCTGGGCCCAGTCCTGGAGG + Intergenic
1015444614 6:133288559-133288581 AGCAATTGGTGAAGGCCTGCTGG + Intronic
1017550990 6:155507315-155507337 AGCAATTGGACCAGGCATGGTGG - Intergenic
1017847529 6:158272298-158272320 AGCCATTGGGGCAGGAAGGGAGG - Intronic
1019125812 6:169839535-169839557 AGCCATGCGGGCAGGCCAGGAGG + Intergenic
1019256886 7:58048-58070 AGCCACAGGCTGAGGCCTGGGGG + Intergenic
1020414853 7:7934165-7934187 TGCCATTAGAGGAGGCCTGGTGG - Intronic
1022035165 7:26527339-26527361 AGGCGTGGGCGCAGGCCTGCTGG - Intergenic
1023985216 7:45089888-45089910 AGCCATTGTCACAGGCAGGGAGG + Intergenic
1024064941 7:45724824-45724846 AGCCATAGGAGCAGGGTTGGTGG + Intergenic
1032078289 7:128846398-128846420 AGCCTTCGGGCCAGGCCTGGAGG + Exonic
1032544011 7:132727092-132727114 AGCCATTGGCTCAGGTCCTGCGG - Intronic
1034466611 7:151233446-151233468 AGCCACTGCGGCAGGCCCGGTGG - Exonic
1041564994 8:59267012-59267034 AGCCATTAGCCCAGGACTCGTGG + Intergenic
1049363180 8:142224019-142224041 AGCTATCGGTGCAGTCCTGGGGG + Intronic
1049670893 8:143869418-143869440 AGCCTCTGGCCCAGGCCTGTGGG + Exonic
1049743648 8:144253410-144253432 AGACAATGGCTCAGGCCTTGGGG - Intronic
1050048806 9:1576287-1576309 AGCCATGGGAGCAGGTCTGGTGG + Intergenic
1051920739 9:22260591-22260613 ACCCACTGGAGCAGGCCTAGGGG + Intergenic
1055054439 9:72010862-72010884 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1056635200 9:88325882-88325904 AGGCATTGGACCAGGCATGGTGG + Intergenic
1057282778 9:93724896-93724918 AGCAGTTGGCCCTGGCCTGGAGG + Intergenic
1059433242 9:114262190-114262212 ATTCATGGGCACAGGCCTGGCGG - Intronic
1060343924 9:122800539-122800561 GGCCATGTGCGCAGCCCTGGTGG + Exonic
1060918661 9:127405678-127405700 GGCCAGTGGCCCAGGCATGGTGG - Intronic
1062220647 9:135413418-135413440 AGCCACTGGCGCAGACCTGGTGG + Intergenic
1062584029 9:137240981-137241003 AGCCAATAGCGCCAGCCTGGCGG + Intergenic
1203563479 Un_KI270744v1:75631-75653 TGCAGTTGGCGAAGGCCTGGTGG - Intergenic
1189787446 X:44572074-44572096 AGCCATTGTGTCTGGCCTGGGGG - Intergenic
1191759469 X:64630742-64630764 GGCCATGGGGGCAGGCGTGGAGG + Intergenic
1192112750 X:68382060-68382082 AGCCATTGCACCTGGCCTGGTGG - Intronic
1192522368 X:71814251-71814273 TGACATTGGGGCAGACCTGGAGG + Intergenic
1193394049 X:80963041-80963063 AGCTTTTAGGGCAGGCCTGGTGG + Intergenic
1194179492 X:90695097-90695119 AGCCATTGCGGCAGGGATGGAGG - Intergenic
1195135721 X:101906175-101906197 TGGCACTGGAGCAGGCCTGGAGG - Intronic
1200526155 Y:4277270-4277292 AGCCATTGCGGCAGGGATGGAGG - Intergenic
1202031753 Y:20582496-20582518 AGCTATTGGGCCAGGCATGGTGG - Intronic
1202269201 Y:23054012-23054034 GGCTAGTGGCCCAGGCCTGGAGG + Intergenic
1202422193 Y:24687752-24687774 GGCTAGTGGCCCAGGCCTGGAGG + Intergenic
1202448593 Y:24982326-24982348 GGCTAGTGGCCCAGGCCTGGAGG - Intergenic