ID: 1132871177

View in Genome Browser
Species Human (GRCh38)
Location 16:2116446-2116468
Sequence GGCGAGACCCACAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 4, 1: 2, 2: 1, 3: 27, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132871167_1132871177 22 Left 1132871167 16:2116401-2116423 CCATCTTCACTGGGCACAAGCAA 0: 6
1: 0
2: 0
3: 32
4: 581
Right 1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG 0: 4
1: 2
2: 1
3: 27
4: 218
1132871165_1132871177 27 Left 1132871165 16:2116396-2116418 CCCAACCATCTTCACTGGGCACA 0: 6
1: 0
2: 0
3: 28
4: 156
Right 1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG 0: 4
1: 2
2: 1
3: 27
4: 218
1132871171_1132871177 -10 Left 1132871171 16:2116433-2116455 CCCCAAGTTTTTTGGCGAGACCC 0: 4
1: 2
2: 0
3: 4
4: 46
Right 1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG 0: 4
1: 2
2: 1
3: 27
4: 218
1132871166_1132871177 26 Left 1132871166 16:2116397-2116419 CCAACCATCTTCACTGGGCACAA 0: 6
1: 0
2: 1
3: 12
4: 175
Right 1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG 0: 4
1: 2
2: 1
3: 27
4: 218
1132871170_1132871177 -9 Left 1132871170 16:2116432-2116454 CCCCCAAGTTTTTTGGCGAGACC 0: 4
1: 2
2: 0
3: 2
4: 43
Right 1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG 0: 4
1: 2
2: 1
3: 27
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132871177 Original CRISPR GGCGAGACCCACAGTGGGCA GGG Intronic
900280368 1:1863423-1863445 GGCAGCAGCCACAGTGGGCAAGG - Intronic
900310201 1:2029828-2029850 GCTGGGACCCACAGTGGGCTGGG - Intronic
900822202 1:4898426-4898448 GTTGAGACACACAGGGGGCAAGG - Intergenic
901262848 1:7886152-7886174 GGGGAGACTCAGAGTGGGCAGGG - Intergenic
902335727 1:15753597-15753619 GGCGAGACCCACAGGGGCAATGG + Intergenic
902839911 1:19068129-19068151 GGTGGGACCCACAGTGGGTATGG - Intergenic
903322561 1:22551777-22551799 GGCTGGAGCCACAGTGGTCACGG + Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904592286 1:31621592-31621614 GGTGAGGCCCACTCTGGGCAGGG + Exonic
905092838 1:35443146-35443168 CTCGAGACCCACCTTGGGCATGG + Intronic
905166946 1:36088518-36088540 AGGGAGGCCCACAGGGGGCAAGG + Intergenic
907302697 1:53498529-53498551 GGTGAGACCCAGGCTGGGCAAGG - Intergenic
907409453 1:54274154-54274176 GGCGAGACCCAGAATGGGGAGGG + Intronic
907526875 1:55058846-55058868 GGAGAGAGCCACAGCGGGAAGGG + Intronic
915621890 1:157091257-157091279 GGAGAGACCCAGAGTGGGGCAGG - Intergenic
916787007 1:168093719-168093741 GACCAGACCCTCTGTGGGCAAGG - Intronic
918421936 1:184373082-184373104 GGAGAGACCCAGAGAAGGCAGGG + Intergenic
1063385611 10:5614491-5614513 GGAGAGACCCACATTTGGGATGG - Intergenic
1064516587 10:16155845-16155867 AGCCAGACCAACAGTGGACAGGG + Intergenic
1065976320 10:30845948-30845970 AGGGAGAGCCACAGTGGGTAGGG - Intronic
1072834475 10:98696392-98696414 GGCGTGACCCACAGAGAGGAAGG + Intronic
1072914770 10:99531123-99531145 GGAGAGACCCTCTGTGGGCAGGG - Intergenic
1073426664 10:103459227-103459249 GAGGAGACCCCCAGTGGGAAGGG - Intergenic
1073890067 10:108091023-108091045 GGCAGTACTCACAGTGGGCACGG + Intergenic
1074781079 10:116802789-116802811 GCCAAGCCCAACAGTGGGCAGGG - Intergenic
1076202078 10:128566802-128566824 GGCGAGACTCACCCAGGGCAGGG + Intergenic
1076373755 10:129970512-129970534 GTGGAGAGCTACAGTGGGCACGG + Intergenic
1076798765 10:132811197-132811219 GGCGAGGTCCACTGTGGCCAGGG - Intronic
1076869438 10:133186156-133186178 GGCGAGAGCCACAGCCGGGAGGG + Exonic
1076883250 10:133249632-133249654 AACGAGGCCCAGAGTGGGCACGG + Intergenic
1076943034 10:133622625-133622647 GGCGACACCCACAGAGGGCCTGG - Intergenic
1077323278 11:1952007-1952029 ACCAAGACCCACAGGGGGCAGGG - Intronic
1077415161 11:2421347-2421369 GCCGAGGCCCAGAGAGGGCAAGG + Intronic
1081773368 11:45663139-45663161 AGAGAGATCCACAGCGGGCAAGG + Intronic
1083184249 11:61008212-61008234 GGAGAGACCCAGAGCGGGCGGGG - Intronic
1083266738 11:61550412-61550434 GGGGAGACCAGCAGCGGGCAGGG + Intronic
1083593802 11:63909727-63909749 GGAGAAGCCCACAGTGGGCCTGG - Exonic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085471600 11:76761865-76761887 AGCGAGGCCCAGGGTGGGCAGGG + Intergenic
1088037334 11:105333938-105333960 GGTGCGACCCACAGAGAGCAAGG + Intergenic
1202806266 11_KI270721v1_random:7202-7224 ACCAAGACCCACAGGGGGCAGGG - Intergenic
1096227811 12:49877665-49877687 GGCCAGACCCACAGCGTCCAAGG - Intronic
1097088588 12:56487876-56487898 AGCGAGAACCACAGTGGGAGTGG + Intronic
1101445902 12:104736653-104736675 GGCCAGACTCACAGAGGGCCAGG - Intronic
1101606679 12:106252133-106252155 GGCAAGGCCCCCAGTGGCCAAGG + Intronic
1101953897 12:109197165-109197187 TGCGAGTCCCACTGTGGGCTGGG + Intronic
1102030140 12:109735569-109735591 GGTAAGACCCACAGTGGAGATGG - Intronic
1103597865 12:122035108-122035130 AGAGAGCCCCACAGTGGGGAGGG - Intronic
1104923421 12:132303125-132303147 GGTGACAGCCACAGTGTGCATGG - Intronic
1106182473 13:27381105-27381127 GCAGAGCCCCACATTGGGCAGGG + Intergenic
1107546700 13:41440067-41440089 GGTGAGAGCCACAGGTGGCAAGG + Intergenic
1108356178 13:49630566-49630588 GTTGAAACCAACAGTGGGCAGGG - Exonic
1108441327 13:50456267-50456289 GCCAAGAGCCACAGTGGACAAGG - Intronic
1110404446 13:75134125-75134147 GCCCAAACCCAAAGTGGGCAAGG + Intergenic
1112431297 13:99352704-99352726 GGTGAGTCCCACAGTGACCAAGG + Intronic
1112549117 13:100403500-100403522 GGTGAGAACCACAGTGAGCGGGG + Intronic
1113784880 13:112997202-112997224 GGCCAGACCCACAGTGGTCTTGG - Intronic
1114424814 14:22612568-22612590 GTCGAGATCCACAGTGTGGATGG + Exonic
1114536972 14:23429117-23429139 GGAGAGACCCATATTGAGCAGGG + Intronic
1114958111 14:27848927-27848949 GGCGTGACCCACAGAGAGCAAGG + Intergenic
1116312888 14:43347703-43347725 GGCGAAACACACAGAGAGCAAGG - Intergenic
1116849553 14:49893858-49893880 GTTGAAACCCACAGTGGGAATGG - Exonic
1118735396 14:68697261-68697283 GGGGAGACCCACCTTGGGCCTGG - Intronic
1121654029 14:95581894-95581916 GGGAGGACCCAGAGTGGGCACGG - Intergenic
1122159044 14:99769456-99769478 GGCCTCCCCCACAGTGGGCAGGG + Intronic
1122362217 14:101174247-101174269 GACGAGGCCCAGAGAGGGCAAGG + Intergenic
1122957285 14:105076641-105076663 GGGGTGACGCAGAGTGGGCAAGG + Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125512947 15:40302653-40302675 AGAGAGAGCCACACTGGGCAGGG - Intronic
1126143644 15:45456957-45456979 GCCGAGGCACACTGTGGGCATGG - Intergenic
1130393655 15:83482049-83482071 GGCAAGACCCAGTGTTGGCAAGG - Intronic
1130541084 15:84821262-84821284 GGCGAGGCCTAGAGAGGGCAGGG + Intronic
1130715571 15:86330110-86330132 GGCAGCAGCCACAGTGGGCAGGG - Intronic
1131104389 15:89721776-89721798 GGCTAGACCCTTACTGGGCATGG - Intronic
1131535247 15:93232067-93232089 GGTCAGCCCCACAGTGAGCAGGG - Intergenic
1132711835 16:1272320-1272342 GGAGAGAACCACACAGGGCAAGG - Intergenic
1132850611 16:2023351-2023373 GGCTAGAGCCGCAGTGGGCGGGG + Intergenic
1132871177 16:2116446-2116468 GGCGAGACCCACAGTGGGCAGGG + Intronic
1134521350 16:14920448-14920470 GGCGAGACCCACAGTGGGCAGGG - Intronic
1134607589 16:15583296-15583318 GGCGTGATCCACTGTGGGCCTGG - Intronic
1134709025 16:16319099-16319121 GGCGAGACCCACAGTGGGCAGGG - Intergenic
1134716234 16:16359133-16359155 GGGGAGACCCACAGTGGGCAGGG - Intergenic
1134950580 16:18349546-18349568 GGCGAGACCCACAGTGGGCAGGG + Intergenic
1134958518 16:18393026-18393048 GGGGAGACCCACAGTGGGCAGGG + Intergenic
1137395960 16:48116316-48116338 GGGGAGCTCCACGGTGGGCAGGG + Intronic
1137850612 16:51738375-51738397 GGCAAGATCCTCAGTGGACAGGG - Intergenic
1139366866 16:66438942-66438964 GGCATTACCCACAGTGAGCAGGG - Intronic
1139476888 16:67207310-67207332 GGCCAGGCCCCCAGCGGGCAGGG - Exonic
1139774922 16:69311174-69311196 GGCGAGACGGACAGGGGGCGGGG - Intronic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141705399 16:85661798-85661820 GGAGAGCCGCACAGTGGGGATGG + Intronic
1142151705 16:88515404-88515426 GTGGAGGCTCACAGTGGGCAGGG - Intronic
1143125303 17:4638127-4638149 TGCGGGACCCACTGTGGGCCTGG - Intronic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1143403201 17:6658982-6659004 TGCGGGACCCACTGTGGGCCTGG + Intergenic
1143783382 17:9240747-9240769 GGCCAGCCCCACGCTGGGCAGGG - Exonic
1144004244 17:11085811-11085833 GGCGACACTGACAGTGGGCCTGG + Intergenic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1144586053 17:16488431-16488453 GGCCAGACCCAAAGTGAGTAAGG + Intronic
1146471979 17:33131890-33131912 AGCCAGACACACAGTGGGGAGGG + Intronic
1147660070 17:42112610-42112632 GGCGAGACCCAGGCTGGGCAAGG - Exonic
1147982342 17:44282372-44282394 GGAGAAAACCCCAGTGGGCATGG + Intergenic
1148432236 17:47650873-47650895 GGGGAGAGCCACAGGGGCCACGG - Intronic
1148995092 17:51702609-51702631 GGGGAGACCCACTGTGTGCATGG + Intronic
1149683446 17:58521200-58521222 GGGGAGAGCCACTGAGGGCAAGG + Intronic
1150654364 17:67030391-67030413 GGTTAGACCCACAGTGGGACGGG - Intronic
1151756036 17:76075831-76075853 GGCGAGAGGCAGAGTGGGCTGGG - Intronic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1154062498 18:11075567-11075589 GACAAGACCGCCAGTGGGCACGG - Intronic
1157506232 18:48228605-48228627 GGCGGCAACCACAGTGGGCAAGG - Intronic
1160804949 19:988525-988547 AGCGAGGCCCAGAGAGGGCATGG + Intronic
1161441025 19:4291674-4291696 GGAGAGGCCCACTGTGGCCAAGG - Intergenic
1161604397 19:5206679-5206701 GCCTGGACCCCCAGTGGGCAGGG - Exonic
1162029787 19:7912444-7912466 GGCCAGCCCCACAGGGGGCCAGG + Exonic
1162366339 19:10251957-10251979 GGCGGGACCCAAAGTAGGCTAGG + Exonic
1162376564 19:10308729-10308751 TGGGAGGCCCACAGTGGGCGAGG - Exonic
1163258959 19:16175161-16175183 GGTGAGACCCAAAGTGAGAAGGG - Intergenic
1163642403 19:18469165-18469187 GGGAAGACACACAGAGGGCATGG + Intronic
1163643736 19:18476490-18476512 GGCGTGGCCCACAGGGAGCATGG - Intronic
1164644039 19:29845025-29845047 GGCCAGAGCAACAGTGGGCGGGG + Intergenic
1165101397 19:33440591-33440613 AGTGAGACCCAAAGTGGGCGAGG - Intronic
1166996507 19:46722101-46722123 GGCGAGGCCCAGAGTGGGAGGGG - Intronic
1167511486 19:49897438-49897460 GACGAGAGCCACAGAGGGGAGGG - Intronic
1168353029 19:55687323-55687345 CCTGAGACCCTCAGTGGGCAGGG + Intronic
927009439 2:18887530-18887552 GGAGAGGCCCATTGTGGGCAAGG - Intergenic
930455827 2:51606097-51606119 GGCATGACCCACAGAGAGCAAGG - Intergenic
931300544 2:60974160-60974182 GAGAAGACCCACAGTGGGTAGGG - Intronic
931739409 2:65228190-65228212 GGCGAGACCGGCACTGGACATGG + Intronic
934479189 2:94619117-94619139 GGCGTGACCCACAGGGAGCAAGG - Intergenic
934766107 2:96880996-96881018 GCCGAGACCCAGGCTGGGCAAGG + Intronic
934937774 2:98477758-98477780 GGCAAGACCCACACAGGGCAGGG - Intronic
938245038 2:129769724-129769746 GGCGACACCAACAGTGGACCGGG + Intergenic
938381156 2:130837244-130837266 GGCGAGCCCCTGAGAGGGCAAGG + Intronic
940592480 2:155747941-155747963 GGCGTGATCCACAAGGGGCAAGG + Intergenic
941164974 2:162074444-162074466 ACCGAGACCCAGAGAGGGCAGGG + Exonic
946833682 2:223750366-223750388 AGCCAGACCTGCAGTGGGCATGG + Intergenic
948627775 2:239279727-239279749 GGCCAGGCCCGCAGGGGGCATGG + Intronic
1172183680 20:33018725-33018747 GGAGAGGCCCACGGTGGCCATGG - Exonic
1172244686 20:33437872-33437894 ACCGAGGCCCACAGAGGGCAAGG + Intronic
1172813879 20:37671082-37671104 GTGAACACCCACAGTGGGCAAGG - Intergenic
1173537993 20:43830380-43830402 AGCCAGACCCGCACTGGGCATGG - Intergenic
1173813087 20:45968239-45968261 GGGGAGGCCTGCAGTGGGCAGGG - Intronic
1175343407 20:58250409-58250431 GGTGAGACCCACCGAGGCCAGGG + Intergenic
1175776788 20:61658782-61658804 AGCAACACCCACAGTGGACATGG + Intronic
1175893329 20:62324953-62324975 GGACAGACACACAGTGGGCGAGG + Intronic
1175957306 20:62617982-62618004 GGTGACACCCACAGTGGCCCAGG + Intergenic
1176181498 20:63751791-63751813 GGGGAGACCCACCGGGGGCGGGG - Intronic
1176289117 21:5034923-5034945 GGGAAGACCCACAGTGGGTCTGG - Intronic
1178585243 21:33865936-33865958 GCAGAGACCCACACTGGCCAAGG - Intronic
1179868118 21:44228681-44228703 GGGAAGACCCACAGTGGGTCTGG + Intronic
1180600207 22:17010544-17010566 GGTGAGACCCATGGTGGGCACGG - Intergenic
1181673711 22:24438481-24438503 TGCGAGTCCCACAGGAGGCAGGG + Intronic
1182755172 22:32673381-32673403 ATCAAGACCCACAGTGGGGAGGG - Intronic
1183597495 22:38821567-38821589 GGCCAGGCCCAGAGAGGGCAGGG + Exonic
1184099993 22:42336953-42336975 GGGGAGACAGACAGTGAGCAAGG - Intronic
1184155115 22:42662312-42662334 GCCGGGACCCAAGGTGGGCACGG - Intergenic
1184335962 22:43853426-43853448 GACGTGGCCCAGAGTGGGCAGGG - Intronic
1184389098 22:44192722-44192744 GGCCACACCCCCGGTGGGCAGGG - Intronic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185370762 22:50459877-50459899 GCCCAGGCCCACAGCGGGCAGGG + Intronic
1185417214 22:50716772-50716794 GGAGGGATGCACAGTGGGCAGGG - Intergenic
952881060 3:37986628-37986650 GGGCAGGACCACAGTGGGCAAGG + Intergenic
955380393 3:58433709-58433731 GGCGGGACGCAGGGTGGGCAGGG + Intronic
958954364 3:100451343-100451365 GGGAAAACCCAAAGTGGGCAGGG + Intronic
960998195 3:123353110-123353132 GTGGAGACCCACTGTGGCCATGG - Intronic
961364600 3:126391185-126391207 GTGCAGACCCACAGTGGGCCTGG - Intergenic
961660901 3:128468327-128468349 AGCGAGGCCCAGAGAGGGCAGGG + Intergenic
962358325 3:134714012-134714034 GGTGAGTCCCAGAGTGGGCTGGG + Intronic
962739754 3:138354632-138354654 GGCTAAACCCACAATGGTCAAGG - Intronic
964058897 3:152496482-152496504 GCGGAGACCCTCAGTGGACAAGG - Intergenic
968645319 4:1737752-1737774 GGCTTGGCCAACAGTGGGCAGGG + Intronic
968697900 4:2041768-2041790 GGCGAGACCTCCAGAGCGCAAGG - Intronic
968701080 4:2058705-2058727 TCCGAGCCCCGCAGTGGGCACGG - Intergenic
968774836 4:2534598-2534620 GGCGAGAGCCACACTGTGCCCGG + Intronic
974913406 4:68149641-68149663 GGCATGACCCACAGAGAGCAAGG - Intergenic
975620471 4:76291324-76291346 GGCAGAACCCACACTGGGCATGG - Intronic
975820612 4:78267108-78267130 GGCCCGACCCACGATGGGCAGGG - Intronic
976913359 4:90337330-90337352 GTTGTGACCCACAGTGGACAAGG + Intronic
979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG + Intergenic
980566597 4:134550825-134550847 GGCAAGATGCACAGTGGGGAAGG - Intergenic
982452829 4:155572978-155573000 GGCGTGACCCACAGAGGGGAAGG + Intergenic
983820849 4:172192512-172192534 GGAGTGACCCACAGAGAGCAAGG + Intronic
985446388 4:190023067-190023089 GGCGACACCCACAGAGGGCCTGG - Intergenic
990694596 5:58401837-58401859 GGTCAGACCCAGAGTGGTCATGG - Intergenic
990940836 5:61201107-61201129 GGCGTGACCCACGGAGAGCAAGG - Intergenic
995184041 5:109253274-109253296 GGCCAGACCCATAGAGAGCAAGG + Intergenic
997460858 5:134051308-134051330 GGCAGCACCCACAGTGGGCTAGG + Intergenic
999826240 5:155276200-155276222 GGTGAGACTCACAGTGACCAAGG + Intergenic
999997740 5:157108201-157108223 GGCGTGACCCACCGTGTGCCCGG - Intronic
1000027208 5:157369670-157369692 GAGGACACCCCCAGTGGGCAGGG + Intronic
1001569055 5:172718316-172718338 GGGGAGACCCACTGGGGTCAGGG - Intergenic
1001753289 5:174147664-174147686 GGCCAGACCCATGCTGGGCAGGG - Intronic
1002215871 5:177632196-177632218 GGTGAGGCTCTCAGTGGGCAAGG + Intergenic
1005351608 6:24941285-24941307 GGCAAGACTCACATTGGGTATGG + Intronic
1005840549 6:29742313-29742335 GGCGGAACCCACAGTGGGCAGGG - Intergenic
1006060410 6:31414583-31414605 GGCAGAGCCCACAGTGGGCAGGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006716844 6:36125796-36125818 GGCGAGACCTACTGTGTGCCAGG + Intergenic
1007308951 6:40929783-40929805 GGCTAGATGAACAGTGGGCAAGG - Intergenic
1009707211 6:67266787-67266809 GGCATGACCCACAGAGAGCAAGG - Intergenic
1012231713 6:96768246-96768268 GGTGAGACCCACACAGAGCAAGG + Intergenic
1013958567 6:115869781-115869803 GACAAGACCCACAGAAGGCAGGG - Intergenic
1018379982 6:163249959-163249981 GGTGGGAACCACAATGGGCAAGG - Intronic
1018438295 6:163783165-163783187 GGCGAGACGCAGGGTGGGAAGGG + Intergenic
1019179225 6:170176477-170176499 GGGGGGACCCACAGAGGGCAGGG + Intergenic
1019989531 7:4682161-4682183 GGCGAGGCGCACGGTGGGCTGGG + Intergenic
1020007773 7:4791495-4791517 GGCAAGGCCCACGGTGGGCTTGG + Exonic
1021123780 7:16826626-16826648 GGCAGTACTCACAGTGGGCATGG + Intronic
1022544462 7:31173262-31173284 GCCAGGACCCACAGAGGGCAGGG + Intergenic
1023463072 7:40421596-40421618 GGTGAGTCATACAGTGGGCATGG + Intronic
1023899343 7:44463336-44463358 GGTGACACCCACAGAGGGCACGG + Intronic
1024342132 7:48277222-48277244 AGGGAGGCCCACAGTAGGCAGGG + Intronic
1024559229 7:50629428-50629450 GGCGAGACCCTGAGGGGGCAAGG + Intronic
1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG + Intergenic
1025665409 7:63580620-63580642 GGCAGGAGCCACAGTGGGAAGGG - Intergenic
1028517879 7:91698429-91698451 GGCGTGACCCACAGAGAGGAAGG + Intronic
1029080097 7:97966286-97966308 GGCGAGACCCACAGGTGGAGAGG + Intergenic
1029383248 7:100226894-100226916 GACGAGACCCAGAGTGGTCTTGG + Intronic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1032087543 7:128891709-128891731 GGCGAGGCTGGCAGTGGGCATGG + Exonic
1034426594 7:151017262-151017284 GCCGAGAGCCACTGTGAGCAAGG + Exonic
1034980778 7:155474772-155474794 GGCATGACCTGCAGTGGGCAAGG - Intronic
1035044081 7:155952671-155952693 GGGGAGAAACACAGTGGGGAGGG + Intergenic
1035388718 7:158490927-158490949 TGCCAGACACACAGAGGGCATGG - Intronic
1035514455 8:220593-220615 GGCGTGAACCACAGTGCGCAGGG - Intergenic
1035714196 8:1741340-1741362 GGTGAGACCCACGTTGGGTAAGG + Intergenic
1039854516 8:41400695-41400717 TGCGAGGCTCACAGTGGTCAAGG - Intergenic
1042773532 8:72404938-72404960 GGTGTGACCCACAGAGAGCAAGG + Intergenic
1044614973 8:94130662-94130684 TGGGATACCCACTGTGGGCATGG - Exonic
1047845435 8:128800438-128800460 GGCGAGACCAGAAGTGGACAAGG + Intergenic
1049272110 8:141701356-141701378 GGAAAGACCCACTGTTGGCACGG + Intergenic
1049405397 8:142449946-142449968 GGCGAGGCCCAGAGCGGGCCGGG + Exonic
1049436605 8:142589038-142589060 GGTGATGACCACAGTGGGCAGGG + Intergenic
1053678636 9:40464448-40464470 GGCCTGACCCACAGGGAGCAAGG + Intergenic
1053928620 9:43092802-43092824 GGCCTGACCCACAGGGAGCAAGG + Intergenic
1054285088 9:63160494-63160516 GGCCTGACCCACAGGGAGCAAGG - Intergenic
1054291714 9:63299986-63300008 GGCCTGACCCACAGGGAGCAAGG + Intergenic
1054389731 9:64604529-64604551 GGCCTGACCCACAGGGAGCAAGG + Intergenic
1054505982 9:65911847-65911869 GGCCTGACCCACAGGGAGCAAGG - Intergenic
1056710553 9:88989522-88989544 GGGGAGACCCACTGAGGACAGGG + Intergenic
1057164503 9:92915080-92915102 TGCGGGACCCACTGTGGGCCTGG + Intergenic
1057604593 9:96489852-96489874 GGCAGGACCCACAGTGGGAAGGG - Intronic
1058525067 9:105849672-105849694 GGAGAGCCACAGAGTGGGCAAGG - Intergenic
1060090384 9:120737851-120737873 CGCGAGAACCAGTGTGGGCAAGG - Intergenic
1061975586 9:134066908-134066930 GCCGAGACCCACCGGGGGCAGGG - Intronic
1062179047 9:135180808-135180830 GTCCAGCCCCACAGTGGGAAGGG - Intergenic
1062501855 9:136855138-136855160 GGGGAGCCGCACTGTGGGCAGGG + Intronic
1189701145 X:43717009-43717031 GGCGAGACACAAAGTGGTTAAGG + Intronic
1191225297 X:58035749-58035771 GGTGTGACCCACAGAGAGCAAGG - Intergenic
1192314933 X:70044029-70044051 GGGCAGGCCCACAGTGGGAATGG - Intronic
1196791639 X:119469335-119469357 GGCGAGTCCCACATAGGGCGCGG - Intronic
1200523813 Y:4247122-4247144 GGCGTGACCCACAGAGAGCAAGG + Intergenic