ID: 1132872485

View in Genome Browser
Species Human (GRCh38)
Location 16:2122041-2122063
Sequence CAGGCTGCCCGGTGGGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 431}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132872471_1132872485 20 Left 1132872471 16:2121998-2122020 CCGCTCCCACAGGAGCCTACCCG 0: 1
1: 0
2: 2
3: 16
4: 148
Right 1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG 0: 1
1: 1
2: 2
3: 40
4: 431
1132872470_1132872485 28 Left 1132872470 16:2121990-2122012 CCGGAGCTCCGCTCCCACAGGAG 0: 1
1: 0
2: 1
3: 18
4: 143
Right 1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG 0: 1
1: 1
2: 2
3: 40
4: 431
1132872474_1132872485 14 Left 1132872474 16:2122004-2122026 CCACAGGAGCCTACCCGGCGCAG 0: 1
1: 1
2: 1
3: 7
4: 101
Right 1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG 0: 1
1: 1
2: 2
3: 40
4: 431
1132872473_1132872485 15 Left 1132872473 16:2122003-2122025 CCCACAGGAGCCTACCCGGCGCA 0: 1
1: 0
2: 2
3: 2
4: 43
Right 1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG 0: 1
1: 1
2: 2
3: 40
4: 431
1132872476_1132872485 5 Left 1132872476 16:2122013-2122035 CCTACCCGGCGCAGGAGAGACGC 0: 2
1: 0
2: 0
3: 5
4: 69
Right 1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG 0: 1
1: 1
2: 2
3: 40
4: 431
1132872477_1132872485 1 Left 1132872477 16:2122017-2122039 CCCGGCGCAGGAGAGACGCACAC 0: 2
1: 0
2: 0
3: 11
4: 104
Right 1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG 0: 1
1: 1
2: 2
3: 40
4: 431
1132872478_1132872485 0 Left 1132872478 16:2122018-2122040 CCGGCGCAGGAGAGACGCACACA 0: 2
1: 0
2: 1
3: 11
4: 92
Right 1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG 0: 1
1: 1
2: 2
3: 40
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132872485 Original CRISPR CAGGCTGCCCGGTGGGGCCC GGG Intronic
900140200 1:1136658-1136680 CAGGCGGCCCGCAGGGACCCAGG - Intergenic
900262356 1:1738289-1738311 CAGGCGGAGGGGTGGGGCCCAGG + Intronic
900291009 1:1923598-1923620 CTGGGGGCCCCGTGGGGCCCTGG + Intronic
900355297 1:2258873-2258895 CCTGCTCCCAGGTGGGGCCCTGG - Intronic
900514234 1:3073756-3073778 CAGGCTGCGCGGTGTGGACGCGG - Intronic
900663151 1:3796098-3796120 CCGGCGGCTCGGCGGGGCCCAGG + Exonic
900796658 1:4712287-4712309 CGCGGTGGCCGGTGGGGCCCCGG + Exonic
901040510 1:6360358-6360380 CAGGCAGCCTGCCGGGGCCCAGG + Intronic
901361290 1:8703152-8703174 CAGGCGGGCAGGTGGGGGCCCGG + Intronic
901674376 1:10874430-10874452 CAGGTAGCCAGGTGGGACCCAGG + Intergenic
901786736 1:11629773-11629795 CAAGCTGCCCCCTGGGACCCTGG + Intergenic
902339608 1:15774523-15774545 GAGGCTGCCCTCAGGGGCCCAGG - Intronic
902534282 1:17110213-17110235 GAGGCTGCAGGGAGGGGCCCAGG + Intronic
902807918 1:18872384-18872406 CAGACTGACCTGTGGGGCACAGG - Exonic
902818171 1:18927795-18927817 CAGGCTCCCCGGTGGGGTCAGGG + Intronic
903035918 1:20492481-20492503 CAGGCTTCTCGGTGGGATCCTGG - Intergenic
903044235 1:20553668-20553690 CAGGCGGCGCAGTGGGGCGCGGG - Exonic
903241709 1:21986990-21987012 GAGGCTGCCTGGTGGGGGACAGG + Intronic
903245216 1:22010164-22010186 GAGGCTGCCTGGTGGGGGACAGG + Intronic
903777115 1:25800269-25800291 GAGGCTGCGCGGCGGGGCCGGGG - Exonic
903999907 1:27332992-27333014 CAGAGTGCCCGGTGGGTCTCAGG - Intronic
904034668 1:27552133-27552155 CAGGCCGCCGGGCGGGGCCGGGG + Exonic
904042160 1:27591259-27591281 TAGGCTGGTGGGTGGGGCCCAGG + Intronic
904261361 1:29289586-29289608 CAGGCAGCAGGGTGGGGCCTGGG - Intronic
904267788 1:29327437-29327459 CAGGCTGGCTGGTAGGGACCTGG + Intergenic
904428444 1:30446701-30446723 CAGTCTGCCTGGTGCAGCCCAGG - Intergenic
905308188 1:37033305-37033327 GAGGCCGCCCAGTGCGGCCCGGG - Intronic
906152734 1:43597600-43597622 CAGCCTGCCTGGAGGGACCCTGG + Intronic
907423372 1:54362561-54362583 GGGGCTGCCCGGAGGAGCCCAGG - Intronic
907426721 1:54384381-54384403 CAGACTGCACAGAGGGGCCCTGG + Intronic
909048948 1:70745515-70745537 CAGGCTCCCCTGTGGGGCTAAGG - Intergenic
912384679 1:109265366-109265388 CAGCCTGCCCTCTAGGGCCCAGG - Intronic
913219205 1:116645894-116645916 AGGGCAGCCTGGTGGGGCCCTGG + Intronic
914928484 1:151909220-151909242 TATGCTGCCCTGTGGTGCCCAGG + Intronic
915549789 1:156625334-156625356 TAGGCTGCCTGTTGGGGCCTGGG - Exonic
916184003 1:162113341-162113363 CTGGCGGCCCAGTGGGGTCCTGG + Intronic
916678801 1:167086230-167086252 CTGGCTCCCCGCTGGGGCCTGGG - Intronic
920007678 1:202845248-202845270 CAGGCTGCCCAGAGTGCCCCAGG + Intergenic
920669377 1:207991497-207991519 CAGCCTGCCTGGTGGCCCCCTGG - Intergenic
922518080 1:226223367-226223389 GGGGCAGCCCGGAGGGGCCCGGG - Intergenic
922766318 1:228158331-228158353 CGTGTTGCCCGGTCGGGCCCGGG - Exonic
923772255 1:236947954-236947976 CAGGAGGCCCTGTGGGGCGCAGG + Intergenic
1062992910 10:1836761-1836783 CAGCCTGCCCTGTGGGGCCTCGG - Intergenic
1063636437 10:7787617-7787639 CAGGCTGCCCGCTGGGCCCGGGG + Intronic
1064231039 10:13529202-13529224 CAGGCAGGCCGGCCGGGCCCGGG - Intergenic
1064380681 10:14838750-14838772 CAGGGTGCCCGGGGGGGTCCCGG + Intronic
1070168333 10:73914208-73914230 GAAGCTGCCCGGTGGGGCAGGGG + Intronic
1070540245 10:77410412-77410434 CAGGCAGCAGGGAGGGGCCCTGG - Intronic
1070789255 10:79179952-79179974 CAGCCTGCCCCGTTGGCCCCAGG - Intronic
1070961871 10:80505196-80505218 CAGGGTGCCCTGTGGGGCAGGGG + Intronic
1072409088 10:95183924-95183946 CACGCTGACCCGTGGGGCCCCGG + Intergenic
1072659658 10:97355981-97356003 CAGGCTGCCAGGAGGTGCACAGG + Intergenic
1073063866 10:100747122-100747144 CAGCCTTCCAGGTGGGCCCCCGG + Intronic
1073122542 10:101131514-101131536 CGGGCCCCCCGGTGGGGCCAGGG + Exonic
1073509281 10:104033319-104033341 CAGGCTGGCCTGGTGGGCCCTGG + Exonic
1074101495 10:110357923-110357945 CAGTCTGGCTGGTGGGACCCAGG - Intergenic
1074942897 10:118252153-118252175 CAGGCAGCCAGGTGAGGCCGTGG + Intergenic
1076138223 10:128059408-128059430 AAGGCTGCCAGGTGGGCCACGGG - Intronic
1076140353 10:128073490-128073512 CAGGCTGCCCTGGAGGGACCGGG - Intronic
1076150850 10:128160920-128160942 CAGGCTGCTCTGTATGGCCCAGG - Intergenic
1076319129 10:129565106-129565128 TAGCCTGCCCGGCGGGGCCGGGG + Intronic
1076606883 10:131695057-131695079 CAGGGTGTCCAGTGGGTCCCTGG + Intergenic
1076791452 10:132779037-132779059 GAGCCTGCCTGGTGGGGGCCTGG + Intronic
1077026369 11:441771-441793 CAGGCTGCCCGGTCAGGCGAGGG - Intronic
1077050467 11:564153-564175 CAGGGTGCTCAGTAGGGCCCAGG + Intergenic
1077119425 11:899942-899964 CAGACGGCCAGGTGGGACCCGGG + Intronic
1077160185 11:1109172-1109194 GAGGCTTCCTGGTGAGGCCCAGG - Intergenic
1077167196 11:1149045-1149067 GTGTCTGCCAGGTGGGGCCCTGG + Intergenic
1077259319 11:1607375-1607397 CAGGCTCACAGGAGGGGCCCAGG + Intergenic
1077412872 11:2411561-2411583 CGGCCAGCCGGGTGGGGCCCAGG + Intronic
1077435750 11:2538381-2538403 CAGGCCCCTCTGTGGGGCCCAGG + Intronic
1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG + Exonic
1077550163 11:3196658-3196680 CAGGCTGACCTGTGTGGGCCTGG + Intergenic
1078540065 11:12206228-12206250 CAGGATGCCTTGTGGGGCCCTGG + Intronic
1081867020 11:46365795-46365817 CTGGATGGACGGTGGGGCCCAGG - Intronic
1083683403 11:64361623-64361645 CAGCCTGCCGGGTGGAGCCGGGG - Exonic
1083923000 11:65790423-65790445 CAGGCTGGGCGGTGGGACACTGG + Intronic
1084007838 11:66332560-66332582 CCGCCTGCCCCCTGGGGCCCTGG - Exonic
1084019782 11:66410578-66410600 CAGGCTGTCCTCTGGGGCCCAGG - Intergenic
1084208448 11:67609544-67609566 AAGGCTGCCTGGTGGGGGGCCGG + Exonic
1084692975 11:70737647-70737669 CTGGCTGCCCACTGGGGCCTGGG - Intronic
1084800243 11:71538891-71538913 CAGGCTCACAGGAGGGGCCCAGG - Exonic
1085457884 11:76675524-76675546 CAGGCTCTGCGGTGGGGCTCGGG + Intergenic
1085508039 11:77071256-77071278 CAGGCTGCACACTGGGGCCAGGG - Intronic
1088884017 11:113993140-113993162 CAGGGTGCACAGTGTGGCCCGGG - Intergenic
1088906102 11:114156529-114156551 CCCACTGCCCGCTGGGGCCCTGG + Intronic
1089282112 11:117381776-117381798 CGGGCTGCCCCTCGGGGCCCTGG - Exonic
1089643833 11:119865032-119865054 CATCCTGCCCGGAGGAGCCCCGG + Intergenic
1089681639 11:120121966-120121988 CAGGCTGGCCGGCTGGGGCCTGG + Intronic
1092263189 12:6963177-6963199 CAGGGTGGCAGGCGGGGCCCAGG + Intergenic
1094155487 12:27333263-27333285 AAGGCCGCCCCGTGGGGCACAGG + Intronic
1096144013 12:49265293-49265315 CAGGTTAACCGGAGGGGCCCGGG - Intronic
1101680120 12:106956171-106956193 CTGGCTGCCCAGCGGGGCCTTGG + Intronic
1102586078 12:113923887-113923909 CCTGCTGCCTGGTGGGGCCTGGG + Intronic
1102783967 12:115588770-115588792 GGGGCTGCCCGCTGGGGCTCTGG + Intergenic
1103147938 12:118611488-118611510 CAGGCAGACCGATGTGGCCCAGG + Intergenic
1103614058 12:122141176-122141198 CAGGCAGCCAGGTGGGGCCGGGG + Intronic
1105614684 13:22001064-22001086 GAGGCAGCCTGGTGTGGCCCTGG - Intergenic
1106500269 13:30321766-30321788 CAGGCTCCCAGGTGACGCCCAGG - Intergenic
1107020665 13:35747608-35747630 AGGGCTGCCAGGTGGGTCCCTGG + Intergenic
1107467494 13:40664640-40664662 GAGGCTGCCCTGAGGGGCCGGGG - Intronic
1108598505 13:51970845-51970867 GAGGCTGCTCGGTGGGAGCCGGG - Intronic
1112120988 13:96411273-96411295 CAGGCTGCCAGTGTGGGCCCTGG - Intronic
1112311158 13:98318572-98318594 CAGGCTGCCCTGAGGCACCCTGG + Intronic
1113424698 13:110198476-110198498 CAGGCTGCCCAGGGGGCCCAGGG + Exonic
1113782656 13:112985581-112985603 CAGACTGCCCTGTGGAGCACGGG - Intronic
1113893434 13:113748625-113748647 CAGGCTTCACGGTGTGGCCCTGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115850170 14:37584436-37584458 CCGTCTGGCGGGTGGGGCCCAGG + Intergenic
1119645676 14:76346634-76346656 CAGGCAGCCCGGCTGTGCCCAGG + Intronic
1119725761 14:76920903-76920925 CAGGCTGCAGGGTGGTGCCCGGG + Intergenic
1119856392 14:77904392-77904414 CAGGCTGCTGGCTGGAGCCCCGG - Intronic
1121382899 14:93489864-93489886 CAGCCTGCAGAGTGGGGCCCAGG - Intronic
1122070792 14:99204231-99204253 CAAGCTGCCTGGTGGGCCTCTGG + Intronic
1122582317 14:102778099-102778121 CGGGCCGGCCGGGGGGGCCCGGG + Intronic
1122715244 14:103693065-103693087 CGAGCTGCCGGGTGGGCCCCAGG - Intergenic
1122791013 14:104184186-104184208 CAGACAGCCTGGCGGGGCCCCGG - Intergenic
1122797182 14:104211920-104211942 CCGGCTGGCCGGGGTGGCCCTGG + Intergenic
1122824728 14:104364109-104364131 CAGACTGCCGGGTGGGGCTGGGG + Intergenic
1122929309 14:104926118-104926140 CAGGCTGGGCGCTGGGACCCAGG - Intronic
1123112619 14:105880317-105880339 CGGGCTGCCTGGTGTGGCCATGG + Intergenic
1124687826 15:31797568-31797590 CAGCCTGCATGGTGGGGCCTGGG - Intronic
1125729630 15:41885878-41885900 CAGGCTGGCTGGCGGGGCTCTGG + Exonic
1126645280 15:50869431-50869453 AAGGCTTCCCAGTGGCGCCCTGG + Intergenic
1126852664 15:52806422-52806444 CCTGCGGCCGGGTGGGGCCCCGG - Intergenic
1127860795 15:62992795-62992817 CAAAGTGCCCTGTGGGGCCCAGG + Intergenic
1128161094 15:65423107-65423129 CAGGGTCCCCGGCGGGGCCAGGG - Intergenic
1128710324 15:69866799-69866821 CAGGCTGGGTGGTGGAGCCCAGG + Intergenic
1128717407 15:69918757-69918779 TAGGCTGCCCTGTGGGGCAGGGG + Intergenic
1129191681 15:73941327-73941349 CAGGCTCCCCCATGAGGCCCAGG + Intronic
1129221513 15:74134267-74134289 CTGGCTGCGCGCTGGGGCCCTGG + Exonic
1129489414 15:75908893-75908915 CATGATGGCCTGTGGGGCCCAGG - Intronic
1129600774 15:76996847-76996869 CAGGCTGGCAGCTGGAGCCCTGG + Intronic
1129739146 15:77981593-77981615 CAGGCTCCTTGGTGGGACCCGGG - Intergenic
1129782738 15:78284547-78284569 CAGGCTTCCAGGTGAGGCCAAGG - Intronic
1129846813 15:78771596-78771618 CAGGCTCCTTGGTGGGACCCGGG + Exonic
1130255087 15:82322295-82322317 CAGGCTCCTTGGTGGGACCCGGG - Intergenic
1130352768 15:83106780-83106802 CAGGCTGGCTGGTGGGCACCTGG + Intergenic
1130531209 15:84748766-84748788 CAGGCTGCAGGGCCGGGCCCCGG - Intronic
1130555313 15:84918453-84918475 CAGGGTGCCAGGCGGGGCCCAGG - Intronic
1130599887 15:85267711-85267733 CAGGCTCCTTGGTGGGACCCGGG + Intergenic
1131231902 15:90665632-90665654 CAGGCTGAACGCTGGAGCCCGGG - Intergenic
1132151827 15:99467506-99467528 CAGGCTGCCAGCGGGGGTCCCGG + Intergenic
1132313315 15:100872751-100872773 CTGGCTGCTCTGTTGGGCCCTGG - Intergenic
1132589987 16:722377-722399 CAGGCTGCCAGGTGGGGAGTGGG - Exonic
1132646335 16:1000927-1000949 CAGCCTGCACGTCGGGGCCCAGG - Intergenic
1132648036 16:1007998-1008020 CAGGCTTCCCGGTTGGGCAGTGG + Intergenic
1132666605 16:1083755-1083777 CACGCTGCCCCGTGGAGGCCTGG + Intergenic
1132733623 16:1375125-1375147 CCGGCTGCCCTGGGGGGCTCGGG - Intronic
1132804593 16:1769636-1769658 CAGGCTGCCAGGGCAGGCCCAGG + Exonic
1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG + Intronic
1132959206 16:2612801-2612823 CAGCCTCCCCGGCGAGGCCCAGG - Intergenic
1132972266 16:2694776-2694798 CAGCCTCCCCGGCGAGGCCCAGG - Intronic
1134551581 16:15141241-15141263 CAGGCTGCCTGGTGGGGCCCGGG + Intergenic
1135572287 16:23558064-23558086 CAGGCTGCCTCGTGCGGCGCCGG - Exonic
1135691295 16:24539838-24539860 CCGGCCGCCGGCTGGGGCCCGGG + Intronic
1136580481 16:31148476-31148498 CAGGCCACACGGCGGGGCCCAGG + Exonic
1137686422 16:50390154-50390176 CAGGCTTCCCGCTCAGGCCCGGG + Intergenic
1138657993 16:58501676-58501698 CAGGTAGCCCGGTGACGCCCAGG + Intronic
1141930435 16:87198746-87198768 CATGCTGGCCCGTGGGGCTCAGG - Intronic
1142281209 16:89148654-89148676 CAGAGTCCCCAGTGGGGCCCTGG - Intronic
1142290435 16:89191730-89191752 CAGGCTGCCCGGCGGCGGCGGGG - Exonic
1142293221 16:89201996-89202018 CAGGTTGCCCGGGGGCGCGCGGG + Intergenic
1142309670 16:89305146-89305168 CAGGCAGCCCGGAGCAGCCCAGG - Intronic
1142613617 17:1122955-1122977 CAGGCTTCCTGCTGGGGCCTTGG - Intronic
1142614729 17:1127617-1127639 CAGGCTGCCCTGTTGGTGCCTGG + Intronic
1142712744 17:1732322-1732344 CAGGTTCCCAAGTGGGGCCCAGG + Exonic
1142745957 17:1958350-1958372 CGGGGTGCCTGGTGGGGCACTGG - Intronic
1143010808 17:3865316-3865338 CAGGCTGGCCGGTGGACCACGGG - Exonic
1143106517 17:4533103-4533125 CAGCCCGCCCTGTGGGGCCAAGG + Exonic
1143446451 17:7012846-7012868 CAGGCAGGCCGGAGGGGCCGGGG + Intronic
1143670577 17:8393153-8393175 CAGGCTGTCCAGTGGGGGCACGG + Exonic
1144269073 17:13600707-13600729 CAGGGTCCCCGGCGGGGCCTCGG + Exonic
1145828930 17:27899165-27899187 CAAGCTCCCAGGTGAGGCCCAGG - Intergenic
1145905608 17:28514594-28514616 CAGCCTGTCGGGTGGAGCCCTGG + Intronic
1147728552 17:42582092-42582114 CCGGCTGGCAGGTGGGGCCTGGG + Exonic
1147892318 17:43726077-43726099 CAGGCCACCCTGTTGGGCCCTGG + Intergenic
1147993404 17:44348856-44348878 AAGCCTGCCCAGTGAGGCCCAGG + Intronic
1148290134 17:46439102-46439124 CAGCCTCCCCAGTGGGCCCCAGG + Intergenic
1148312302 17:46656675-46656697 CAGCCTCCCCAGTGGGCCCCAGG + Intronic
1148330733 17:46812454-46812476 CAGGCTGCTCTGGGCGGCCCTGG + Intronic
1148889592 17:50798354-50798376 GAGGCTGGCCCGTGGGACCCAGG + Intergenic
1148899873 17:50867118-50867140 CAGGCCTCCCGGTGCGACCCCGG + Intronic
1149507063 17:57203286-57203308 CAGGCTTCTCTGTGAGGCCCAGG - Intergenic
1150239988 17:63623047-63623069 CAGGCTGCCCCGCGGAGCACGGG - Intronic
1150488780 17:65560917-65560939 CGGCCGGCCCGGGGGGGCCCGGG - Intronic
1151427480 17:74040482-74040504 CTGGCCGGCGGGTGGGGCCCAGG + Intergenic
1151542686 17:74772752-74772774 CAGGCTGCCCAGCCAGGCCCTGG + Intronic
1151659600 17:75511907-75511929 CAACCTGCCCAGTGGGGCCTTGG - Intronic
1151703330 17:75754510-75754532 CAGCCTGCCCCACGGGGCCCGGG + Intronic
1151856346 17:76724982-76725004 CAGTCTCCCCAGTAGGGCCCAGG + Intronic
1152512644 17:80800972-80800994 ACGGCTGCCCCGTGTGGCCCAGG + Intronic
1152537687 17:80960042-80960064 CAGGCAGCCCGGTGAAGACCGGG - Intronic
1152573491 17:81130501-81130523 CAGGCTGCGAGGAGGGGCCGAGG - Intronic
1152586752 17:81192724-81192746 CAGGCAGCCAGGTGCCGCCCGGG - Exonic
1152686383 17:81695718-81695740 CAGCCTCCCTGGTGGGGCCTGGG - Intronic
1152698193 17:81806559-81806581 CCGGCTGGAAGGTGGGGCCCTGG + Intronic
1152804492 17:82348604-82348626 GAGGCTGCCAGGTGGGGTCCTGG + Intergenic
1152852977 17:82648524-82648546 TAGGCTCCCTGGTGGGGCGCGGG - Exonic
1152936927 17:83144569-83144591 GAGGCTGTAAGGTGGGGCCCAGG - Intergenic
1153818229 18:8809501-8809523 CAGGCTGCCAGCTGGGTCCACGG + Intronic
1155096340 18:22559738-22559760 CCGGCCGCCCGGTGGGTCGCTGG - Intergenic
1156265070 18:35480681-35480703 CAGGCTGCCTGCTGGAGCTCTGG - Intronic
1157555821 18:48612361-48612383 CAGGCTGTCAGGTGGCCCCCAGG - Intronic
1157598609 18:48878999-48879021 CAGGCTGCCCTGGGTGCCCCCGG - Intergenic
1158283287 18:55851073-55851095 CAGGCTGCTGGGCTGGGCCCTGG - Intergenic
1160736860 19:666965-666987 CAGGGTGGCCGGTGGGGCCTGGG - Intergenic
1160748119 19:720840-720862 CTGCCTGCCGGGTGGGGACCTGG + Intronic
1160760347 19:781075-781097 CTGGCCGCCCTGTGGGGCCCCGG + Intergenic
1161089184 19:2351796-2351818 GGGGGTGCCAGGTGGGGCCCGGG + Intronic
1161089204 19:2351836-2351858 GGGGGTGCCGGGTGGGGCCCAGG + Intronic
1161379774 19:3958831-3958853 CACGCTGCCTGGAGGGTCCCAGG + Exonic
1161388164 19:4007872-4007894 CCGGCCGCGCTGTGGGGCCCCGG - Intronic
1161829286 19:6590964-6590986 CGGGCTGCTCGGTGCGGCGCAGG - Exonic
1162321192 19:9971240-9971262 CGGGCAGCCCCGTGGGGCCCTGG + Exonic
1162377829 19:10315710-10315732 CGGGCGGCCCGGAGCGGCCCGGG - Exonic
1162472397 19:10880263-10880285 CAAGCAGCCAGGTGTGGCCCAGG - Intronic
1162788709 19:13052083-13052105 CAGGCATCCAGGTGGTGCCCGGG + Intronic
1164272827 19:23688278-23688300 CAGGCTGACCGTTAGGGCCAAGG - Intergenic
1164669209 19:30063314-30063336 CAGGCTCCCCTGCGAGGCCCTGG - Intergenic
1165068090 19:33240606-33240628 CAGCCTGCCCTGTGGGTGCCCGG + Intergenic
1165091200 19:33389255-33389277 CAGCCTGGCTGGTGTGGCCCCGG + Intronic
1165134620 19:33660007-33660029 CAGGAAGCCTGGTGGAGCCCAGG - Intronic
1165398129 19:35578655-35578677 CAGGGGTCCTGGTGGGGCCCAGG - Intergenic
1165924880 19:39320790-39320812 CACCCAGCCCGGGGGGGCCCCGG + Intergenic
1166340390 19:42133503-42133525 CAGGATGTCCTGCGGGGCCCAGG - Intronic
1166364384 19:42271053-42271075 CAGGCTGCCCAGAGGGGCAGAGG + Intronic
1167072967 19:47231199-47231221 CAGGCCGCCCGGCGGATCCCGGG + Intronic
1167096016 19:47375483-47375505 CGGGCTGCTGGCTGGGGCCCAGG + Exonic
1167358442 19:49017659-49017681 CAGGATGCCCGGAGCGTCCCCGG + Intergenic
1167498978 19:49835222-49835244 CAGGGGGCCATGTGGGGCCCGGG - Intronic
925130085 2:1488507-1488529 GAGGCTGCCGGGTGGGGCCTGGG - Intronic
925170052 2:1744636-1744658 CAGGCCGGACGCTGGGGCCCCGG - Intronic
927810195 2:26176167-26176189 CGGGCTGCCAGCTGGGGCCTGGG - Intronic
928928781 2:36602607-36602629 AAGGCTACCCGGTGTGGTCCTGG - Intronic
929188617 2:39120514-39120536 CGGGCCGTCCGGTGGGGCCGCGG - Intronic
929604868 2:43227223-43227245 CAGTCTTGCCGGTGGAGCCCGGG + Intergenic
930146789 2:48015615-48015637 CAGGCTGCCCCTTGGGGGCCAGG + Intergenic
932260756 2:70325171-70325193 CAAGCTCCCAGGTGGAGCCCAGG + Intergenic
932716210 2:74101964-74101986 GAGGCTGCCCGGCTGGGCCTGGG + Exonic
934564087 2:95328900-95328922 CAGGCTGCTGGCTGGGGCCAGGG + Intronic
936093190 2:109513938-109513960 CAAGCAGCCGGGTGGAGCCCAGG + Intergenic
936248923 2:110852338-110852360 CAGGCTGCGCGTGGGGGCCCTGG + Intronic
937221782 2:120346194-120346216 CGGGCTGCCCGGTCGGGCGCTGG + Exonic
937361249 2:121231581-121231603 CTGGGTGCCCGGTGGGAGCCAGG - Intronic
937985201 2:127635235-127635257 CAGGCTGCCCTGGTGGGCACTGG + Intronic
938067013 2:128286875-128286897 CAGGCAACCAGGTGGGGCCTTGG - Intronic
938324819 2:130391350-130391372 CAGGCAGCCCTGCGGGCCCCTGG + Intergenic
938405732 2:131032187-131032209 CAGGCTCCTCTGTGGGGCCGAGG + Intronic
938727526 2:134120869-134120891 CAGGAGGCCCGGGGGCGCCCCGG + Intronic
942110245 2:172674806-172674828 CAGGCTGCCGGGCCGGGCCCTGG + Intergenic
943820668 2:192315735-192315757 CTTGCTGCCCCATGGGGCCCAGG + Intergenic
945235379 2:207627236-207627258 CAGGCTCCCGGGGGCGGCCCCGG - Intergenic
946334964 2:219030328-219030350 CAGTCTGGCCAGTGGGGCACAGG - Intronic
946747642 2:222861445-222861467 GAGGCGGCCCGCTGGGGTCCGGG + Intronic
946865597 2:224039069-224039091 CAGGCTGCGCGGTGAGTCCCGGG - Intronic
947399007 2:229714195-229714217 CAGGCTCGCCGGCGGGGGCCGGG + Exonic
947634468 2:231673097-231673119 CAGACTGTCGGGTGGGGCCCGGG - Intergenic
947819318 2:233059511-233059533 CAGCCTGCCCTGTGGGGCTTTGG + Intergenic
948854034 2:240721763-240721785 CAGGCTGCCCCGCAGGGCTCGGG - Intronic
948903743 2:240968269-240968291 CAGGCGGCAGGGTGGGTCCCAGG + Intronic
948903783 2:240968403-240968425 GAGCCAGCCCGGTGGGGCCCTGG + Intronic
949072768 2:242035988-242036010 CAGTCTGCCCAGTGAGGCGCAGG - Intergenic
1168981138 20:2004698-2004720 CAGACTGCCTGGCTGGGCCCTGG + Intergenic
1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG + Intronic
1170959903 20:21016061-21016083 CAGCCTGCCTGGTGTGGCCGAGG + Intergenic
1172101082 20:32484144-32484166 AAGGCTGCCCGAAGGGGCCCCGG - Intronic
1172482054 20:35277151-35277173 CAGGCTGGCCCTGGGGGCCCAGG + Intergenic
1172859175 20:38033853-38033875 CAGCCTGTCAGGTGAGGCCCCGG + Exonic
1174386037 20:50189278-50189300 CCGCCTGCCCGCTGGGGCCAGGG + Intergenic
1175756494 20:61533523-61533545 CAGCCTCCCTGGCGGGGCCCTGG + Intronic
1175958014 20:62621291-62621313 CAGGCTGGCCGGCGGGGATCGGG - Intergenic
1175964654 20:62654475-62654497 CAGGCAGTCCCGTGGGGACCTGG - Intronic
1175987748 20:62772330-62772352 CACGCTGCACTGTGGTGCCCAGG + Intergenic
1176056534 20:63151845-63151867 GAGGGAGCCGGGTGGGGCCCGGG + Intergenic
1176389921 21:6158196-6158218 GTGCCTGCCGGGTGGGGCCCAGG + Intergenic
1176871074 21:14083819-14083841 TAGTCTGCACGGTGGGGCCTAGG - Intergenic
1178878396 21:36429881-36429903 CAGGCTGCCTGGAGGGGCCGAGG - Intergenic
1179176912 21:39014651-39014673 CAGGCTGGGGGTTGGGGCCCTGG + Intergenic
1179733545 21:43380044-43380066 GTGCCTGCCGGGTGGGGCCCAGG - Intergenic
1179784623 21:43722373-43722395 GAGGCTGCCCTGAGGGCCCCAGG - Intronic
1179822686 21:43945896-43945918 CAGGCAGCCCTGTGGGCACCTGG + Intronic
1180011638 21:45055141-45055163 CAGGCTGCGGCGTGGCGCCCGGG - Intergenic
1180046138 21:45306634-45306656 GAGGGTGCCCGGTGGGGGTCTGG - Intergenic
1180073269 21:45449286-45449308 CAGGCTGCCCGCTGAGCGCCAGG + Intronic
1180615565 22:17123675-17123697 CAGGGTGCCAGTTGGGGCCAGGG + Intronic
1180693866 22:17739629-17739651 CAGCCCGCCCGCTGTGGCCCTGG - Intronic
1180820497 22:18823950-18823972 AGGGCAGCCTGGTGGGGCCCTGG + Intergenic
1180986247 22:19905520-19905542 GAGGCTGCCCGCTTGGGCCTGGG - Intronic
1181039058 22:20183438-20183460 CCGTCTGCCCTGTGTGGCCCTGG + Intergenic
1181054327 22:20252935-20252957 CAGGATGCTGGGTGGGGGCCTGG - Intronic
1181130590 22:20729301-20729323 CTGCCTGCCAGGTGGGCCCCCGG - Exonic
1181167869 22:20993004-20993026 CATCCTGCCAGGTGTGGCCCTGG - Intronic
1181206721 22:21258422-21258444 AGGGCAGCCTGGTGGGGCCCTGG + Intergenic
1181496953 22:23292664-23292686 CAGCCTGCCAGGTGGGGCACAGG + Intronic
1181509985 22:23384839-23384861 CAGGCTGCCCCCTGCAGCCCTGG - Intergenic
1181736356 22:24884697-24884719 AAGGCTGCCCTGAAGGGCCCTGG - Intronic
1182691506 22:32167090-32167112 TAGGCTGCACCGTGTGGCCCAGG + Intergenic
1183508664 22:38222815-38222837 CTGGGTGCCCTGTGGGGCCTGGG - Intronic
1183521491 22:38298390-38298412 CAGGCTGGCCCGAGGGGCCATGG + Intronic
1183720316 22:39558360-39558382 CAGGCTGCCGGCCGGGGCCCGGG + Intergenic
1183804026 22:40193048-40193070 CAAGCTGACCGCTGGGGCGCCGG - Intronic
1184168373 22:42743806-42743828 CTGGAGGCCGGGTGGGGCCCTGG + Intergenic
1184186792 22:42870090-42870112 CGGGCTGCCCGGAGTCGCCCGGG - Exonic
1184253118 22:43272079-43272101 CAGGCTGCCAAGTGGGTACCAGG - Intronic
1184269431 22:43370333-43370355 AGGGCTGCCAGGTGAGGCCCCGG - Intergenic
1184414373 22:44343689-44343711 CAGGCTGCCAGGTGCCTCCCAGG + Intergenic
1184545592 22:45164695-45164717 GCCGCAGCCCGGTGGGGCCCGGG - Intronic
1184653174 22:45928488-45928510 TCGGATGGCCGGTGGGGCCCTGG - Intronic
1184686345 22:46098121-46098143 CTGGCTGCAAGGTGGGGCCTGGG - Intronic
1184720448 22:46309521-46309543 CGGGCTGCAGGGTGGGCCCCGGG - Intronic
1184731538 22:46373602-46373624 CAGGCTCCCCTCTGGGTCCCGGG + Intronic
1185004654 22:48268610-48268632 CAGGCTGTCCCGTGGGGCGGAGG - Intergenic
1185050869 22:48553385-48553407 CAGATTGCCCGGAGGCGCCCGGG + Intronic
1185096199 22:48807411-48807433 CACGTAGCCCGGTGTGGCCCGGG + Intronic
1185186730 22:49405629-49405651 CAGGCTTCCCTGTGGTGGCCTGG - Intergenic
1185206491 22:49541832-49541854 TAGGCTGCCAGGTGGGGACATGG + Intronic
1185310936 22:50153884-50153906 CAGGGTTCCCCGTGTGGCCCGGG - Intronic
1203220203 22_KI270731v1_random:37001-37023 AGGGCAGCCTGGTGGGGCCCTGG - Intergenic
1203270623 22_KI270734v1_random:49825-49847 AGGGCAGCCTGGTGGGGCCCTGG + Intergenic
950105469 3:10385677-10385699 CTGGCTGCCCATTGGGGGCCAGG + Intronic
954403457 3:50331741-50331763 CAGGATGCCCGGCGGGGCCCAGG - Exonic
954412044 3:50375014-50375036 CTGGTTGCCCGGTGGCCCCCAGG - Intronic
954458333 3:50611907-50611929 CGGGCTGAGCGGTGGGGCCCGGG + Exonic
956678287 3:71754742-71754764 CCGCCTGGCCGGTGGCGCCCGGG - Exonic
956916359 3:73875977-73875999 CTGACTGCCCAGTTGGGCCCAGG - Intergenic
959380421 3:105634899-105634921 CAAGCTGCCTGGACGGGCCCCGG - Intergenic
960811607 3:121632156-121632178 CAGGCTGCCCGGCTGGGGCTGGG - Exonic
962240351 3:133746541-133746563 CAGGCTGCGCGGTGGCCGCCCGG - Intronic
968258305 3:197298379-197298401 CAGGTGGCCCGGGGTGGCCCTGG + Intronic
968485286 4:857904-857926 CACACTGCCTGATGGGGCCCTGG + Intronic
968576041 4:1366656-1366678 CAGGCTGCAGGGAGGGCCCCAGG - Intronic
968606982 4:1540197-1540219 CAGAGAGCCAGGTGGGGCCCGGG + Intergenic
968652962 4:1767317-1767339 CAGGCTGCGCCGTGGTTCCCAGG - Intergenic
968972576 4:3803668-3803690 CGGGCTGCCGGGTGGGGGGCTGG - Intergenic
969285754 4:6200802-6200824 CAGGCTGCCCGGCGCGGCTGGGG - Intergenic
969311771 4:6357079-6357101 AAGGCTGTCAGGTGGGACCCTGG + Intronic
971364972 4:25970383-25970405 AGGGCTGCCAAGTGGGGCCCGGG + Intergenic
973613725 4:52659459-52659481 GAGGCGGCGCGGCGGGGCCCGGG - Intergenic
976199022 4:82561564-82561586 CAGCCCGCCCGCTGCGGCCCCGG - Intronic
976883651 4:89960771-89960793 CAGGCTTGAGGGTGGGGCCCTGG + Intergenic
979614928 4:122732418-122732440 CCGGCTGCCGGCTGGGGACCTGG - Intergenic
981361999 4:143857535-143857557 CAGGCTGCCGTGTGGGGTCTAGG - Intergenic
981372733 4:143978372-143978394 CAGGCTGCCATGTGGGGTCTAGG - Intergenic
981381823 4:144081610-144081632 CAGGCTGCCGTGTGGGGTCTAGG - Intergenic
984714973 4:182917200-182917222 CTGGCTGCCGGGCGGGGGCCTGG - Intronic
985068407 4:186144884-186144906 CAGGCGGCCCGGGCGCGCCCGGG - Exonic
986734300 5:10656730-10656752 TTGGCTGCCTGGAGGGGCCCAGG + Intergenic
987114084 5:14712954-14712976 CAGGGTGCACGGTGCGACCCTGG - Exonic
987518482 5:18947120-18947142 CTGGCTGGCTTGTGGGGCCCTGG - Intergenic
989099960 5:37814086-37814108 CTGGCTGCCCAGTGCAGCCCGGG - Intronic
990173713 5:53083740-53083762 CAGGCTGCCCCTTGTAGCCCAGG - Intronic
991166264 5:63567617-63567639 CAGGTTGCTGGGTGGGACCCCGG - Intergenic
996581212 5:125034471-125034493 CAAGCTGCCTGCTGGGGCCGTGG - Intergenic
998503352 5:142652657-142652679 CAGGCTGCACGTGTGGGCCCAGG - Intronic
998849368 5:146338930-146338952 CAGCCTGCCAGGAAGGGCCCGGG - Intronic
999251411 5:150184362-150184384 CAGGCTGCCCATCAGGGCCCAGG + Exonic
999696229 5:154190623-154190645 CGGGCGGCTCGGCGGGGCCCGGG + Intronic
1001416188 5:171546063-171546085 CAGGCTCCCCAGGGTGGCCCGGG - Intergenic
1001939613 5:175731228-175731250 CATGCTGCAGGGCGGGGCCCAGG - Intergenic
1002088931 5:176793192-176793214 CACGTTGCAGGGTGGGGCCCAGG + Intergenic
1002297385 5:178239161-178239183 CAGGCAGCCCGTCGGGGCCCTGG + Exonic
1002322484 5:178384020-178384042 CAGGCCGCCTGGTGGAGTCCTGG - Intronic
1002470229 5:179430564-179430586 AAGGCTGCCCCGTGGAGCTCTGG + Intergenic
1002595338 5:180318355-180318377 CAGGCTGCCCTGTGGGGTAGAGG + Intronic
1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG + Intergenic
1003171878 6:3726593-3726615 CAGGCCGCCGGCTGGGGCCCAGG + Intronic
1006366919 6:33621418-33621440 GAGGCGGCTCGGCGGGGCCCGGG - Exonic
1006436509 6:34028439-34028461 CGGGATGCCGGGTGGGTCCCTGG - Intronic
1006472967 6:34238273-34238295 CAGGCCGGCCGGCGGGACCCGGG - Intronic
1010051540 6:71510296-71510318 AAGGGTGCCCTCTGGGGCCCTGG + Intergenic
1012475742 6:99613616-99613638 CAGGCTGCTGGGCGGGGGCCGGG + Exonic
1013288442 6:108699759-108699781 GAGGCTGCCCTGTGAGGCGCTGG - Intergenic
1013590163 6:111613067-111613089 GAGGCTGCCCTGCAGGGCCCTGG + Intergenic
1016658172 6:146544148-146544170 CAGGCGGCCCGGCGGGGCTCTGG - Intronic
1017253039 6:152302235-152302257 CAGGCTGCGCGGCGCGGCGCAGG + Intronic
1019170057 6:170128850-170128872 CAGGCTGCAAGGAGGGTCCCAGG + Intergenic
1019273411 7:163434-163456 TAGGGTGGCCGGTGGTGCCCAGG + Intergenic
1019312465 7:369446-369468 CAGGGTGCGTGGTGGGACCCAGG - Intergenic
1019348946 7:544200-544222 CAGACAGGCAGGTGGGGCCCAGG + Intergenic
1019427190 7:983290-983312 CCAGCTGCCCGGTGGCCCCCGGG + Exonic
1020018950 7:4850589-4850611 CAGGTTGCCCCGTGATGCCCTGG - Intronic
1020107369 7:5428312-5428334 CAGGGTGCGCGGCGTGGCCCGGG - Intergenic
1022499256 7:30872309-30872331 CAGGGGGCGCTGTGGGGCCCAGG + Intronic
1023522268 7:41060436-41060458 CAGGCTGCCCAGTCGGGGCTTGG - Intergenic
1023655437 7:42414926-42414948 CAGGCTGCCCCTTTGGGCCAGGG - Intergenic
1023822410 7:43987578-43987600 CAGGCATCCTGCTGGGGCCCTGG + Intergenic
1023862893 7:44226465-44226487 GCGGCTGCCCGGAGGGGCTCGGG - Intronic
1023955589 7:44884704-44884726 CAGGCCGCCCCCTGGGCCCCCGG + Exonic
1025611417 7:63078163-63078185 CAGGCTGCCCTGTGAGTGCCAGG - Intergenic
1027223113 7:76226498-76226520 AAGGGTGGCCGGTGGGGCCCCGG + Intronic
1029459917 7:100688580-100688602 CAGGCTGCCAGGTGAGCCCCGGG - Exonic
1029647488 7:101867399-101867421 CAGGGTGGCAGGTGGGCCCCTGG - Intronic
1029750673 7:102540993-102541015 CAGGCATCCTGCTGGGGCCCTGG + Intronic
1029768628 7:102640104-102640126 CAGGCATCCTGCTGGGGCCCTGG + Intronic
1030950859 7:115789531-115789553 CAGGCTACCCGACGGAGCCCTGG - Intergenic
1031999680 7:128256610-128256632 CAGGGTTCCCTGTGGGCCCCTGG - Exonic
1033327735 7:140393377-140393399 CCAGCTGCCCAGTGGGGGCCTGG - Intronic
1033584965 7:142767654-142767676 CAGGCAGCCCACTGTGGCCCTGG - Intergenic
1033586449 7:142778267-142778289 CAGGCAGCCCACTGTGGCCCTGG - Intergenic
1033601156 7:142889170-142889192 CAGGCTTCCCTGGGGGCCCCAGG + Intergenic
1033952320 7:146800354-146800376 CAAGCTGCCCGGGGTGGCCTGGG + Intronic
1034214910 7:149397829-149397851 AAGGCAGGCGGGTGGGGCCCAGG + Intergenic
1034270102 7:149799607-149799629 CAGGTGGCACGGTGAGGCCCAGG + Intergenic
1034415217 7:150961023-150961045 GAGCCTGCCTGGTGGGTCCCTGG - Intronic
1034560792 7:151877956-151877978 GAGGGTTCCCGGTGCGGCCCAGG + Intergenic
1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG + Intergenic
1035073643 7:156162774-156162796 CAGGCTGCCCCGGGGGACACGGG - Intergenic
1035084858 7:156249370-156249392 CAGCCTTCCCGGTGGTGCCTTGG - Intergenic
1036021095 8:4847617-4847639 CAGGGTCCTCGGTGGGGTCCTGG - Intronic
1037828709 8:22176171-22176193 GAGGCTGCCCGTTGGTGCTCTGG - Exonic
1040314138 8:46252021-46252043 CAGCCTGCCCAGGGGAGCCCAGG - Intergenic
1043268703 8:78301087-78301109 CAGGCTGCATGCTGTGGCCCAGG - Intergenic
1043993860 8:86788666-86788688 CTGGCTGCAGGGTGGGGACCAGG + Intergenic
1045856404 8:106770019-106770041 CTGGCTGCCGGGAGGGACCCAGG - Exonic
1047277361 8:123416456-123416478 CCGGCTGGTGGGTGGGGCCCGGG - Intergenic
1047313054 8:123708451-123708473 CAGCCTGCCTGGCTGGGCCCAGG + Intronic
1048195789 8:132330822-132330844 CAGACTGCCCAGTGTGGCCTGGG - Intronic
1048244218 8:132775679-132775701 CGGGCGGCCCGGCGGGGGCCAGG - Intronic
1048601539 8:135923729-135923751 CAGGATGCCATGTGGGGCCTTGG - Intergenic
1049040589 8:140109821-140109843 CAGGCTGGCCTGCGTGGCCCAGG - Intronic
1049572361 8:143375238-143375260 CAGGCTGCCTGGTGAGACCCTGG + Intronic
1049662868 8:143828213-143828235 CAGCCCGCCCGCTGGGGGCCTGG + Intronic
1052902206 9:33802923-33802945 CAGGCAGCCCGCTGTGGCCCTGG - Intergenic
1053129758 9:35608303-35608325 ATGGCTGCCCTGTGGGACCCAGG + Intronic
1055654139 9:78436780-78436802 AGGGCTGGCCGGTGGGACCCGGG + Intergenic
1056228169 9:84517215-84517237 CAGCCTGCTCTGTGGAGCCCAGG + Intergenic
1056552900 9:87665668-87665690 CTGGCTGGCCTGTGGGGCTCCGG + Intronic
1056728575 9:89143775-89143797 CAGTCTGCCCCTTGGGTCCCTGG - Intronic
1056779391 9:89538244-89538266 CAGGCTTGCCGGTGGGTCTCAGG - Intergenic
1056813490 9:89782512-89782534 GAGGCAGCCCAGAGGGGCCCAGG - Intergenic
1056832916 9:89931167-89931189 CAGGCTGCCAGAGGGGTCCCTGG + Intergenic
1057277677 9:93684636-93684658 CTGGCTGGACAGTGGGGCCCAGG - Intergenic
1059304630 9:113344182-113344204 CTGCCTGCCTGGTGGGGCCCTGG - Intergenic
1059418941 9:114179134-114179156 CTGGGTGCCTGGTGAGGCCCTGG + Intronic
1060205980 9:121683103-121683125 CAGGCAGCAAGCTGGGGCCCTGG + Intronic
1060594605 9:124840599-124840621 CAGGCTGCCCGAGGGGGGCCAGG + Intergenic
1061233197 9:129326901-129326923 CAGGCTGCCCTGTGAGGCCCAGG - Intergenic
1061629195 9:131860940-131860962 CAGGCTGCTCGGTGGTTCACGGG - Intronic
1062001590 9:134218582-134218604 GAGGGTGCCCTGTGGGGCACAGG + Intergenic
1062022249 9:134325262-134325284 CAGGCTGCGCGTGGTGGCCCGGG - Intronic
1062087451 9:134656129-134656151 GAAGCTGCAAGGTGGGGCCCCGG - Intronic
1062113446 9:134795285-134795307 CAGGCTTCCCAGTGATGCCCCGG - Exonic
1062134255 9:134916391-134916413 GAGGCTGCCCGGGGCTGCCCGGG - Exonic
1062197612 9:135282926-135282948 GTGGCTGCCAGGTGGGGTCCAGG + Intergenic
1062407558 9:136404025-136404047 CAGGCTTCCCGGTGCCTCCCAGG + Intronic
1062452363 9:136621007-136621029 CACTCTGCCCGGGGGGCCCCAGG - Intergenic
1062529865 9:136995114-136995136 CAGGCGGCGCGGTGAGGACCAGG + Intronic
1062623804 9:137434102-137434124 CAGGCAGCACCGTGGTGCCCGGG + Intronic
1203761158 EBV:13420-13442 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203762087 EBV:16492-16514 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763016 EBV:19564-19586 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763945 EBV:22636-22658 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203764874 EBV:25708-25730 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203765803 EBV:28780-28802 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203766732 EBV:31852-31874 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203767661 EBV:34924-34946 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1185790328 X:2924327-2924349 CAGTCTGCCCTGTGTGGGCCGGG - Intronic
1186387433 X:9124375-9124397 GAGTCTGCCAGGTGGGGTCCTGG - Intronic
1186463405 X:9765849-9765871 CAGGCAGGCCGGCGGGGTCCTGG - Exonic
1187895128 X:23973542-23973564 CAGGCTTCCAGGTGAGGCCCAGG - Intergenic
1187913852 X:24134819-24134841 CAGGCTTCCAGGTGAGGCCCAGG - Intergenic
1190333830 X:49251120-49251142 AAGGCTGCTCAGAGGGGCCCCGG - Exonic
1191189499 X:57651273-57651295 CAGCCTGCCATGTAGGGCCCAGG - Intergenic
1192169705 X:68846685-68846707 CAGGCTGGCCGGAAAGGCCCAGG - Intergenic
1192229619 X:69256007-69256029 CTAGCTGCTCCGTGGGGCCCAGG + Intergenic
1198504816 X:137290918-137290940 CTGGCTGGCCACTGGGGCCCAGG + Intergenic
1199690480 X:150305603-150305625 CAGGCTCCTCTGTGGGGCCGAGG - Intergenic
1199863178 X:151820297-151820319 CAGGCTGGCCACTGTGGCCCAGG + Intergenic
1200141857 X:153906471-153906493 CAGGATGGCTGGTGGGGCACAGG - Intronic
1200145283 X:153923180-153923202 CACACTGCCAGGTGGAGCCCAGG + Intronic
1200172020 X:154083851-154083873 CACGCTGCCTTCTGGGGCCCAGG + Intronic
1200179215 X:154140388-154140410 CTCGCTGCCAGCTGGGGCCCTGG - Intergenic
1200231978 X:154448654-154448676 CAGGCAGACAGGTGAGGCCCAGG - Intronic
1201283988 Y:12363611-12363633 CAGTCTGCCCTGTGGGGGCTGGG + Intergenic