ID: 1132872628

View in Genome Browser
Species Human (GRCh38)
Location 16:2122542-2122564
Sequence GTCCCACCCCACGGCGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132872628_1132872639 6 Left 1132872628 16:2122542-2122564 CCATCCCCGCCGTGGGGTGGGAC 0: 2
1: 0
2: 0
3: 9
4: 135
Right 1132872639 16:2122571-2122593 GTGGCTGGGAGACCAGCAAGAGG 0: 1
1: 1
2: 1
3: 29
4: 328
1132872628_1132872641 22 Left 1132872628 16:2122542-2122564 CCATCCCCGCCGTGGGGTGGGAC 0: 2
1: 0
2: 0
3: 9
4: 135
Right 1132872641 16:2122587-2122609 CAAGAGGCCATTCTCGAGACAGG 0: 1
1: 1
2: 1
3: 1
4: 70
1132872628_1132872638 -8 Left 1132872628 16:2122542-2122564 CCATCCCCGCCGTGGGGTGGGAC 0: 2
1: 0
2: 0
3: 9
4: 135
Right 1132872638 16:2122557-2122579 GGTGGGACAGGGTGGTGGCTGGG 0: 1
1: 1
2: 9
3: 79
4: 713
1132872628_1132872643 28 Left 1132872628 16:2122542-2122564 CCATCCCCGCCGTGGGGTGGGAC 0: 2
1: 0
2: 0
3: 9
4: 135
Right 1132872643 16:2122593-2122615 GCCATTCTCGAGACAGGGTGAGG 0: 1
1: 1
2: 0
3: 12
4: 88
1132872628_1132872637 -9 Left 1132872628 16:2122542-2122564 CCATCCCCGCCGTGGGGTGGGAC 0: 2
1: 0
2: 0
3: 9
4: 135
Right 1132872637 16:2122556-2122578 GGGTGGGACAGGGTGGTGGCTGG 0: 1
1: 2
2: 7
3: 146
4: 1033
1132872628_1132872642 23 Left 1132872628 16:2122542-2122564 CCATCCCCGCCGTGGGGTGGGAC 0: 2
1: 0
2: 0
3: 9
4: 135
Right 1132872642 16:2122588-2122610 AAGAGGCCATTCTCGAGACAGGG 0: 1
1: 1
2: 0
3: 3
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132872628 Original CRISPR GTCCCACCCCACGGCGGGGA TGG (reversed) Intronic
900562457 1:3314061-3314083 GCCCCCCCCCCCGGTGGGGAAGG - Intronic
901228725 1:7630203-7630225 GTCCCACCCAAAGGCTGAGAGGG - Intronic
901676471 1:10888740-10888762 GCCCCACCCCCCGGCGCGGGAGG + Intergenic
901838561 1:11939459-11939481 GTCCCAGCCCAAGGCGTGGGTGG - Intronic
902335332 1:15751273-15751295 GTCCCACCCACCCGAGGGGAGGG + Intergenic
902466063 1:16619556-16619578 GTCCCACCCCACGCTGGGCATGG - Intergenic
902508628 1:16953748-16953770 GTCCCACCCCACGCTGGGCATGG + Intronic
902747006 1:18481111-18481133 TTCCCACCCCACCGCTGGGCTGG - Exonic
905033106 1:34900667-34900689 GTGGCTCCCCACAGCGGGGAAGG - Intronic
905406400 1:37735423-37735445 GACCCACCTCACGGCAGGGCTGG + Intronic
905668564 1:39776629-39776651 ATCCCAGCCCAGGGCGGAGAAGG + Intronic
905803562 1:40861127-40861149 CTCCCACCTCAAGGAGGGGAAGG - Exonic
910771507 1:90836218-90836240 GCCCCAGCCCCCGGCGGGGCGGG + Intergenic
916800405 1:168210453-168210475 GTTCCACCCAATGGTGGGGAGGG + Intergenic
921291918 1:213666063-213666085 CTCCCACCCCACTGCCGAGAGGG - Intergenic
924517779 1:244780619-244780641 ATCCCATCCCACGGAGGGGCAGG - Intergenic
1062855350 10:777370-777392 GTCACAGCCCACGCCGGGGGAGG - Intergenic
1062855427 10:777567-777589 GTCACAGCCCACGCCGGGGAAGG - Intergenic
1067160469 10:43821131-43821153 CTCCCACCCCAGGGCTGGAAGGG - Intergenic
1070824268 10:79381685-79381707 GTCCCACCCCAGGGAGGCCAAGG - Intergenic
1075642540 10:124075226-124075248 GTGCATCCCCACGGTGGGGAGGG + Intronic
1076818482 10:132926257-132926279 GCATCACCACACGGCGGGGAGGG + Intronic
1077444230 11:2582878-2582900 GTCCCACCACACGTCCTGGACGG + Intronic
1081677768 11:44980930-44980952 GTTCCTCCCCGAGGCGGGGAGGG - Intergenic
1081967125 11:47176899-47176921 GGGCCAATCCACGGCGGGGAGGG + Exonic
1083713994 11:64565353-64565375 GTCCCTCCCCAAGGCAGGGCTGG + Intronic
1083751867 11:64765495-64765517 ATCCCTCCCCGCGGCGGCGATGG - Exonic
1085411044 11:76290828-76290850 GTCCCAACCCAGGGCAGGAAGGG + Intergenic
1090228001 11:125083075-125083097 GTTCCTCCCCAGGGCTGGGAGGG - Intronic
1096365523 12:51026029-51026051 GTCCTAGGCCGCGGCGGGGAAGG + Intronic
1096910638 12:54980511-54980533 GCCCCACCACAGGGCGGTGATGG - Intronic
1097155148 12:57006650-57006672 GCGCCCCCCCACGGCGGGGCCGG + Intergenic
1102050234 12:109856621-109856643 TCCCCACCCCACTGCAGGGAGGG - Intronic
1102098333 12:110257969-110257991 GTCCCAGCCCAAGGTGGGGTGGG + Intergenic
1103039647 12:117684623-117684645 GTACCAGCCCACTTCGGGGAGGG + Intronic
1103261505 12:119593214-119593236 TTCCCACCCCACCTGGGGGAGGG + Intergenic
1103931676 12:124453925-124453947 GCCCCTCCCCTCGGCAGGGACGG - Intronic
1104622782 12:130331035-130331057 GCCCCACCGCATGGCGGGGTTGG - Intergenic
1104930068 12:132334030-132334052 TTCCCACCCCACTGCGTGAAGGG - Intergenic
1113397928 13:109965936-109965958 GTCACACCTCAGGGTGGGGAGGG - Intergenic
1114393140 14:22331697-22331719 CTCCCACCCCACTGCTGGGAGGG - Intergenic
1126348054 15:47717362-47717384 GTCCCACCCCCGGGCACGGACGG - Intronic
1127449842 15:59105499-59105521 CTCCCACCCCGGGGCAGGGAGGG - Intronic
1127855211 15:62948450-62948472 GGCCCACCACACGGCGAGAATGG - Intergenic
1128687797 15:69699705-69699727 GTCCCAGGCCACGGTGGGGTCGG - Intergenic
1132693125 16:1190545-1190567 GTCCCTCTCCAGGGCAGGGAGGG + Intronic
1132696057 16:1202464-1202486 GCCCCACCCCACGGAGGAGGCGG + Intronic
1132872628 16:2122542-2122564 GTCCCACCCCACGGCGGGGATGG - Intronic
1134063523 16:11212821-11212843 GCTCCGCCCCACGGCAGGGAGGG - Intergenic
1134410558 16:14000274-14000296 TTCCCAGCCCCCGGCGGGGGAGG + Intergenic
1134551725 16:15141742-15141764 GTCCCACCCCACGGCGGGGATGG - Intergenic
1137610647 16:49815002-49815024 CTCCCAAGCCACGTCGGGGAGGG + Intronic
1142037506 16:87870796-87870818 GCCCCACCCCAGGGAGGGGGCGG + Intergenic
1142349139 16:89571736-89571758 GTTCCACCCCAGGGCCTGGACGG + Intergenic
1143016451 17:3893287-3893309 GGCCCACGCCGCGGCCGGGAGGG - Intronic
1143750562 17:9023705-9023727 GTCCAACCCAACGAGGGGGAAGG - Intronic
1147322279 17:39653500-39653522 CCCCCACCTCAGGGCGGGGAGGG - Exonic
1147741103 17:42671350-42671372 CTCCCACACCACGGCGGGGGAGG - Exonic
1148052937 17:44778032-44778054 GTCCCCACCCACGGGGGAGACGG + Exonic
1148156058 17:45425751-45425773 TTCCCACCTCTGGGCGGGGATGG + Intronic
1148159530 17:45442044-45442066 GTCCCTCCCGACAGCCGGGAAGG - Intronic
1148588669 17:48799229-48799251 GTCACAGCCCACTGTGGGGAGGG - Intronic
1152729658 17:81963211-81963233 CACCCACACCCCGGCGGGGAAGG + Intergenic
1152904816 17:82964661-82964683 GTGCACCCCCACGGGGGGGACGG + Intronic
1152904846 17:82964742-82964764 GTGCACCCCCACGGGGGGGACGG + Intronic
1152904890 17:82964863-82964885 GTGCACCCCCACGGGGGGGACGG + Intronic
1156525626 18:37764997-37765019 GACCCACCCCAAGGGAGGGAAGG - Intergenic
1157444405 18:47733949-47733971 GTGCCAACCCATGCCGGGGAGGG - Intergenic
1159889718 18:73942249-73942271 GTCACATCCCACGGTGGGGGAGG + Intergenic
1160628263 18:80228215-80228237 GTCACATCCCACGGGGGAGACGG + Intronic
1161018707 19:1997502-1997524 CCGCCACCCCACGGCCGGGAGGG + Intronic
1161295187 19:3516183-3516205 GTCTCTCCCCACGCCTGGGATGG + Intronic
1161438817 19:4279336-4279358 GTCCCACCTCCCGGCGGCGGCGG + Exonic
1161760603 19:6168296-6168318 GACCCACCCGAAGGAGGGGAGGG - Intronic
1163534476 19:17869283-17869305 GACCCACCCCAGGGTGGTGATGG - Intergenic
1164207474 19:23070736-23070758 CTCCCACCCCGCGGGTGGGATGG - Intergenic
1164908703 19:31988089-31988111 GGCCCCACCCACGTCGGGGAGGG - Intergenic
1165994283 19:39833391-39833413 GGCCGGCCCCGCGGCGGGGAGGG + Exonic
1166701713 19:44886041-44886063 CACCCACCCCAGGGCTGGGAGGG + Intronic
1166944908 19:46390609-46390631 GCCCCACCCCACCCCGAGGACGG - Exonic
1167156667 19:47743057-47743079 CCCCCACCCCATGGCTGGGAGGG + Exonic
1168514956 19:57003447-57003469 GTCCCACCCCACAGGGCGGCTGG + Intergenic
927532994 2:23827218-23827240 CTACCACCCCACAGAGGGGAGGG + Intronic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
930136335 2:47906506-47906528 GGCCAGCCCCGCGGCGGGGAGGG - Intergenic
932028412 2:68158112-68158134 TTCCCACCCCTCTGTGGGGACGG + Exonic
933778555 2:85786516-85786538 CTGCCACCCCAGGGTGGGGACGG + Intronic
935130970 2:100260743-100260765 GTCCCTCCCCACGGCCAGGCGGG - Intergenic
946401169 2:219469093-219469115 CTCCCACCCCAGGGCTGGGCTGG - Intronic
1169382359 20:5119436-5119458 GCCCCACCCCACTGCGTGGCAGG + Intronic
1171180246 20:23086126-23086148 GACCCAGCCCGGGGCGGGGACGG - Exonic
1176373254 21:6075053-6075075 GTCCCTCCCCGAGACGGGGAGGG + Intergenic
1178639822 21:34337014-34337036 GTGCCAGCCCAGGGAGGGGAGGG - Intergenic
1179750223 21:43463190-43463212 GTCCCTCCCCGAGACGGGGAGGG - Intergenic
1180078556 21:45475585-45475607 GTGTCACCCCACTGCTGGGAGGG - Intronic
1180787319 22:18554208-18554230 GCCTCACCCCATGGCGGGGCAGG + Intergenic
1180908568 22:19432320-19432342 CTCCCAGCACAGGGCGGGGACGG + Exonic
1181234421 22:21441098-21441120 GCCTCACCCCATGGCGGGGCAGG - Intronic
1181244227 22:21493733-21493755 GCCTCACCCCATGGCGGGGCAGG + Intergenic
1181521387 22:23450552-23450574 GTCCCAGCCCCGGGCGGGGTTGG - Intergenic
1182487746 22:30649474-30649496 GGGCCAGCCCACGGCGGGGTGGG + Intronic
1184443776 22:44535444-44535466 GTCCTACCCCACGGTGGTCAGGG + Intergenic
1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG + Intronic
1184889620 22:47371832-47371854 GTCCCCCCCGACTGTGGGGAGGG - Intergenic
953738732 3:45518150-45518172 GGCCCAACCCAAGGCAGGGAGGG - Intronic
954995340 3:54876166-54876188 GTCCCCACCTAAGGCGGGGAGGG - Intronic
963708740 3:148721590-148721612 GTCCCAGCCCACTGCCTGGAGGG + Intronic
965797060 3:172449974-172449996 GTCCTACCCCACGGAGGAGCAGG + Intergenic
968808683 4:2790465-2790487 GTCCAACCCCAGGGCGTGGGAGG - Intergenic
968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG + Intronic
969321805 4:6417154-6417176 GTCCAGCCCCTGGGCGGGGAGGG + Intronic
969582030 4:8071265-8071287 GTCCCACTCCTGGGCCGGGATGG - Intronic
972586179 4:40438703-40438725 GGCCCACCGCCCGGCTGGGAGGG - Exonic
981015450 4:139969260-139969282 TACCTATCCCACGGCGGGGATGG - Intronic
981782825 4:148445364-148445386 GCGCCCCCCCACGGCGGGGGTGG - Intergenic
994353979 5:98774425-98774447 GTCCGAGCCGAAGGCGGGGAGGG - Intronic
996056539 5:118988654-118988676 GTCCCACCCTGCCGCTGGGAAGG + Intergenic
997118379 5:131149942-131149964 GTACCACCCCAGGGATGGGAGGG + Intergenic
1002401609 5:178994376-178994398 GGGCCACCCCAGGGCGAGGACGG + Intronic
1007660024 6:43478216-43478238 GTCCAACCCCAGAGCGGGTAAGG + Exonic
1007724505 6:43906901-43906923 GTCCCACTTCTCGGCAGGGAGGG - Intergenic
1008109559 6:47477922-47477944 GTCCCTCCCCACTGCGGGAGCGG + Exonic
1014143017 6:117965614-117965636 TTCCCACCCCACAGCTGGGGTGG + Intronic
1017378650 6:153800864-153800886 GTCTCACCCCACAGCAGAGAGGG - Intergenic
1019589948 7:1825919-1825941 GTCCCAGCCCCAGGCGGGGTTGG + Intronic
1020261204 7:6531586-6531608 GTCCCTCCCGACCCCGGGGAGGG - Intronic
1022469350 7:30672680-30672702 GTCCAACCCCACATGGGGGAGGG + Intronic
1023938417 7:44755573-44755595 GTCCCTCCCCAAGGCCAGGATGG + Intronic
1028622236 7:92836785-92836807 GACCCACCCCCCGGCGGGGCTGG + Intergenic
1028750303 7:94375392-94375414 GTACAACCCCAGGGCTGGGAGGG + Intergenic
1038360120 8:26866863-26866885 GTCTCACCAGACGGCGGGGGAGG + Intronic
1038666389 8:29541368-29541390 ATCCCGCCCCACAGCAGGGAAGG + Intergenic
1048867345 8:138770567-138770589 GTCCCACCCCATGTTGGGCAAGG + Intronic
1049595103 8:143479786-143479808 GTCCCCCCCCAGGGAGGAGAGGG - Intronic
1051659004 9:19408838-19408860 GTCCCGCCCCACGGTGGGCGTGG + Intergenic
1051876912 9:21802886-21802908 GTCCCTCCCCGCGGCGGCAAGGG - Intronic
1060479884 9:124011862-124011884 GGCGCACCCCAGGGAGGGGAGGG + Exonic
1061365786 9:130172095-130172117 GGCCCCCGCCGCGGCGGGGAGGG - Intergenic
1061712745 9:132499034-132499056 GTCCCTGCCGGCGGCGGGGAAGG - Intronic
1061754313 9:132802252-132802274 CTCCCACACCACACCGGGGAAGG - Intronic
1062106417 9:134757394-134757416 GTCCCAGGCCACGGGGGGCAGGG + Intronic
1186426021 X:9464983-9465005 GTCCCCTCCCACGGCCGTGAGGG + Intronic
1199608879 X:149597209-149597231 GTGGCACCCCACGGGGGGGGGGG + Exonic
1199630243 X:149772151-149772173 GTGGCACCCCACGGGGGGGGGGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic
1202115141 Y:21465024-21465046 GTTCTACCCCAGGGAGGGGATGG - Intergenic