ID: 1132876898

View in Genome Browser
Species Human (GRCh38)
Location 16:2143993-2144015
Sequence CTCCAGAGGAGGGTCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 2, 1: 0, 2: 1, 3: 28, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132876891_1132876898 1 Left 1132876891 16:2143969-2143991 CCGCGGAGGGCACAGACCGCTGA 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG 0: 2
1: 0
2: 1
3: 28
4: 225
1132876890_1132876898 2 Left 1132876890 16:2143968-2143990 CCCGCGGAGGGCACAGACCGCTG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG 0: 2
1: 0
2: 1
3: 28
4: 225
1132876888_1132876898 10 Left 1132876888 16:2143960-2143982 CCGGGGACCCCGCGGAGGGCACA 0: 1
1: 0
2: 2
3: 17
4: 162
Right 1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG 0: 2
1: 0
2: 1
3: 28
4: 225
1132876882_1132876898 28 Left 1132876882 16:2143942-2143964 CCAGGGGCACATAGCAAGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 214
Right 1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG 0: 2
1: 0
2: 1
3: 28
4: 225
1132876889_1132876898 3 Left 1132876889 16:2143967-2143989 CCCCGCGGAGGGCACAGACCGCT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG 0: 2
1: 0
2: 1
3: 28
4: 225
1132876880_1132876898 29 Left 1132876880 16:2143941-2143963 CCCAGGGGCACATAGCAAGCCGG 0: 1
1: 0
2: 0
3: 19
4: 162
Right 1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG 0: 2
1: 0
2: 1
3: 28
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132876898 Original CRISPR CTCCAGAGGAGGGTCTTGGG AGG Intronic
901451772 1:9340266-9340288 CAGCAGAGGAGGGGCCTGGGGGG + Intronic
901717536 1:11168546-11168568 CCCCTGAAGAGGGTCTAGGGAGG - Intronic
902242854 1:15100314-15100336 CTCCTGCTGAGGGTCCTGGGTGG - Intronic
903578681 1:24354783-24354805 CTGCAGACAAGGGTCTTGGGAGG - Intronic
903678615 1:25082551-25082573 CTGCAGGGGCGGGTGTTGGGGGG - Intergenic
903818786 1:26084992-26085014 ATGCAGAAGAGGGTCTTGAGGGG - Intergenic
903994553 1:27297596-27297618 ATCCACAGGAGGGACTCGGGTGG + Intronic
904325588 1:29725798-29725820 CCCCAGAGGGAGGTCCTGGGAGG - Intergenic
904366546 1:30014461-30014483 CTCCAGAGGAGGGACTTCTGGGG + Intergenic
905105057 1:35559054-35559076 CTGCAGAGGAGGGACGGGGGTGG - Intronic
907751469 1:57267537-57267559 CTCCAGAGGCTGCCCTTGGGAGG - Intronic
911254843 1:95621406-95621428 CTCCAGAGGAGAGTGGTGGGAGG + Intergenic
914855123 1:151345113-151345135 CTCCAGTGGTGGGTCCTGAGGGG + Exonic
916993819 1:170274206-170274228 TTCGTGAGAAGGGTCTTGGGAGG - Intergenic
917287303 1:173434690-173434712 CTGCAGAGGAGTGTCTTTGCTGG - Intergenic
917971500 1:180211072-180211094 CTCCAGAGGAGAGCTTTGGGTGG + Intergenic
919191731 1:194230174-194230196 CACCAGAGGAGGGTCTGGAGAGG + Intergenic
919928018 1:202202684-202202706 CTTGAGAGGAGGCACTTGGGAGG + Intronic
920672312 1:208013973-208013995 CTCCAGGGGAGGGGCTGTGGTGG - Intergenic
922237571 1:223733537-223733559 CCTCAGAGGAGGGTCTGGGTGGG + Intronic
923541022 1:234888284-234888306 CTCCAGGTCAGAGTCTTGGGAGG + Intergenic
923596867 1:235367300-235367322 GCCCAGAGGCGGGGCTTGGGTGG + Intergenic
1063061231 10:2555595-2555617 CTCCAGAGAAAGAACTTGGGAGG - Intergenic
1064333282 10:14414637-14414659 CTCCAGTGCAGAGTCTTAGGTGG - Intronic
1067705108 10:48600896-48600918 CTCCAGAGCAGGCTCTTCTGAGG + Intronic
1070053046 10:72907549-72907571 CTCCAGGAGAGGGTCTGGGAGGG - Intronic
1070740573 10:78900519-78900541 GTTCAGAGTAGGGTGTTGGGTGG - Intergenic
1071274744 10:84043185-84043207 CACCAGAGGAGGGTGCTGTGTGG - Intergenic
1072295087 10:94001085-94001107 CTTCAGAGGAGGGATATGGGGGG - Intronic
1072307257 10:94119655-94119677 ACACAGAGGAGGGTCTTAGGAGG - Intronic
1073034379 10:100553052-100553074 CTCCAGAGGTGGGTTAGGGGTGG + Exonic
1075730310 10:124631826-124631848 CTGCAGAGGCGGGTTTTGGTGGG - Intronic
1076413159 10:130265876-130265898 CTCCAGAGGAGGGAGGTGGAGGG + Intergenic
1076501002 10:130936060-130936082 CTCAAGAGCAGGGTCTTGCATGG + Intergenic
1076612901 10:131737602-131737624 CTCCAGAGGCTGATCTTAGGAGG - Intergenic
1078355827 11:10630722-10630744 CTGAAGTGGAGGGACTTGGGAGG - Intronic
1078437421 11:11337067-11337089 CTCCAGATGAGAGTTTAGGGTGG - Intronic
1080873262 11:36255476-36255498 CTACAGAGCAGGCTCTGGGGTGG + Intergenic
1082829097 11:57602195-57602217 CTGCAGAGGAGGGTCCTGAGAGG + Intronic
1083457681 11:62789959-62789981 CTCCAGAGGCCGGTATGGGGTGG - Exonic
1083665604 11:64272542-64272564 CTCCAGAGAAGGCTCTGTGGGGG - Intronic
1083826951 11:65209410-65209432 CTCCTGAGTGGGGTTTTGGGTGG + Intronic
1084955728 11:72690365-72690387 CTGCAGAAGTGGGTCTTGGGAGG + Intronic
1091979517 12:4853899-4853921 CTCCTGAGGAGGGGCCAGGGTGG + Intergenic
1092564061 12:9647143-9647165 CTCTTGAGGAGGGGCTTGTGAGG + Intergenic
1100195584 12:92240955-92240977 TTCCAGGTCAGGGTCTTGGGTGG + Intergenic
1101888669 12:108691830-108691852 CTCCAGGGGAGGGGGTGGGGTGG + Intronic
1103475845 12:121218135-121218157 CTCAAGAGAAGGGTCTTGTGGGG + Intronic
1104119865 12:125788991-125789013 CTCCAGAGGAGGGTCTTGGGAGG + Intergenic
1104171925 12:126290818-126290840 CTCCATACCAGGCTCTTGGGAGG - Intergenic
1104340882 12:127947293-127947315 CTCAAGATGAGGATCATGGGAGG + Intergenic
1104766700 12:131334291-131334313 CTCCAGAGGCATGTCCTGGGAGG + Intergenic
1105253160 13:18719397-18719419 CTCAAGAGCAGGTTCTTGTGGGG - Intergenic
1105292283 13:19060803-19060825 CCCCTGAGTGGGGTCTTGGGAGG - Intergenic
1105532601 13:21233269-21233291 CTCCTGGACAGGGTCTTGGGGGG - Intergenic
1107446088 13:40471508-40471530 CTCCAGGTGAGGGGTTTGGGTGG + Intergenic
1112338964 13:98537145-98537167 CTTCAGAGGTAGGTCTTGAGGGG - Intronic
1113994330 14:16053797-16053819 CTCATGAGGCGGGTCTTGGTGGG + Intergenic
1114255304 14:20996579-20996601 CTCCAGAGGAGGCTCATCGCTGG + Exonic
1117328785 14:54692367-54692389 CAACAGAGGAGTATCTTGGGAGG - Intronic
1120302139 14:82721361-82721383 CTGCAGTGGTGGGGCTTGGGAGG - Intergenic
1120572709 14:86141842-86141864 CGTCAGAGGAGGGACTCGGGTGG - Intergenic
1121001448 14:90454467-90454489 CCCCAGAGCAGGGTCTGGAGTGG + Intergenic
1121695710 14:95910218-95910240 CTCTAGAATAGGGTCTTGGCTGG + Intergenic
1121762392 14:96456845-96456867 CTCCTGAGGACACTCTTGGGAGG + Intronic
1122811243 14:104290402-104290424 CTCCAGAGGACTGACTTGGAAGG - Intergenic
1123186140 14:106518731-106518753 CTCCAGGGAAGGGTCTGGAGTGG - Intergenic
1202943436 14_KI270726v1_random:5136-5158 CTCCAGGGAAGGGTCTGGAGTGG + Intergenic
1125342665 15:38689926-38689948 GTGCAGAGGAGGGTCTTTGAAGG + Intergenic
1127281545 15:57497520-57497542 CTGCAGACAAGGGTCTTGAGTGG + Intronic
1129515232 15:76153291-76153313 CCCCAGAGGAGGGTCCTGAAGGG - Intronic
1129554584 15:76493093-76493115 CTCCAGAGAAGGGTCTTCAAGGG + Intronic
1129667433 15:77587448-77587470 CTCCAAAGGAGGGTCCTGGCGGG + Intergenic
1129848058 15:78777078-78777100 TTCCAGAGGAGGGGCTGGGCCGG - Intronic
1131000502 15:88936296-88936318 TTCTAGATGAGGGTCTTAGGGGG - Intergenic
1131461766 15:92622593-92622615 CCCCCGAGGAGGGGCTTGGGGGG + Intronic
1132537900 16:492411-492433 CTCCCGGGGAGGGCCCTGGGCGG - Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG + Intronic
1133127514 16:3656292-3656314 CTTCAGAGCAGGGTCCAGGGTGG + Intronic
1133663092 16:7937851-7937873 CACCAGAAGATGGACTTGGGTGG + Intergenic
1134098925 16:11438004-11438026 CACCAGTGGAAGATCTTGGGTGG - Intronic
1136416024 16:30104449-30104471 CTGCAGAGGATGGGCCTGGGTGG - Intergenic
1136540315 16:30924684-30924706 CTCCAGGGGAGGGGCCTGGAGGG - Exonic
1136870487 16:33803040-33803062 CTCCAGGGAAGGGTCTGGAGTGG + Intergenic
1137397021 16:48123473-48123495 CTCCAGAATAGGGTGGTGGGGGG - Intronic
1137403400 16:48171406-48171428 CTCCACATGAGGGCCCTGGGGGG - Intronic
1139450741 16:67026714-67026736 CTCAAGAGGAGGCCCTTGGTTGG + Intergenic
1139684933 16:68595941-68595963 CTCCTGAGTAGGGTTTTGGCCGG + Intergenic
1140070998 16:71649480-71649502 GCCCAGAGGTGGGTGTTGGGTGG + Exonic
1142358098 16:89613595-89613617 TTCCTGAGGAGGGGCCTGGGAGG + Intronic
1203101685 16_KI270728v1_random:1313010-1313032 CTCCAGGGAAGGGTCTGGAGTGG - Intergenic
1143736318 17:8914181-8914203 CCCCAGAGCAGGTTCTTGGAGGG + Intronic
1144143235 17:12370612-12370634 CTCCTGCTGAGGGTCTTGGAAGG - Intergenic
1144835655 17:18155368-18155390 CTCCTGAGGATGGTCAAGGGTGG + Exonic
1148581138 17:48744846-48744868 ATGCAGAGGAGGGGGTTGGGTGG + Intergenic
1149650999 17:58276438-58276460 CTGCAGAGAAGGGTTCTGGGAGG - Intronic
1150427150 17:65086027-65086049 CTGCCGTGGAGGGTCTTGGGGGG + Intergenic
1151578386 17:74963993-74964015 CTGCAGAGGAGGGTCAGGGGGGG + Intronic
1152088222 17:78232730-78232752 CTCCGGAGGAGGGAGCTGGGGGG - Intronic
1152133248 17:78489893-78489915 CTCCAGAGGAGCGTCTTGGCTGG - Intronic
1152409125 17:80113068-80113090 TCCCAGGGGAGAGTCTTGGGTGG - Intergenic
1153001134 18:456453-456475 CTCCAGAGGATGTTTCTGGGCGG - Intronic
1156573023 18:38280386-38280408 CTTCAGAGGAGGTTCTTCAGAGG - Intergenic
1159358579 18:67370049-67370071 CTTCGGTGGGGGGTCTTGGGTGG + Intergenic
1159667912 18:71185918-71185940 TTCCAGTTCAGGGTCTTGGGTGG - Intergenic
1160272183 18:77397230-77397252 CTCCACAGCAGGGACATGGGAGG - Intergenic
1160444772 18:78918852-78918874 TGCCAAAGGAGGGTCTTGGATGG + Intergenic
1161587127 19:5111556-5111578 TCCCAGAGGAGGGGCTGGGGAGG - Intronic
1162050324 19:8028841-8028863 CTGCGGAGGAGGGGCTTGGTTGG - Intronic
1162534764 19:11256322-11256344 CTCCAGAGGAGGGAGAGGGGAGG + Intronic
1162827768 19:13264169-13264191 CCCAAGAGGAGGGTATTGAGTGG + Intronic
1163286513 19:16351820-16351842 CTGGAGATGAGGGTGTTGGGAGG - Intergenic
1163548018 19:17950777-17950799 CCCCCGGGGAGGGTGTTGGGTGG + Intergenic
1163784750 19:19269360-19269382 CTTCAGGGGTAGGTCTTGGGAGG - Intronic
1164643669 19:29843641-29843663 CTCCAGAGGAGGCTCAGAGGCGG - Intergenic
1164981685 19:32619230-32619252 TTCCAGAGGAAGGGCTGGGGAGG - Intronic
1166202618 19:41248340-41248362 GTCCAGAGGAGGAGCTGGGGTGG + Intronic
1166668741 19:44697466-44697488 CACCAGAGGAGGGGCCAGGGAGG + Intergenic
1166751928 19:45168363-45168385 CTCCAGCTCAGGGTCCTGGGTGG + Intronic
1167414823 19:49364514-49364536 CTGGAGAGGGGCGTCTTGGGTGG + Intronic
1167509676 19:49889487-49889509 CTCCAGAGGAGGGTGGGGGGTGG - Intergenic
1168064091 19:53909523-53909545 CGCTAGCGGAGGGTCCTGGGAGG + Intronic
925098260 2:1224535-1224557 CTCCAGGTGAGGGGCCTGGGAGG - Intronic
925935208 2:8751170-8751192 TTCCAAAGGAAGGACTTGGGTGG + Intronic
926001416 2:9336343-9336365 CTCCAGAGGTGGGGCTTCAGAGG - Intronic
926311134 2:11677143-11677165 CTCCAGAGGAGGTTGGTGGCAGG - Intergenic
926615234 2:14990922-14990944 CTACAGAGGAGAGACATGGGAGG + Intergenic
926793730 2:16601299-16601321 CTCCAGCTGAGGGGGTTGGGGGG + Intronic
927553550 2:24017853-24017875 CCCCAGAGGAGGGGCGAGGGTGG + Intronic
928616346 2:33043535-33043557 GTCCAGAGGAGGGTGGTGGAGGG + Intronic
930737611 2:54795412-54795434 CGCCAGAGGAGGGGCCTGGTGGG - Intronic
930738446 2:54803456-54803478 TGCTAGAGGAGGGTCTAGGGTGG - Intronic
930873309 2:56187965-56187987 CTGCAGAGCAGGGTGGTGGGCGG - Intronic
933692537 2:85190426-85190448 CTGCAGAGGCCAGTCTTGGGTGG + Intronic
935156277 2:100486363-100486385 CTCCATAGGATAATCTTGGGAGG - Intergenic
936098601 2:109554420-109554442 CTCCAGTTCAGGGTCATGGGTGG + Intronic
937046438 2:118854543-118854565 CTGCTGAGGTGGGTCTTGGTGGG - Intergenic
937283208 2:120734905-120734927 CACCCGAAGAGGGTCTTGGGGGG - Intergenic
938662576 2:133502894-133502916 CTGCAGAGGAGGGACTTGGATGG + Intronic
939771048 2:146318833-146318855 AACCAGAGGTGGCTCTTGGGAGG - Intergenic
939776466 2:146393398-146393420 CTCCAGAGGCACGTCCTGGGAGG - Intergenic
941431282 2:165417437-165417459 CTCCAGGGCAGGGGGTTGGGAGG - Intergenic
944171336 2:196782114-196782136 ATTAAGAGGTGGGTCTTGGGAGG + Intronic
944435559 2:199685395-199685417 GTAGAGAGGAGGGTCTTAGGTGG - Intergenic
947817589 2:233048530-233048552 CCCCAGAAGAGTGCCTTGGGTGG - Intergenic
947820377 2:233064764-233064786 CCGCAGAGAAGGGACTTGGGAGG + Intronic
948106691 2:235420151-235420173 CTGGAGAGGTGGGTGTTGGGTGG - Intergenic
948287013 2:236793677-236793699 CTCCAGAGAAGCGTCCTGGGCGG - Intergenic
1168747536 20:256755-256777 CTCCAAAGGACGCTATTGGGGGG + Intergenic
1168803257 20:657517-657539 CTCCAGGTGATGGTGTTGGGAGG + Intronic
1170157808 20:13284641-13284663 CCCAAGAGGAGGGTCTTTGCCGG + Intronic
1172622692 20:36330243-36330265 GGCCAGAGGAGGGTTTTGTGGGG + Intronic
1172805000 20:37605387-37605409 CTCCAGAGGGGGCTCTGGGGAGG + Intergenic
1174457910 20:50662590-50662612 CCCGAGAGGAGGGTCCTGGGTGG - Intronic
1174556703 20:51400699-51400721 CTGCGGAGGAGGGTGTTTGGCGG - Intronic
1176115266 20:63429361-63429383 CTCCACAGGTGGGTGTGGGGAGG - Intronic
1177663106 21:24113551-24113573 CTCCAGAAGAGGGAGTTGGGGGG + Intergenic
1180312939 22:11253718-11253740 CTCATGAGGCGGGTCTTGGTGGG - Intergenic
1180342306 22:11628639-11628661 CTCATGAGGCGGGTCTTGGTGGG + Intergenic
1180789509 22:18567157-18567179 CCCCAGGGGAGGGTGTGGGGTGG + Intergenic
1180961289 22:19763530-19763552 CTCCAGAGGCGGGTTCTGAGAGG - Intronic
1180963432 22:19773308-19773330 CCCCAGAGGAAGGTCTAGGTGGG + Intronic
1181232233 22:21428155-21428177 CCCCAGGGGAGGGTGTGGGGTGG - Intronic
1181246418 22:21506702-21506724 CCCCAGGGGAGGGTGTGGGGTGG + Intergenic
1181542452 22:23580562-23580584 CCCCAAGGGAGGGTCTTGGGGGG - Intergenic
1182505509 22:30779539-30779561 CTCCAGAGGGTGGTCCTGGGCGG + Intronic
1182663863 22:31943864-31943886 CACCAGAGGAGGGGACTGGGTGG - Intronic
1183736601 22:39648115-39648137 TTCCAGAGCAGGGCCTGGGGTGG - Intronic
1184414451 22:44344109-44344131 AGCCACAGGAGGGTCTTGAGCGG - Intergenic
1184784829 22:46666616-46666638 CCCCAGAGGAGGGGCTGGTGAGG + Intronic
1184803768 22:46778569-46778591 CCCCAGTGGAAGGTCTTCGGGGG + Intronic
1185313584 22:50169738-50169760 CTGCAGTGGAGGGTGTGGGGCGG + Intergenic
949872851 3:8604120-8604142 CTCCAGGTCAGGGTCGTGGGTGG + Intergenic
953828801 3:46277740-46277762 CCCCTGAGGAGAGTCGTGGGAGG + Intergenic
954457767 3:50609240-50609262 TCCCAGTGGAGGGTCTGGGGTGG + Intronic
956208016 3:66773943-66773965 TTCCAATTGAGGGTCTTGGGTGG + Intergenic
962350356 3:134651578-134651600 CTCCCTAGGAGGGAGTTGGGTGG + Intronic
964277288 3:155022020-155022042 CTCAAGATGATGGTATTGGGAGG - Intergenic
965728155 3:171742157-171742179 ATCCAGAGGTGGGACTGGGGTGG + Intronic
966945915 3:184777038-184777060 CGCCAGATGAGAGACTTGGGGGG + Intergenic
967864781 3:194181258-194181280 CTCTAGGGGAGGGCCCTGGGAGG - Intergenic
969470453 4:7384639-7384661 CTCCCAAGAAGGGTCTTGGGTGG - Intronic
969718303 4:8879033-8879055 TTCCGTAGGAGGGTCTTGGGAGG + Intergenic
969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG + Intergenic
974989767 4:69072664-69072686 GTAAAGAGCAGGGTCTTGGGGGG + Intronic
983511130 4:168610638-168610660 CTCTAGAGGAGGGTCTGGGTTGG - Intronic
986601053 5:9473626-9473648 CTGAAGAGGAGGGGCTGGGGAGG + Intronic
992416859 5:76559948-76559970 TTCCAGGTCAGGGTCTTGGGTGG - Intronic
992648139 5:78831338-78831360 CTCCACTGGAGGGTGCTGGGGGG - Intronic
995479157 5:112577992-112578014 CTCAAGTGGATGGTCTGGGGTGG + Intergenic
995656848 5:114435247-114435269 CTTCAGAGGTGGTTTTTGGGTGG + Intronic
998404990 5:141869245-141869267 CTCCCAATGAGGGTGTTGGGTGG + Exonic
999972919 5:156883024-156883046 CTCCAGAGGTGGATGGTGGGAGG + Intergenic
1000177545 5:158772417-158772439 CTCCAGAGGAGGGGCTGAGATGG + Intronic
1002081407 5:176739803-176739825 CTCCAGAGGAGGGAGATGGCTGG - Intergenic
1002373521 5:178772770-178772792 CCCAGGAGGAGGGTCTTGGAGGG + Intergenic
1002456204 5:179346371-179346393 CTGGAGAGGAGGGACTGGGGAGG - Intergenic
1002946522 6:1766562-1766584 CTCGGGAGGAGGGTCTAAGGTGG + Intronic
1003389666 6:5702852-5702874 CTCCTGGACAGGGTCTTGGGGGG + Intronic
1003489309 6:6607019-6607041 CTCCAGAGGAGGGGATTGCACGG + Intronic
1006397542 6:33796989-33797011 CTCCTGAGGAGGGAGCTGGGAGG - Intronic
1007503411 6:42315867-42315889 CTGAAGAGGAGGGACTTGGGTGG + Intronic
1009694904 6:67089735-67089757 CTTCTGGTGAGGGTCTTGGGAGG + Intergenic
1013409664 6:109872792-109872814 CTCCAGAGCAGGGGTTAGGGAGG + Intergenic
1018203321 6:161414756-161414778 CACCAGAGGAGGGTCTCCGCAGG + Intronic
1018933052 6:168254742-168254764 CTCCAGGCCAGGGTCATGGGTGG - Intergenic
1018973106 6:168542564-168542586 TTACAGAGGAGGGTTTGGGGTGG + Intronic
1020279801 7:6644343-6644365 CTCCAGAGCAGGGGTGTGGGAGG + Intronic
1023114902 7:36853202-36853224 GTCCAAAGGAGGGTCTAGGGAGG + Intergenic
1023732079 7:43201738-43201760 GTCCAGAGAATGGTCTTGTGTGG + Intronic
1023843210 7:44107998-44108020 CTTCACAGGAGGCTCTGGGGAGG - Exonic
1024051659 7:45627634-45627656 GGCCAGAGGAGGGGCTGGGGTGG + Intronic
1024078069 7:45833421-45833443 CACCAGAGGAGGGATTTGAGAGG - Intergenic
1026447682 7:70499694-70499716 CACCAGTGGAGAGTCTTAGGAGG + Intronic
1028742507 7:94291889-94291911 GTCAAGGGGAGGATCTTGGGTGG + Intergenic
1028823916 7:95246559-95246581 ATCCACAGCAGGGTCTTTGGAGG - Intronic
1032023461 7:128422884-128422906 CAGCAGGGGAGGGTCTGGGGTGG + Intergenic
1032533662 7:132643008-132643030 CTCCAGAGAAGGGTATTAGGTGG + Intronic
1032563555 7:132916977-132916999 ATCCACAGGGGGGTCTTGGAAGG + Intronic
1035270196 7:157715237-157715259 CCCAAGAGGAGGGTCGTGGTGGG + Intronic
1035930239 8:3772832-3772854 GTGCAGAGGAGGGGGTTGGGAGG - Intronic
1037885260 8:22592689-22592711 CTGGAGAGGAGGCTCTGGGGTGG - Intronic
1038423094 8:27446106-27446128 CTCCAGAGCAGGGCCTGGTGTGG - Intronic
1038804348 8:30776667-30776689 CAGCAGTGGAGGGTCCTGGGTGG - Intronic
1040277031 8:46019043-46019065 CCCCTGAGCAGGGTCTGGGGGGG - Intergenic
1041588644 8:59550266-59550288 CCCCAGAGGTGGGGCTGGGGCGG - Intergenic
1047194259 8:122706994-122707016 CTCCAGTGCAGGGACTTGGAAGG - Intergenic
1047744859 8:127837159-127837181 CCCCAGAGAAGGGCCATGGGTGG + Intergenic
1047926968 8:129691572-129691594 CTACATAGGAGAGTCTGGGGGGG - Intergenic
1049317196 8:141975574-141975596 CCCCTGAGGAGGGGTTTGGGTGG + Intergenic
1049408777 8:142463299-142463321 CTGCAGAGGGCAGTCTTGGGGGG + Intronic
1049561043 8:143310412-143310434 ATACAGAGGAGGGCCGTGGGCGG + Intronic
1049830976 8:144700522-144700544 CTCCTGAGAAGGGTCCTCGGGGG + Intergenic
1049853285 8:144845886-144845908 CTGCTGAGAAGGGTCTTGGCAGG + Intronic
1055116574 9:72611741-72611763 AGCCAGAAGAAGGTCTTGGGTGG + Intronic
1055312773 9:75001014-75001036 CTCCAGAGTAGGGGTTTCGGTGG - Intronic
1055559055 9:77504393-77504415 CTTCAGAAGAGTGTCCTGGGTGG - Intronic
1057719270 9:97519077-97519099 CTCCAGAGGAGGCACTTACGCGG - Intronic
1058025246 9:100135768-100135790 CTCCAAAGTAAGGTCTTGGCTGG + Intronic
1058901757 9:109448191-109448213 CTGGAGAGGAGGGTCTTCAGAGG - Intronic
1060540204 9:124424125-124424147 CTCGAGAGAAGGGTCTGGGCTGG + Intergenic
1061130139 9:128703801-128703823 CTCCAGAGGAAGGGGGTGGGAGG - Intronic
1062025726 9:134339288-134339310 AGACAGAGGAGGGTCTGGGGAGG - Intronic
1062063700 9:134514557-134514579 CTCCTGAGGTGGGGCATGGGTGG + Intergenic
1062627195 9:137448655-137448677 CTTCAGAGGAGGCTCTGGGTGGG - Exonic
1185611790 X:1397516-1397538 CTTCAGAGGGCAGTCTTGGGGGG - Intergenic
1185671020 X:1810287-1810309 CCCAAGAGGATGGTGTTGGGAGG + Intergenic
1186376058 X:9003025-9003047 CTCCAGAGGAAGGAATGGGGTGG - Intergenic
1191915612 X:66198521-66198543 AAGCAGGGGAGGGTCTTGGGGGG - Intronic
1192208241 X:69110154-69110176 CTCCATGGGAGGGCCTAGGGTGG - Intergenic
1192578361 X:72260591-72260613 CTAAGGAGGAGGGCCTTGGGAGG - Intronic
1193198345 X:78659113-78659135 CTCCTGAGGCTGGTCTTGTGTGG - Intronic
1193936012 X:87622771-87622793 TTCCAGAGGAGAGTCTAGGAAGG + Intronic
1197853563 X:130890375-130890397 CTGCCGAGGAGGAGCTTGGGTGG - Intronic
1199621546 X:149705852-149705874 CTCCAGAAGAGGCTGTTGGTGGG + Intronic