ID: 1132878047

View in Genome Browser
Species Human (GRCh38)
Location 16:2148930-2148952
Sequence CACCGCCGCCAAGCGAGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132878047_1132878050 4 Left 1132878047 16:2148930-2148952 CCGGCCCTCGCTTGGCGGCGGTG 0: 1
1: 0
2: 3
3: 7
4: 60
Right 1132878050 16:2148957-2148979 CTTCTACGACGTCGCCTTCAAGG 0: 1
1: 0
2: 1
3: 1
4: 20
1132878047_1132878051 13 Left 1132878047 16:2148930-2148952 CCGGCCCTCGCTTGGCGGCGGTG 0: 1
1: 0
2: 3
3: 7
4: 60
Right 1132878051 16:2148966-2148988 CGTCGCCTTCAAGGTGAGCCAGG 0: 1
1: 0
2: 1
3: 3
4: 57
1132878047_1132878053 28 Left 1132878047 16:2148930-2148952 CCGGCCCTCGCTTGGCGGCGGTG 0: 1
1: 0
2: 3
3: 7
4: 60
Right 1132878053 16:2148981-2149003 GAGCCAGGCACCCGCCCCCCAGG 0: 1
1: 0
2: 2
3: 23
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132878047 Original CRISPR CACCGCCGCCAAGCGAGGGC CGG (reversed) Exonic
901034382 1:6327459-6327481 CATGGCCGCCCAGCGAGGGGAGG - Intronic
1069913122 10:71771889-71771911 CAGCCCAGCCAAGTGAGGGCAGG + Intronic
1071695087 10:87862501-87862523 CACGGCGGCCAAGGGGGGGCGGG + Exonic
1074465869 10:113680320-113680342 CACCGCCGGCAGGCAAGGGGTGG - Intronic
1076372963 10:129966897-129966919 CACCGCAGCCAGGCCAGGGATGG + Intergenic
1079111342 11:17606823-17606845 CACCCCACCCAAGCCAGGGCTGG + Intronic
1083551573 11:63593972-63593994 CACTGCCACCAGGCGAGGGAGGG + Intronic
1084153459 11:67301861-67301883 CCTCCCCGCCAAGCCAGGGCTGG - Intronic
1092145290 12:6210489-6210511 CACTGCCCCCAAGCGAGGCCAGG + Intronic
1096438987 12:51622762-51622784 CTCCTCCCCCAAGCGTGGGCTGG - Intronic
1096700572 12:53380373-53380395 CCCCGCCGTGAAGCGGGGGCGGG + Intronic
1096717759 12:53501330-53501352 CACAGCCGACGAGCTAGGGCCGG - Exonic
1097787779 12:63780051-63780073 CGCCGCCGCCAGGCGCCGGCCGG + Exonic
1101942608 12:109111154-109111176 CACCGCAGCCAGGGGAGGGTTGG - Intergenic
1102299332 12:111759515-111759537 CCCAGCCTCCAAGGGAGGGCAGG - Intronic
1106400790 13:29428423-29428445 CATCCCCGCCAGGGGAGGGCTGG + Intronic
1130335287 15:82952705-82952727 CACCGCCGCCAGGCGCGGGCGGG + Exonic
1131259220 15:90879973-90879995 CACCGAGCCCAAGTGAGGGCTGG + Exonic
1132878047 16:2148930-2148952 CACCGCCGCCAAGCGAGGGCCGG - Exonic
1132903222 16:2269426-2269448 CACCGCCCCCGGCCGAGGGCGGG + Intergenic
1132964835 16:2647156-2647178 CACCACCCCCAAGGGAAGGCGGG + Intergenic
1133769031 16:8857027-8857049 CACCTCCCCCAAAGGAGGGCAGG + Intronic
1141704818 16:85658922-85658944 CACCGCAGCCAGGGGAGGCCAGG - Intronic
1143499321 17:7329674-7329696 CACCGCCCCCTAGCGAGGGCGGG - Intergenic
1144742539 17:17591975-17591997 CACCGCCGCCAGGCAAGGGCAGG - Intergenic
1160465004 18:79069207-79069229 CGCCGACGCCAAACGAGGGCGGG + Intergenic
1162551214 19:11359511-11359533 GACTGCCACCAAGCCAGGGCGGG - Intronic
1162808830 19:13152363-13152385 CACCGCCTACAAGCAAGGGCTGG + Exonic
1162910701 19:13846717-13846739 CACTGCCGCCAGCCGGGGGCTGG - Intergenic
1164539407 19:29111765-29111787 CAGCCCCGCCAAGGGAGGCCAGG - Intergenic
1168687705 19:58358441-58358463 CCCCGCTGCCAAGGCAGGGCAGG + Intronic
925391818 2:3500475-3500497 CCTCACCGCCAAGCAAGGGCTGG + Intronic
925725243 2:6865502-6865524 CAGCGCCGCCAGGCGGGGGTCGG + Exonic
928421225 2:31138760-31138782 CAGCGCCGCCTGGCGAGGGCCGG - Intronic
934854996 2:97724153-97724175 CATAGCCGCCCAGCGAGCGCAGG - Exonic
945560177 2:211330049-211330071 CAGCGTGGCCAAGCGAGGCCCGG - Intergenic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1174306211 20:49615953-49615975 CACCGCAGGCCAGGGAGGGCAGG - Intergenic
1179465456 21:41568695-41568717 CACCTCCTCCAGACGAGGGCTGG + Intergenic
1181019201 22:20089884-20089906 CACCGCAGCCAAGCAGAGGCCGG + Intronic
1181512984 22:23397103-23397125 CACCGCAGCCAGGCCGGGGCTGG + Intergenic
1184676265 22:46045023-46045045 CAGCGCCGCCGGGCGAGGGCGGG - Intergenic
954839122 3:53495543-53495565 CAACGCCCCCGAGCGATGGCAGG + Intronic
959637244 3:108589404-108589426 CACCACCGCCCAGCGTGCGCCGG + Exonic
961885122 3:130091946-130091968 CACCCCTGCCAATCGAGGCCTGG - Intronic
966924466 3:184635353-184635375 CACAGCTGCCAGGCGAGAGCAGG - Intronic
967847045 3:194052357-194052379 TACCTCAGCCAAGCCAGGGCTGG + Intergenic
987149125 5:15021036-15021058 GACCCCCGCCAACCCAGGGCTGG + Intergenic
998112662 5:139514170-139514192 CACTGAGGCCAAGAGAGGGCAGG + Intergenic
999653995 5:153795031-153795053 CACCTCCTCCAACTGAGGGCAGG + Intronic
1000210071 5:159100423-159100445 CACCGCAGCCAATCGCGGCCCGG + Intergenic
1001506443 5:172283925-172283947 CAGCCCCGCCAGGCCAGGGCTGG + Exonic
1015743685 6:136486639-136486661 CACAGCCTCAAAGCTAGGGCAGG - Intronic
1016982354 6:149864493-149864515 CGCCGCTGCCCAGCTAGGGCAGG + Intergenic
1027374401 7:77536706-77536728 CACCGCCGCCAGCCGTGGGCTGG - Intergenic
1031629942 7:124033310-124033332 CACCGCGGCCCAGCCAGGGGAGG + Intergenic
1034342710 7:150368666-150368688 CGCCCCCGCCAAGAGCGGGCCGG - Intronic
1039845924 8:41325365-41325387 CACTGCTGCCAAGCCAGGTCCGG + Intergenic
1041906514 8:63038907-63038929 CACGGCCGCCTAGCGCGCGCCGG - Exonic
1042059138 8:64798588-64798610 CACCGCGGCCTAGCGCGCGCCGG - Exonic
1043388156 8:79768018-79768040 CACCGCCGCCGGGCAGGGGCGGG - Intergenic
1043464008 8:80487116-80487138 CGCCACCGCCAAGCGAGGTGGGG - Exonic
1048971415 8:139647059-139647081 CCCTGCCGCCAACAGAGGGCGGG - Intronic
1053135274 9:35646918-35646940 CGCCGCCGCCTGGCGAGGGGCGG - Intergenic
1057565598 9:96163819-96163841 CACCGCCTGCAAGCGCGTGCCGG - Intergenic
1061059795 9:128244698-128244720 CACCGCCGCCACTGGAGAGCTGG - Intronic
1061217760 9:129231603-129231625 CAGTGCCCCCAAGCCAGGGCAGG - Intergenic
1062047863 9:134432718-134432740 CACCCCCGGCACGTGAGGGCAGG + Intronic
1062537635 9:137027900-137027922 CAGCGCCGGCAGGCGAGGGCAGG + Exonic
1200000019 X:153055653-153055675 CACGGCTGCCAAGGAAGGGCAGG + Intergenic
1200146388 X:153928354-153928376 CACTGCCGCCAGGCGCGGGGCGG + Intronic