ID: 1132879467

View in Genome Browser
Species Human (GRCh38)
Location 16:2155645-2155667
Sequence CCCCGCGACGACGAGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132879461_1132879467 29 Left 1132879461 16:2155593-2155615 CCAATCAGACTTCGATCTGCAAC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1132879467 16:2155645-2155667 CCCCGCGACGACGAGGCCGCCGG 0: 1
1: 0
2: 1
3: 12
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132879467 Original CRISPR CCCCGCGACGACGAGGCCGC CGG Intergenic
900100383 1:959916-959938 CCCCGCGACAAGGGCGCCGCGGG + Intergenic
900117034 1:1033321-1033343 CCCCGCCAGGGCGGGGCCGCGGG + Intronic
903485719 1:23688431-23688453 CCCCGGGAGGCCGAGGCCGGCGG - Intergenic
906545509 1:46616870-46616892 CCCCGCCACGCCGCGGCCACGGG + Intronic
911498942 1:98662083-98662105 CCCCGAGGCGACGCGGCCCCGGG - Intronic
920401567 1:205679845-205679867 CCCCGCGGCGCCGCGGCCGTCGG + Intronic
922200032 1:223393676-223393698 ACCCGCGCCTGCGAGGCCGCGGG - Exonic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
1062798839 10:364481-364503 CACCACGAAGACGAGGCCTCCGG + Exonic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1075522212 10:123149674-123149696 CCCGGCGAGGGCGAGCCCGCGGG - Exonic
1076096482 10:127737763-127737785 CCCCGCGACGAGGACGACCCAGG + Exonic
1077898785 11:6473906-6473928 CCCCGCGCCGGCGCCGCCGCCGG + Intronic
1083227481 11:61294269-61294291 CCCCCGGAGGACGTGGCCGCGGG + Intronic
1084385805 11:68841979-68842001 CCCCGCCCCGCCGAGGCCCCGGG - Intronic
1096101235 12:48971608-48971630 CCCAGCGCCGCCGCGGCCGCCGG + Exonic
1119219147 14:72892750-72892772 CCCCGCCCGGACGAAGCCGCAGG - Intronic
1120632273 14:86905512-86905534 CCCCGCCCCGACGACGCCGTGGG - Intergenic
1123474438 15:20579907-20579929 CCCCGGGAGGCCGAGGCCGGCGG + Intergenic
1123643574 15:22420446-22420468 CCCCGGGAGGCCGAGGCCGGCGG - Intergenic
1131055343 15:89371542-89371564 CCCCGCGCCCTCGAGGCTGCGGG + Intergenic
1132879467 16:2155645-2155667 CCCCGCGACGACGAGGCCGCCGG + Intergenic
1133076194 16:3283005-3283027 TCCGGAGCCGACGAGGCCGCAGG + Exonic
1138327955 16:56191299-56191321 CCCCGGGACGGGGAGGGCGCGGG - Intergenic
1142810555 17:2393788-2393810 CCCGGGGACGCCGAGGCTGCAGG + Intronic
1152628461 17:81399204-81399226 CGCCGCGGCGAAGAGGCTGCTGG - Intronic
1160453041 18:78978804-78978826 CGCGGCGACGACGGGGCCGGGGG + Intergenic
1160567767 18:79797950-79797972 CTCCGCCCCGAGGAGGCCGCCGG + Intergenic
1161400674 19:4065398-4065420 CCCCGCGCGGGCGAGGCGGCGGG - Intronic
1162934213 19:13973050-13973072 ACCAGCTACTACGAGGCCGCAGG - Exonic
1163575748 19:18110018-18110040 CGCAGGGACGCCGAGGCCGCCGG - Intronic
1166763439 19:45238678-45238700 CACGGCGACGAGGAGGCAGCGGG - Intronic
1168401458 19:56088063-56088085 GACGACGACGACGAGGCCGCGGG - Exonic
925927180 2:8678890-8678912 CGCCGCGAGGACAAGGCTGCAGG + Exonic
928193103 2:29192217-29192239 CCCCGGGAGGAACAGGCCGCTGG - Intergenic
929218038 2:39436856-39436878 CCGCGCGCCGCCGAGGCCGTGGG - Intronic
933858579 2:86441903-86441925 CCGCGCGAGGACGCGGCCCCGGG - Intronic
933907931 2:86913942-86913964 CCCCGCCAGGTCGAGGCCGTCGG - Intronic
934078964 2:88451895-88451917 CCCCGCGACGAGGACGACCCAGG - Exonic
936278724 2:111120774-111120796 CCCCTCGGCGCCGCGGCCGCCGG - Intronic
944632772 2:201643456-201643478 CCCCGCGACGCAGCGGCCTCCGG + Exonic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1173672848 20:44810174-44810196 TCCTTCGACGACGAGGACGCAGG - Exonic
1175494417 20:59403882-59403904 CAGCGCCACCACGAGGCCGCGGG + Intergenic
1178865175 21:36320704-36320726 CCCCGGGACGTCGAGGCCGCCGG - Intronic
1179845275 21:44107576-44107598 CCCCGCGTCCCCGAGGCCACGGG - Intronic
1181725163 22:24806337-24806359 CCCCGCGGGTAAGAGGCCGCTGG + Exonic
954618627 3:51983380-51983402 ATCCGCGCCGACGCGGCCGCTGG + Exonic
960582703 3:119294506-119294528 CCCGGAGACGACGCGGACGCGGG - Exonic
968047928 3:195634626-195634648 GCCCGGGAGGTCGAGGCCGCAGG - Intergenic
968099473 3:195954993-195955015 GCCCGGGAGGTCGAGGCCGCAGG + Intergenic
968306683 3:197655295-197655317 GCCCGGGAGGTCGAGGCCGCAGG + Intergenic
968520590 4:1033115-1033137 CCCTGGGACGAAGAGGCCACAGG + Intergenic
980354659 4:131725403-131725425 CTCCGCGACTAAGAGGCCACCGG - Intergenic
980355190 4:131727909-131727931 CTCCGCGACTACGAAGCCACCGG - Intergenic
980355737 4:131730393-131730415 CTCCGCGACTACGAAGCCACCGG - Intergenic
980356277 4:131732887-131732909 CTCCGCGACTACGAAGCCACCGG - Intergenic
980356811 4:131735375-131735397 CTCCGCGACTACGAGGCCACCGG - Intergenic
980357350 4:131737863-131737885 CTCCGCGACTACGAGGCCACCGG - Intergenic
980357891 4:131740342-131740364 CTCCGCGACTACGAGGCCACCGG - Intergenic
980358962 4:131745322-131745344 CTCCGCGACTACGAAGCCACCGG - Intergenic
980359502 4:131747795-131747817 CTCCGCGACTACGAGGCCACCGG - Intergenic
980360585 4:131752758-131752780 CTCCGCGACTACGAGGCCACCGG - Intergenic
980361126 4:131755230-131755252 CTCCGCGACTACGAGGCCACCGG - Intergenic
980361668 4:131757713-131757735 CTCCGCGACTACGAGGCCACCGG - Intergenic
980362209 4:131760185-131760207 CTCCGCGACTACGAGGCCACCGG - Intergenic
980362752 4:131762668-131762690 CTCCGCGACTACGAGGCCACCGG - Intergenic
985743665 5:1634448-1634470 GCCCGGGAGGTCGAGGCCGCAGG + Intergenic
997584171 5:135034751-135034773 CCCCTCGACGAGGACACCGCTGG - Intronic
1001246087 5:170106510-170106532 CCCCGCGACGAGGACGACCCGGG + Exonic
1002140094 5:177133097-177133119 CCCCGAGCAGACGCGGCCGCAGG - Intronic
1003035004 6:2634349-2634371 CCCCGCCACGCCGCGCCCGCAGG + Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1027051096 7:75021684-75021706 CCTCAAGACGAGGAGGCCGCCGG + Intronic
1035713235 8:1734499-1734521 CCCCACGACGACGCGGCAGCAGG - Intergenic
1038266753 8:26044179-26044201 GCCCGGGAAGACGAGGCGGCCGG - Intronic
1044242444 8:89902691-89902713 CCCCGCGACCCCGAGCCAGCGGG + Exonic
1049558716 8:143296825-143296847 CCTCGCGCCCACCAGGCCGCCGG - Exonic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1057546159 9:96021587-96021609 CCGCGCGAAGACGAGGCCAGTGG + Intergenic
1061583960 9:131554709-131554731 CCCAGCGAGGACGGGGCCGCGGG + Intergenic
1061608998 9:131733665-131733687 CCCGGCGGCGAGGCGGCCGCGGG + Intronic
1193819889 X:86148658-86148680 CCCCGGGACGCCGGCGCCGCTGG - Exonic
1195045606 X:101051958-101051980 CCCAGCGTCGGCGAGGCAGCAGG + Exonic
1200229581 X:154437348-154437370 CCCCGCGATGATGCGGCCGCCGG + Intronic