ID: 1132879538

View in Genome Browser
Species Human (GRCh38)
Location 16:2155893-2155915
Sequence CGCGCCTCGGGACCGCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 115}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132879521_1132879538 30 Left 1132879521 16:2155840-2155862 CCCGGGCGGCCGCGGGCGGGTGA 0: 1
1: 0
2: 3
3: 24
4: 193
Right 1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG 0: 1
1: 0
2: 1
3: 9
4: 115
1132879532_1132879538 -10 Left 1132879532 16:2155880-2155902 CCGACCCGGGGCTCGCGCCTCGG 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG 0: 1
1: 0
2: 1
3: 9
4: 115
1132879528_1132879538 2 Left 1132879528 16:2155868-2155890 CCCGCGGCGCGCCCGACCCGGGG 0: 1
1: 0
2: 1
3: 16
4: 210
Right 1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG 0: 1
1: 0
2: 1
3: 9
4: 115
1132879531_1132879538 -9 Left 1132879531 16:2155879-2155901 CCCGACCCGGGGCTCGCGCCTCG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG 0: 1
1: 0
2: 1
3: 9
4: 115
1132879523_1132879538 21 Left 1132879523 16:2155849-2155871 CCGCGGGCGGGTGAGTGTCCCCG 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG 0: 1
1: 0
2: 1
3: 9
4: 115
1132879526_1132879538 3 Left 1132879526 16:2155867-2155889 CCCCGCGGCGCGCCCGACCCGGG 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG 0: 1
1: 0
2: 1
3: 9
4: 115
1132879522_1132879538 29 Left 1132879522 16:2155841-2155863 CCGGGCGGCCGCGGGCGGGTGAG 0: 1
1: 0
2: 4
3: 33
4: 239
Right 1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG 0: 1
1: 0
2: 1
3: 9
4: 115
1132879530_1132879538 1 Left 1132879530 16:2155869-2155891 CCGCGGCGCGCCCGACCCGGGGC 0: 1
1: 0
2: 1
3: 62
4: 261
Right 1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG 0: 1
1: 0
2: 1
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132879538 Original CRISPR CGCGCCTCGGGACCGCGCGG TGG Intronic
900531071 1:3153469-3153491 CCAGCCTGGGGACCGCGCTGTGG - Intronic
901251711 1:7784304-7784326 CGAGCCTCGAGACTGCGCGAGGG + Intronic
901425960 1:9182573-9182595 CGCGCCCCGCGACCCAGCGGCGG - Intergenic
901641369 1:10694688-10694710 CGCGCGGCGGGGGCGCGCGGCGG - Intronic
905308400 1:37034118-37034140 CGCGCCCCGGGCACGCTCGGCGG - Exonic
909957692 1:81800727-81800749 CGCGCCGGCGGAGCGCGCGGAGG + Intronic
912776526 1:112509224-112509246 CGCCCCTCCGGGCTGCGCGGCGG + Exonic
916750833 1:167721824-167721846 GGCGCCTCGGCCCCGCGCGGAGG - Intronic
922505151 1:226121922-226121944 GGCGCCTGGGGAGCCCGCGGAGG + Intergenic
923684102 1:236142304-236142326 CGCACTGCGGGAGCGCGCGGTGG + Intergenic
924524606 1:244835284-244835306 CGAGCCTCGGGCGCGCGCCGAGG - Intergenic
1062874160 10:931734-931756 CGAGGCGCGGGTCCGCGCGGGGG - Intergenic
1069544455 10:69318690-69318712 CGCGCCTCTGCAACGCCCGGCGG - Intronic
1070329135 10:75405495-75405517 CGCTCCCAGGGACCGCGAGGCGG - Intergenic
1072970080 10:100009848-100009870 CGCGCCGAGGGACCGCCGGGCGG - Exonic
1074866434 10:117546761-117546783 CGCGCCTTGGGCCAGCGCCGGGG + Intronic
1077249965 11:1556738-1556760 GGCGCCCCGGGACCAGGCGGCGG - Exonic
1078090720 11:8263033-8263055 TGCGCCGCGGGGCCGCGCGGAGG - Intronic
1080801930 11:35618119-35618141 CGCGCCCTGGGCCCTCGCGGGGG - Intergenic
1084086298 11:66856881-66856903 AGCGCCGGGGGACAGCGCGGAGG + Intronic
1084225369 11:67711809-67711831 CGAGCATGGGGACGGCGCGGAGG - Intergenic
1084263185 11:67991656-67991678 CGAGCATGGGGACGGCGCGGAGG - Exonic
1084546759 11:69818625-69818647 CGCGCTGCGGGGCCCCGCGGGGG - Intronic
1084810212 11:71607465-71607487 CGAGCATGGGGACGGCGCGGAGG + Intergenic
1085037284 11:73308169-73308191 CGAGCCTGGGAACCGCGTGGTGG - Intergenic
1086887911 11:92225343-92225365 GGCGGCTCGGGGCTGCGCGGAGG - Intergenic
1090327781 11:125904190-125904212 CGGGCCGCGGGGCGGCGCGGGGG + Intronic
1091303875 11:134524293-134524315 CCCGCCTCAGGACCCTGCGGCGG + Intergenic
1092905978 12:13101161-13101183 GGCGCTTGGGGACCGCGGGGCGG + Intronic
1095440821 12:42237836-42237858 CGCGCCGAGGGCCCGCGGGGCGG - Intronic
1096122064 12:49094677-49094699 CGTGCCCCGGGAGCGGGCGGGGG + Exonic
1102853908 12:116277342-116277364 CGCGCCCCGGGCCGGCGCTGCGG + Intergenic
1105850269 13:24328158-24328180 CGCGCCTCGGGAGTGGGCTGGGG + Intergenic
1108555182 13:51584629-51584651 CGCGCCGCGGGGCCGGGCTGAGG - Exonic
1113082827 13:106535547-106535569 CGCGCGTCCGGAGCCCGCGGCGG - Intergenic
1113861511 13:113490504-113490526 CGCGCCGCGGGCCCGCGAGCCGG - Intronic
1117548022 14:56809046-56809068 CGTGGCTCGGGGCCGGGCGGGGG - Intronic
1117803002 14:59464461-59464483 GGCGCCCCGGGAACTCGCGGCGG - Exonic
1120190647 14:81436520-81436542 CGCGGCTCGGGAGCGCGCCGCGG - Intergenic
1121342853 14:93115587-93115609 TGTGGCTCGGGCCCGCGCGGCGG - Intronic
1121547021 14:94770024-94770046 CCCGCGTCGGGACCGGGGGGCGG + Exonic
1123630468 15:22257251-22257273 CGGGGCTCCGGACCCCGCGGCGG + Intergenic
1124251346 15:28107874-28107896 CGCCCCTGGGGACAACGCGGGGG + Intergenic
1128743210 15:70097152-70097174 CCGGCCTCGGGACCCCGCGCCGG - Exonic
1129344267 15:74906716-74906738 CGGGGCTCGGGACCGCGCGCCGG - Exonic
1130224728 15:82047622-82047644 CGAGCCCCGGGACCGCCCCGCGG - Intergenic
1132842365 16:1984313-1984335 CGCGCCCCGGCCCCGCGCGTCGG - Exonic
1132879538 16:2155893-2155915 CGCGCCTCGGGACCGCGCGGTGG + Intronic
1133273747 16:4624763-4624785 CGTGCCCCGGGACCGGGAGGCGG + Intronic
1141972255 16:87492265-87492287 CGGGGCCGGGGACCGCGCGGGGG + Intergenic
1141972622 16:87493396-87493418 CGGGGCTCCGGACCCCGCGGCGG - Intergenic
1142157695 16:88540100-88540122 CTCGCCTCGGGACCTCGGGCTGG + Intergenic
1143485652 17:7252223-7252245 CGCGCTTAGGGCCCTCGCGGGGG + Intronic
1143487444 17:7262530-7262552 CGCGCCCCGGGAGCGCGGGAGGG + Intronic
1146703246 17:34980634-34980656 CGCGGCGCGGCACGGCGCGGCGG + Intronic
1147994522 17:44353657-44353679 CGCGCCCCGGGGGCCCGCGGGGG - Exonic
1152468047 17:80476699-80476721 CGCGCCGCGGGCCCGGGCCGCGG - Intronic
1156171730 18:34493949-34493971 GGCGCCTCAGGCCCGCGGGGCGG + Intronic
1158436432 18:57437924-57437946 CGCGCCTGGCGACCGCGGGGAGG + Intronic
1159947865 18:74457329-74457351 CGCGGCTCAGGCCCGCTCGGCGG + Intronic
1160613838 18:80109346-80109368 CGCGCCTCCGCCCCGCGCGGCGG - Exonic
1160690491 19:458899-458921 CGCGCCTGGGGACCACACGTGGG + Intronic
1160867238 19:1261326-1261348 CCAGCCTAGGGACCGCGGGGAGG - Intronic
1163480896 19:17555725-17555747 CGCGCCGCCGGCCCGCGCGTGGG - Exonic
1165549673 19:36573472-36573494 CGCGCCTAGGGGACGCGCAGCGG - Intronic
1167668361 19:50836043-50836065 CGCGCCTGGGTTCGGCGCGGCGG - Intronic
927168770 2:20350952-20350974 GGCGCCCCCGGCCCGCGCGGCGG - Intronic
931253309 2:60551521-60551543 CACAGCTCGGGACCGCGAGGAGG - Intronic
932790118 2:74648002-74648024 CGGGCCTGGGGGCCCCGCGGAGG + Exonic
934655912 2:96116752-96116774 CGCGCCTCGGGAGAGCGGAGGGG + Intergenic
938406326 2:131035110-131035132 GGCGCCGCGGGGCCGCGCCGGGG - Intronic
946621967 2:221571668-221571690 CGCTTCTCGGGACCGGGCTGCGG - Intronic
1169211507 20:3768327-3768349 CGCGTCTCGGGCCCGCACGGGGG - Intronic
1170026138 20:11891198-11891220 GGCGCGTCGGGCCCGCGCGGAGG + Intronic
1170890140 20:20369020-20369042 GGCGCCGCGGGGCCGCGCGGGGG + Exonic
1175439643 20:58981543-58981565 CGCGCCGCGGGACCCCGGGCGGG - Intronic
1175858195 20:62133929-62133951 AGCGCCTCGGGACAGCCAGGTGG + Intronic
1175994309 20:62805338-62805360 CCCGCCTCGGGCCCGCGCCTCGG + Intronic
1176234817 20:64049323-64049345 CCCGGCTCGGGGCTGCGCGGGGG + Exonic
1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG + Exonic
1180095057 21:45552541-45552563 CGGGTCTCGGGACCACGTGGAGG + Intergenic
1181610904 22:24011310-24011332 CGCGCAGCCGGACGGCGCGGTGG + Intronic
1184465849 22:44668661-44668683 CGCCCCTCGGGCCCGCGCGGGGG - Intronic
954223078 3:49166272-49166294 CGCGTCTTGGGTCCCCGCGGCGG - Exonic
955182276 3:56683261-56683283 CGCGCGTCGGGGCCGGGAGGGGG + Intergenic
960902213 3:122564399-122564421 TGCGCGTCGGGAGGGCGCGGGGG - Exonic
961236866 3:125375018-125375040 CGCGCGGGGGGAGCGCGCGGCGG - Intronic
968025911 3:195442610-195442632 CGCCCCTCGGGAGGGCTCGGTGG + Intronic
969791755 4:9497934-9497956 CGAGCATGGGGACGGCGCGGAGG + Intergenic
973888501 4:55346562-55346584 CGCGGCTCGGGACCGGGGCGCGG - Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
985645822 5:1084316-1084338 CACTACTCGGCACCGCGCGGTGG - Intronic
987193249 5:15500376-15500398 CGCGCCCCGGGGCCGCCCAGAGG - Exonic
1002058120 5:176610194-176610216 GCCGCCTCGGAACCGCGAGGGGG + Intergenic
1002896391 6:1382715-1382737 GGGGCCTCGGGGCTGCGCGGCGG - Intergenic
1007591173 6:43021714-43021736 CGGGGCCCGGGACCGCGAGGAGG + Exonic
1011416257 6:87122784-87122806 CGGGCCTGGGGCCGGCGCGGAGG + Intergenic
1018400135 6:163413973-163413995 CGGGCCCCGCGAGCGCGCGGTGG - Intergenic
1019527702 7:1488137-1488159 CGCGCCTCTGGGCAGCGCTGCGG - Intronic
1020309123 7:6855596-6855618 CGAGCATGGGGACGGCGCGGAGG - Intergenic
1022943185 7:35258356-35258378 CGCGCCTTGGGACCCGGAGGAGG - Intergenic
1025033022 7:55572511-55572533 GGCGTGTCGGGAGCGCGCGGCGG - Exonic
1026665427 7:72336741-72336763 GGCGCCTCCGCACAGCGCGGGGG + Intronic
1029453426 7:100655448-100655470 CGTGCCTCGGGATGGAGCGGAGG - Exonic
1029537000 7:101162955-101162977 CGCGCGGCGGGGGCGCGCGGGGG + Exonic
1031011180 7:116526221-116526243 GGGGCCTTCGGACCGCGCGGCGG + Intronic
1031401621 7:121330408-121330430 CGCGCCGCGGGAGTGCGCCGAGG - Intronic
1033361286 7:140640579-140640601 CGCGGCTCGGGGGCGGGCGGCGG + Exonic
1033369642 7:140696710-140696732 GGCGGCTGGGGACCGCGGGGCGG + Exonic
1034147421 7:148884827-148884849 CGGGCCTCGGCTCCGCGCGCGGG - Intergenic
1034964211 7:155381748-155381770 AGAGCCTCGGGAGCGGGCGGGGG - Intergenic
1038727593 8:30095366-30095388 GGCGACTCGGGCTCGCGCGGGGG - Intergenic
1039608391 8:38901113-38901135 CGGGCGCCGGGGCCGCGCGGGGG - Intergenic
1040599519 8:48870235-48870257 CGCGCCTCCCGGCCGGGCGGTGG - Intergenic
1049084176 8:140464861-140464883 AGGGCCTCGGGGCCGCGCGCGGG - Intergenic
1049406290 8:142453071-142453093 CGCGTCACGGGACCCGGCGGCGG - Intronic
1053593199 9:39533957-39533979 CGCGCCTGGGTCCCGCGCTGGGG - Intergenic
1053850933 9:42288665-42288687 CGCGCCTGGGTCCCGCGCTGGGG - Intergenic
1054573108 9:66831320-66831342 CGCGCCTGGGTCCCGCGCTGGGG + Intergenic
1054905881 9:70413459-70413481 CGCGGCGCGGCACGGCGCGGCGG + Exonic
1060811203 9:126612503-126612525 TGCGCCGCGGGGCCCCGCGGAGG - Intergenic
1061828128 9:133274656-133274678 GGCGCCTCGGGAAGGCGAGGTGG - Intronic
1062341306 9:136094978-136095000 CCGGCCTCGGGAGCCCGCGGAGG - Intronic
1062406760 9:136400327-136400349 CGCCCCTCCAGAGCGCGCGGAGG - Intergenic
1185460841 X:332197-332219 CGCCCCTCAGGACAGCGCTGTGG + Intergenic
1199794078 X:151178375-151178397 TGCACCTCGGGACCGCACCGCGG - Intronic