ID: 1132879629

View in Genome Browser
Species Human (GRCh38)
Location 16:2156238-2156260
Sequence AAAAAGCGACCCGGGCCGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 21}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132879629_1132879634 13 Left 1132879629 16:2156238-2156260 CCACGCGGCCCGGGTCGCTTTTT 0: 1
1: 0
2: 1
3: 5
4: 21
Right 1132879634 16:2156274-2156296 GCCCTGTACATTGTAGGATGTGG 0: 1
1: 0
2: 5
3: 19
4: 110
1132879629_1132879637 27 Left 1132879629 16:2156238-2156260 CCACGCGGCCCGGGTCGCTTTTT 0: 1
1: 0
2: 1
3: 5
4: 21
Right 1132879637 16:2156288-2156310 AGGATGTGGAACAGCTTGCCTGG 0: 1
1: 0
2: 0
3: 25
4: 396
1132879629_1132879633 7 Left 1132879629 16:2156238-2156260 CCACGCGGCCCGGGTCGCTTTTT 0: 1
1: 0
2: 1
3: 5
4: 21
Right 1132879633 16:2156268-2156290 GGAGCTGCCCTGTACATTGTAGG 0: 1
1: 7
2: 80
3: 374
4: 1127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132879629 Original CRISPR AAAAAGCGACCCGGGCCGCG TGG (reversed) Intronic
1070350984 10:75592076-75592098 AAAAAGCAACCCAGGCAGAGGGG + Intronic
1077100302 11:819557-819579 AAGAAGCTACGCGGGCGGCGCGG - Exonic
1084116367 11:67045106-67045128 AAAAAGGGACCAGGGCCACGGGG + Intronic
1084555653 11:69874394-69874416 AGAAAGCCATCAGGGCCGCGTGG - Intergenic
1105591436 13:21796240-21796262 AAAAACCGACCCGGGCAGGAGGG - Intergenic
1108464586 13:50702078-50702100 AAAAAGTGACCAGGGCTGGGTGG + Intronic
1110142816 13:72151774-72151796 AAAAAGCAACCCTGGCAGGGAGG + Intergenic
1120846105 14:89126348-89126370 AAAAAGCTAACTGGGCCTCGTGG + Intronic
1122581968 14:102777086-102777108 AAAAAGCCACGCAGGCCGCGTGG - Intergenic
1122904438 14:104795419-104795441 ACAAAGCGGCCCGGCCCGCGGGG + Intronic
1124600490 15:31129327-31129349 AGTAAGGGACCCGGGCCGCCTGG + Intronic
1132879629 16:2156238-2156260 AAAAAGCGACCCGGGCCGCGTGG - Intronic
1136613861 16:31383513-31383535 AGCAAGGGACCCGGGCCGTGTGG + Intergenic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1148852460 17:50561570-50561592 AGAAAAGGACCCGGGCAGCGCGG + Exonic
1159931486 18:74316448-74316470 AAAAATCCTCCCGGGGCGCGGGG - Intronic
1168112328 19:54200454-54200476 AAAATGCTACCCGGGCGTCGTGG + Intergenic
929159956 2:38822036-38822058 ATAAAGCCACCTGGGCCGGGGGG - Intronic
1175115112 20:56676676-56676698 GAAAAGGGACCCAGGCAGCGTGG + Intergenic
953325997 3:42013294-42013316 AATCAGCGCCCCGGGCCGCGGGG + Intergenic
954575071 3:51671394-51671416 AAAGAGCGGCCCGGGCCGCGGGG - Exonic
958858348 3:99414834-99414856 AAAAAACTACCCGGGCCTGGGGG + Intergenic
961689348 3:128657415-128657437 AAAAAACGAGCCGGGCGCCGTGG + Intronic
987920870 5:24278647-24278669 AAAAAATGACCCGGGCCGGGCGG - Intergenic
1010980265 6:82363753-82363775 AAAAACCAACCCGGGGGGCGGGG - Exonic
1013274132 6:108567893-108567915 AAAAAGCTAGCCGGGCATCGTGG + Intronic
1020011600 7:4808618-4808640 AAGGAGAGACCAGGGCCGCGGGG - Intronic
1029492187 7:100877133-100877155 AAAAAGCCAGCCGGGCCCAGTGG + Intronic