ID: 1132882839

View in Genome Browser
Species Human (GRCh38)
Location 16:2170069-2170091
Sequence GAAGCTCAGCCGAGGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132882834_1132882839 -5 Left 1132882834 16:2170051-2170073 CCTCACTCCTGCCCTCGGGAAGC 0: 1
1: 0
2: 5
3: 26
4: 287
Right 1132882839 16:2170069-2170091 GAAGCTCAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 106
1132882833_1132882839 -4 Left 1132882833 16:2170050-2170072 CCCTCACTCCTGCCCTCGGGAAG 0: 1
1: 0
2: 1
3: 16
4: 242
Right 1132882839 16:2170069-2170091 GAAGCTCAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 106
1132882830_1132882839 3 Left 1132882830 16:2170043-2170065 CCTGTGGCCCTCACTCCTGCCCT 0: 1
1: 1
2: 11
3: 63
4: 636
Right 1132882839 16:2170069-2170091 GAAGCTCAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 106
1132882829_1132882839 16 Left 1132882829 16:2170030-2170052 CCAGAGGCAGGCACCTGTGGCCC 0: 1
1: 0
2: 3
3: 43
4: 379
Right 1132882839 16:2170069-2170091 GAAGCTCAGCCGAGGTTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132882839 Original CRISPR GAAGCTCAGCCGAGGTTCTC TGG Intronic
900281502 1:1872555-1872577 GAAGCTCAGCAGAGGTCCTGCGG - Intronic
900535105 1:3173126-3173148 GAATCACAGCCGAGGCTCCCTGG - Intronic
903260712 1:22130286-22130308 GAAGATCAGCCAAGGATCACTGG - Intronic
905199644 1:36307138-36307160 GGAGCTCAGCCGCGCTTGTCCGG + Intronic
906668890 1:47640728-47640750 GAATCTCAGCCAAGGCTCTCTGG - Intergenic
909434991 1:75630792-75630814 GAAGCTCACCTGAGGTTCAGAGG + Intergenic
910257404 1:85261341-85261363 AAAGCTCAGGTGAGTTTCTCTGG - Intergenic
916268693 1:162918053-162918075 GAAGCACAGGTGAGGCTCTCAGG + Intergenic
921378240 1:214496370-214496392 GGAGTTCAGCCAAGGTCCTCAGG + Intronic
921446706 1:215255348-215255370 CAACCTCAGCCGAACTTCTCAGG + Intergenic
921735763 1:218626404-218626426 GAATCTGAGCCCAGGCTCTCAGG - Intergenic
923113537 1:230913207-230913229 GAAGCTCCACTGAGGTTCTGTGG + Intronic
1065232003 10:23607859-23607881 AAAGCTCAGCCTAGGATATCCGG - Intergenic
1066308359 10:34169943-34169965 GAAGCTGAGCCTTGCTTCTCTGG - Intronic
1067181127 10:43986645-43986667 GAAGCTCAGCTGAGGCTCAAAGG - Intergenic
1068485594 10:57654531-57654553 GAAGTTCAGGTGAGCTTCTCTGG - Intergenic
1069169863 10:65213255-65213277 GAAGAACAGCCAAGCTTCTCTGG - Intergenic
1069894846 10:71673944-71673966 AGAGCTCATCCCAGGTTCTCAGG - Intronic
1078519126 11:12049395-12049417 GCAGCTTGGCCGAGGTGCTCAGG + Intergenic
1079127751 11:17730972-17730994 GCAGCTCAGCCCAGGTTACCAGG + Intergenic
1082985120 11:59162001-59162023 GAAGCTCAGGTGAGCTTCCCTGG - Intergenic
1088231286 11:107676046-107676068 GTAGATCTGCTGAGGTTCTCAGG - Intergenic
1095236143 12:39798275-39798297 GAAGCTGAGCTGAGGCTCTGTGG - Intronic
1097823833 12:64154725-64154747 GAAGCTCAGGGGAGGATTTCTGG + Exonic
1099182288 12:79482625-79482647 GAAGCACAGCCCAGGTTCTCAGG + Intergenic
1101490025 12:105201615-105201637 GGAGCTCATCCAAGGTTCCCAGG + Intronic
1101998136 12:109539756-109539778 GAAGCCCAGCAGAGGATCCCCGG - Intergenic
1103967486 12:124649159-124649181 GAGGCTCAGGCGAGCTTCTCTGG + Intergenic
1113789317 13:113019187-113019209 GCAGCTGAGCCGCAGTTCTCAGG + Intronic
1114576932 14:23723973-23723995 GAAGGTCAGTGGAGGTTCTCAGG + Intergenic
1118239363 14:64041559-64041581 GTAGCTCAGGCCAGGTGCTCTGG + Intronic
1118710160 14:68512241-68512263 GAACATCAGCAGAGATTCTCTGG + Intronic
1121700929 14:95953514-95953536 CAAGCTAAGCCCAGGTACTCAGG + Intergenic
1127217564 15:56840149-56840171 GAAGCTCAGGAGAGGGTTTCGGG - Intronic
1128283214 15:66414573-66414595 GAAGCTCAGGGGAGCTTCCCTGG - Intronic
1130678204 15:85973138-85973160 GAAGCTCAGATGAGATTCACAGG - Intergenic
1132882839 16:2170069-2170091 GAAGCTCAGCCGAGGTTCTCTGG + Intronic
1133031640 16:3013940-3013962 GTAGCCCAGCCGAGGTCCGCGGG - Exonic
1139757156 16:69153218-69153240 GAAGCCCAGATGAGGTTCACTGG - Intronic
1140766406 16:78163474-78163496 AAAGCTCAGCCCATCTTCTCAGG + Intronic
1141099278 16:81185234-81185256 GCAGCTCAGCAGAGGTGTTCAGG - Intergenic
1142359819 16:89620737-89620759 GTGGCTGAGCCGAGGTACTCGGG + Exonic
1143350481 17:6284535-6284557 GAGGCTCAGGCGAGGTGCTTTGG + Intergenic
1146595216 17:34162471-34162493 GTAACTCAGCCAAGATTCTCTGG - Intronic
1147165251 17:38589691-38589713 GAAGCTGGGCAGAGGCTCTCCGG - Intronic
1147386726 17:40086924-40086946 CAGGCTCATCTGAGGTTCTCTGG + Intronic
1147793218 17:43025772-43025794 GGAGCTTAGCAGAGATTCTCCGG + Intronic
1147924143 17:43936256-43936278 GGAGCTCAGCAGAGTGTCTCTGG - Intergenic
1151371007 17:73645919-73645941 GAAGCTCAGCTGGGGTTAACAGG + Intergenic
1153328719 18:3849619-3849641 GGAGCTCTGCCCTGGTTCTCTGG - Intronic
1153957917 18:10113746-10113768 GGAGCTCTCCCGAGGTTCTTGGG + Intergenic
1154213074 18:12396519-12396541 GAGGCTCAGCCGGGGACCTCAGG + Intergenic
1155307469 18:24492652-24492674 CACGCTCAGCCGAGCTTCTCAGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1166417571 19:42607189-42607211 GCAGCCCAGCCAAGGTCCTCAGG - Intronic
1168011714 19:53538448-53538470 GACGCACCGCCGAGGTTCACAGG - Intronic
1168013715 19:53554845-53554867 GACGCACTGCCGAGGTTCACAGG - Intronic
1168279581 19:55297588-55297610 GGAGAGCAGCCGAGGTGCTCTGG + Intronic
925329839 2:3050023-3050045 GAAGCTTAGCCTCGGATCTCCGG + Intergenic
928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG + Intergenic
929116729 2:38451000-38451022 GAAGCCCAGAAGATGTTCTCTGG - Intergenic
932429856 2:71667728-71667750 GAAGCTCAGCCTCGTTTCGCAGG - Intronic
934606603 2:95699852-95699874 GAGGCTCAGCTGAGGAGCTCAGG + Intergenic
935679836 2:105626331-105626353 GCAGCTGAGCAGAGGTTCACGGG + Intergenic
936081299 2:109434392-109434414 GAAGGTCTGCGGAAGTTCTCAGG - Intronic
936540007 2:113341980-113342002 GAGGCTCAGCTGAGGAGCTCAGG + Intergenic
938369433 2:130760168-130760190 GGAGCCCAGCCCAGGTTCTGTGG + Intronic
938676509 2:133641083-133641105 GAAGCTCTTTGGAGGTTCTCTGG + Intergenic
941250163 2:163151549-163151571 GAAGCTCTGCCCAATTTCTCAGG + Intergenic
945198482 2:207258898-207258920 GAGGCTCAGCTGAGTATCTCTGG - Intergenic
946479501 2:220040551-220040573 GATGATGAGCCCAGGTTCTCCGG - Intergenic
949026196 2:241767589-241767611 GAGGCTCAGCCGGGGGTCTCGGG + Intronic
949044486 2:241866253-241866275 GCAGCTCAGCCCGGGTTCTTCGG - Intergenic
1170749763 20:19135224-19135246 AAAGCTCAGATGAGCTTCTCAGG - Intergenic
1171481916 20:25460787-25460809 GAGGCTCAGCCGAGCCTCACAGG + Intronic
1175904585 20:62373398-62373420 CAAGCTCAGCCAAGGGTCTTAGG + Intergenic
1176380407 21:6109981-6110003 GAAGCTCATCCTCGTTTCTCCGG + Intergenic
1179743066 21:43428259-43428281 GAAGCTCATCCTCGTTTCTCCGG - Intergenic
1180597723 22:16989726-16989748 GAGGCTCAGCAGAGCTTCCCAGG - Intronic
1182432134 22:30305599-30305621 GCAGCTCAGAGGAGGTTCTCAGG + Intronic
1183094990 22:35546668-35546690 GAACATCAGACGAGGTTCTAAGG - Intronic
1183231760 22:36586721-36586743 ACAGCAAAGCCGAGGTTCTCAGG - Intronic
1185247432 22:49780608-49780630 GCAGCTCCCCCGAGGTTCTGGGG - Intronic
950765182 3:15268151-15268173 CAAGCTCAGCCGAGAGTCTCAGG + Intronic
952130363 3:30354810-30354832 GGAGCTCAGCCCAGGCTCCCAGG + Intergenic
959317929 3:104832942-104832964 TCAGCTCAGCCGAGCTTCTCTGG - Intergenic
962314912 3:134353296-134353318 GCAGCCCAGCAGAGGTACTCTGG + Intergenic
966431445 3:179834888-179834910 CAAGTTCAGACGAGGTTCTTAGG + Intronic
967766970 3:193291712-193291734 GAAGCTCAGTTGAGCTTCCCTGG + Intronic
968977109 4:3827763-3827785 GAAGGTCAGCCAGGGTTGTCTGG + Intergenic
969487262 4:7479256-7479278 GAGGCTCAGCTGAGCTTCCCTGG - Intronic
969620761 4:8277654-8277676 GAAGCAGAGCCGAGGTCCACAGG + Intronic
969724530 4:8911408-8911430 GATGCCCAGCCGGGGTTCCCAGG - Intergenic
971348569 4:25835392-25835414 GGAGCTCAGCAGAGGCTTTCAGG - Intronic
988014794 5:25540840-25540862 GAATCTCAGCTGAAGTTCTATGG + Intergenic
999598951 5:153238927-153238949 AAAGCTCAGGAGAGCTTCTCTGG - Intergenic
1002079413 5:176728534-176728556 GAGGCTCAGATGAGGTTCTGGGG - Intergenic
1003361219 6:5427514-5427536 GAAACTGAGCAGAGGATCTCAGG + Intronic
1005707661 6:28471268-28471290 GAAGATCTGCAGAGGTTCTTTGG + Intergenic
1010293442 6:74167221-74167243 GGAGCTGAGCCAAGGTTCTATGG + Intergenic
1014206087 6:118656871-118656893 AAAGCTCAGCCGAGATACTTGGG + Intronic
1016430154 6:143974822-143974844 GTAACTCAGTAGAGGTTCTCTGG + Intronic
1016882055 6:148921176-148921198 GAAGCTCAGCCCAGGGACTCTGG - Intronic
1017871369 6:158489227-158489249 GACCCTCAGCCCAGGTTCTGTGG + Intronic
1017969531 6:159299645-159299667 GAAGCTCAGCAGGGATGCTCAGG + Intergenic
1018357893 6:163037195-163037217 GAAGCCCGTCCGAGGGTCTCAGG + Intronic
1019301473 7:306157-306179 GAATCCCAGCCCAGGGTCTCAGG + Intergenic
1020092198 7:5348080-5348102 GGAGCCCAGCCCAGGCTCTCAGG + Intronic
1023306669 7:38837388-38837410 GAGGCTCAGGTGAGCTTCTCTGG + Intronic
1029010016 7:97249999-97250021 GAAGCTCAGGTGAGTTTCTCCGG - Intergenic
1034458845 7:151187022-151187044 GAAGCCCAGCAGAGGGTCTGAGG - Exonic
1036463855 8:8978218-8978240 GAGGCTCAGGTGAGCTTCTCTGG + Intergenic
1037399962 8:18485835-18485857 GAAGCTCAGGCGAGGAGCTAAGG - Intergenic
1039812036 8:41057763-41057785 GAGGCTCAAGCGAGCTTCTCAGG - Intergenic
1047169709 8:122480040-122480062 CAAGCTCATAGGAGGTTCTCAGG + Intergenic
1055014856 9:71605313-71605335 AAAGCTGGGCCTAGGTTCTCTGG - Intergenic
1056816681 9:89806794-89806816 GAAGTTCAGCTGAGCTTCCCTGG + Intergenic
1058478616 9:105367766-105367788 GAAGCTCAGCAGAGGGGCTGGGG - Intronic
1189333167 X:40155214-40155236 AAAGGTCAGCCAAGGTCCTCCGG + Intronic
1193258741 X:79380289-79380311 GAGTCTCAGCAGAGTTTCTCAGG + Intergenic