ID: 1132883386

View in Genome Browser
Species Human (GRCh38)
Location 16:2172061-2172083
Sequence GAGGCACGCAACATGGGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132883386_1132883400 30 Left 1132883386 16:2172061-2172083 CCCGTTCCCATGTTGCGTGCCTC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1132883400 16:2172114-2172136 TTAGAGGCTCATGCCCACCCGGG 0: 1
1: 0
2: 1
3: 10
4: 146
1132883386_1132883399 29 Left 1132883386 16:2172061-2172083 CCCGTTCCCATGTTGCGTGCCTC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1132883399 16:2172113-2172135 ATTAGAGGCTCATGCCCACCCGG 0: 1
1: 0
2: 1
3: 7
4: 76
1132883386_1132883391 -9 Left 1132883386 16:2172061-2172083 CCCGTTCCCATGTTGCGTGCCTC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1132883391 16:2172075-2172097 GCGTGCCTCAGAGGCGCAGATGG 0: 1
1: 0
2: 0
3: 7
4: 88
1132883386_1132883394 14 Left 1132883386 16:2172061-2172083 CCCGTTCCCATGTTGCGTGCCTC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1132883394 16:2172098-2172120 ACAGATCTGGCCCCCATTAGAGG 0: 1
1: 0
2: 1
3: 3
4: 57
1132883386_1132883393 1 Left 1132883386 16:2172061-2172083 CCCGTTCCCATGTTGCGTGCCTC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1132883393 16:2172085-2172107 GAGGCGCAGATGGACAGATCTGG 0: 1
1: 0
2: 1
3: 36
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132883386 Original CRISPR GAGGCACGCAACATGGGAAC GGG (reversed) Intronic
904775347 1:32902616-32902638 GAGGCACTTACTATGGGAACTGG + Intergenic
905924607 1:41740732-41740754 CAGGCAAGCAAAATGGGAACAGG + Intronic
906793380 1:48677936-48677958 GAGGGATGCAGAATGGGAACTGG + Intronic
911595926 1:99799026-99799048 GAAGCACAAAACATGGGAAGGGG - Intergenic
917972661 1:180218939-180218961 GAGGCAGGAAGGATGGGAACGGG - Intergenic
918026053 1:180747811-180747833 GAGGCATGCTTCATGGGAATTGG - Intronic
918280027 1:182995290-182995312 GAGCCACAAAACAGGGGAACAGG - Intergenic
1065256697 10:23876651-23876673 AAGGCATGCAACATGGACACTGG - Intronic
1072533907 10:96345151-96345173 CAGGCAAGCAATATGGGAAGAGG + Exonic
1072818422 10:98532197-98532219 GAGACTCCCAACATAGGAACAGG - Intronic
1074709865 10:116168439-116168461 GGGCCACCCAGCATGGGAACTGG - Intronic
1077974394 11:7232553-7232575 GAAGCTCGCAACATGGCACCTGG - Intergenic
1089369016 11:117941020-117941042 GACGCGCAGAACATGGGAACTGG + Intergenic
1091602528 12:1926534-1926556 GAGGCTAGAAAGATGGGAACAGG + Intergenic
1095419055 12:42006302-42006324 GTGGCAGGGAAGATGGGAACTGG - Intergenic
1095690299 12:45080962-45080984 GAAGCACACAACATGGCACCTGG + Intergenic
1096711696 12:53461996-53462018 GATGCACCCAACCTGGAAACTGG + Intronic
1097269567 12:57765780-57765802 GAGGCCCGAATCCTGGGAACTGG - Intronic
1097915090 12:65012869-65012891 GAAGCACTCAACTTGGCAACAGG + Intergenic
1102998326 12:117366316-117366338 GACCTACGCACCATGGGAACAGG - Intronic
1115509047 14:34121896-34121918 GATCCAGGCACCATGGGAACTGG + Intronic
1121714132 14:96060659-96060681 CAGGCATGCAGCATGGGAATTGG - Intronic
1124654698 15:31498903-31498925 TAGGCATGCAACATGGGGAGAGG - Intronic
1126134510 15:45377886-45377908 GAGGCAAGCAAAGTGGGAATCGG - Intronic
1128451031 15:67806003-67806025 GAGGCAGGCCACAGGGCAACAGG + Intronic
1131897564 15:97050322-97050344 GAGGCAAGCAAGATGAGAAGAGG - Intergenic
1132883386 16:2172061-2172083 GAGGCACGCAACATGGGAACGGG - Intronic
1133292083 16:4728921-4728943 GAGGGCCACAACTTGGGAACCGG + Intronic
1135833047 16:25795715-25795737 GTGGCAGGCAGCAGGGGAACAGG + Intronic
1141075124 16:80999021-80999043 GAGGACCGGAACAAGGGAACAGG + Intronic
1143846851 17:9778749-9778771 GAGGTACCCAGCATGGGAGCTGG + Intronic
1145847844 17:28058556-28058578 CAGGCACCCATCATGGGACCAGG - Intronic
1147045881 17:37751804-37751826 GAGGCACTTAACATGGGATCTGG - Intergenic
1154055391 18:11008481-11008503 CAGGCAAGCAATCTGGGAACTGG - Intronic
1158470088 18:57728504-57728526 GAGGCAGGGCACATGGGAAATGG + Intronic
1158891062 18:61872093-61872115 GTGGAAGGCAAAATGGGAACAGG + Intronic
1158988098 18:62839620-62839642 GAGGCACGAAAATTGCGAACTGG + Intronic
1161296945 19:3524938-3524960 GAGCCCCGCAACCTGGGAATGGG - Intronic
1161616714 19:5274837-5274859 GAGGCACCCAGCATGGGGGCGGG + Intronic
1164227248 19:23256626-23256648 GAGTCACATAACATGGGTACAGG + Intergenic
1164619205 19:29683921-29683943 GAGGCAGGTACCATGGGGACGGG - Intergenic
1166918465 19:46212284-46212306 GAGGCAGGCGACAAGGGAAGAGG - Intergenic
925970174 2:9100965-9100987 GAGGCACGCAGCCTGGGGAATGG + Intergenic
927475718 2:23412807-23412829 GAAGCTCGCAAAATGGGAAATGG + Intronic
929948563 2:46388968-46388990 CAGGCCAGCATCATGGGAACTGG + Intergenic
929999242 2:46849793-46849815 GAGGCTTGCAGCAAGGGAACAGG - Intronic
939160452 2:138582741-138582763 GAGGGAAGAAACATGGGAAAAGG - Intergenic
944902015 2:204224849-204224871 GAGGTAGGCAACATGGGTAGAGG - Intergenic
946388522 2:219401028-219401050 GAGACAGGCCACATGGGAATGGG + Intergenic
946632152 2:221681930-221681952 GAGGCAGGGATCATGGGAATGGG - Intergenic
1178721450 21:35014261-35014283 ATGGCACGCAACATGAAAACTGG - Intronic
1179892810 21:44345490-44345512 GAGGCCAGCAACATGGGCAGGGG - Intergenic
1180245827 21:46546662-46546684 AAGGGAGGCAACATGGGAAAGGG - Intronic
1181660277 22:24341819-24341841 CTGGCTCACAACATGGGAACTGG - Intronic
1182028482 22:27138597-27138619 AAAGCATGGAACATGGGAACTGG - Intergenic
1182935644 22:34219287-34219309 GAGGCAGGTACCATGGAAACAGG - Intergenic
1183591292 22:38780670-38780692 GAGGCAGGGAACATGGGCAGGGG + Intronic
953210931 3:40874510-40874532 GGGACACACAACGTGGGAACCGG + Intergenic
960109361 3:113830231-113830253 GAGGCAGGCAACATGGTGCCTGG - Intronic
961552705 3:127678187-127678209 GAGGCAGGCAGCAAGGGAAGAGG - Intronic
961891627 3:130135150-130135172 CAGGCACGCAAGATGGGTACAGG + Intergenic
963488059 3:145961944-145961966 AAGGCTGGGAACATGGGAACTGG + Intergenic
964858058 3:161168961-161168983 CAGGCAGGCCTCATGGGAACTGG + Intronic
967096306 3:186180192-186180214 AAGGCAGGGAACATGGGTACGGG + Intronic
968528011 4:1074343-1074365 GAGGCAAGGAGCCTGGGAACAGG - Intronic
969593626 4:8135770-8135792 GAGGCCGGCAACATGGGCAAGGG + Intronic
970021101 4:11569370-11569392 GAGACAAGCAGCATGGGGACTGG - Intergenic
970275478 4:14395149-14395171 GAGGCTGGCAAGATGGAAACGGG + Intergenic
977186433 4:93943666-93943688 GAGACAGGCAACATGGGAGAGGG - Intergenic
982207260 4:153006045-153006067 GAGGCAGGCAGCATGGAAACTGG + Intergenic
983919863 4:173334004-173334026 GAGGCTCGCGACGTGGGAGCTGG - Intronic
987014403 5:13802625-13802647 GAGGAAAGCAACATTGGAAGGGG + Intronic
987773482 5:22335864-22335886 GAGGCAAGCCACTTTGGAACTGG + Intronic
989196873 5:38724816-38724838 GAGAGACGCCACTTGGGAACAGG + Intergenic
991577801 5:68122790-68122812 GAAGCAGGCACCCTGGGAACTGG + Intergenic
994134705 5:96272453-96272475 GCAGCAAGCAACATGGGAACTGG + Intergenic
998037200 5:138927139-138927161 TAGGCACCCAGGATGGGAACAGG - Intronic
1003735901 6:8877309-8877331 GAGGCAAGCAGCTTGGGAAGGGG + Intergenic
1006401624 6:33821149-33821171 GAGGCAGGAAACAGAGGAACTGG + Intergenic
1010029736 6:71260443-71260465 GAGACATGGAACATGGGCACAGG + Intergenic
1011820287 6:91245243-91245265 GAGGCAAGCAACATGGCCTCTGG - Intergenic
1021501713 7:21339072-21339094 GCGGCACTCAACATGGGAAGTGG - Intergenic
1023277083 7:38531316-38531338 CAGGCACGCACCATGGCACCAGG + Intronic
1024675745 7:51636570-51636592 GAGGGAAGCTACATGGGAAGGGG + Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1031644223 7:124203504-124203526 GAGGTTAGCAGCATGGGAACAGG + Intergenic
1034757713 7:153638985-153639007 GAGGCCCGCACCATGGGCTCCGG + Intergenic
1036767760 8:11559714-11559736 GAGGCATGGGGCATGGGAACCGG - Intronic
1037880418 8:22570955-22570977 GAGGGACGCATCACGGGCACGGG + Exonic
1038414111 8:27380734-27380756 GAGGCCTGCAGCCTGGGAACTGG + Intronic
1039676315 8:39671937-39671959 GAGGAACACAACATGGGATGGGG + Intronic
1042197254 8:66241660-66241682 GTGGAAGGCAAAATGGGAACAGG - Intergenic
1043708337 8:83380702-83380724 GAGGCCTGAAACATGGGCACAGG - Intergenic
1048029250 8:130615587-130615609 GAGACATGAAACATGAGAACTGG + Intergenic
1053151810 9:35748670-35748692 GATCCAGGGAACATGGGAACCGG - Exonic
1056565877 9:87771780-87771802 GGGGCAAGCAGCATGGGACCTGG + Intergenic
1056578567 9:87873730-87873752 GTGGCACGGGACATGGGGACAGG - Intergenic
1059401964 9:114076307-114076329 CAGGGACCCAACCTGGGAACTGG - Intronic
1061588420 9:131583254-131583276 GAGGCACGTAACAGGAGAAGAGG - Intronic
1187657531 X:21494691-21494713 GAGACATGCAACATATGAACAGG - Intronic
1188466201 X:30484286-30484308 GAGGCAGGCAACAGCTGAACAGG + Intergenic
1188643574 X:32536357-32536379 GTGGCAGGTAACATGGGAATGGG + Intronic
1189687888 X:43585066-43585088 GATGAAAGCAACATGGGCACTGG - Intergenic
1201512394 Y:14779594-14779616 GACTCACGCAATCTGGGAACTGG - Intronic
1201972948 Y:19816319-19816341 GAGGAACGTAAGATGGGAACTGG + Intergenic