ID: 1132883547

View in Genome Browser
Species Human (GRCh38)
Location 16:2172657-2172679
Sequence GCTGAGAGCTGCCCGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132883543_1132883547 -8 Left 1132883543 16:2172642-2172664 CCCTCCACAGGCTCCGCTGAGAG 0: 1
1: 0
2: 1
3: 17
4: 183
Right 1132883547 16:2172657-2172679 GCTGAGAGCTGCCCGCTTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 235
1132883544_1132883547 -9 Left 1132883544 16:2172643-2172665 CCTCCACAGGCTCCGCTGAGAGC 0: 1
1: 0
2: 2
3: 20
4: 198
Right 1132883547 16:2172657-2172679 GCTGAGAGCTGCCCGCTTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 235
1132883541_1132883547 8 Left 1132883541 16:2172626-2172648 CCGGGGTGGGCGCAGGCCCTCCA 0: 1
1: 1
2: 4
3: 17
4: 273
Right 1132883547 16:2172657-2172679 GCTGAGAGCTGCCCGCTTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132883547 Original CRISPR GCTGAGAGCTGCCCGCTTGC TGG Intronic
900113354 1:1018856-1018878 GCTGAGAGGTGACAGCGTGCTGG - Intergenic
901934192 1:12616743-12616765 GCTGGGAGCCGCCTGCTAGCTGG - Intronic
903280637 1:22248050-22248072 GCTGAGAGCTGCTCTATTTCGGG + Intergenic
904257813 1:29267512-29267534 GCAGAGAGCTGGGGGCTTGCTGG + Intronic
905863820 1:41366292-41366314 GCTGGCAGCTGCCCGCCTCCTGG + Intronic
906711803 1:47935993-47936015 GCTAAGAGCTGCTGCCTTGCAGG + Intronic
907561055 1:55387963-55387985 GTAGACAGCTGCCCTCTTGCTGG + Intergenic
909820570 1:80054012-80054034 GCTGAGAGGTGACAGCGTGCTGG - Intergenic
911087132 1:93988422-93988444 GCTGACAGCAGCCAGCCTGCAGG - Intergenic
912013695 1:105005261-105005283 GCTGAGAGCTGGACACTTACTGG - Intergenic
912554894 1:110508709-110508731 GCTGAGGCCTGCCAGCCTGCCGG - Intergenic
912691809 1:111810314-111810336 CATGAGAGCTGCCCTCTTCCAGG - Intronic
913592402 1:120341716-120341738 GCTGAGGACTGCCTGTTTGCAGG - Intergenic
913650957 1:120913429-120913451 GCTGAGGACTGCCTGTTTGCAGG + Intergenic
914049466 1:144119508-144119530 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
914129718 1:144845932-144845954 GCTCCTTGCTGCCCGCTTGCTGG + Intergenic
914170157 1:145215638-145215660 GCTGAGGACTGCCTGTTTGCAGG - Intergenic
914525273 1:148459601-148459623 GCTGAGGACTGCCTGTTTGCAGG - Intergenic
914598401 1:149176229-149176251 GCTGAGGACTGCCTGTTTGCAGG + Intergenic
914641130 1:149607533-149607555 GCTGAGGACTGCCTGTTTGCAGG + Intergenic
915861248 1:159447041-159447063 GCTGAGATCTGCCTCCTTTCAGG + Intergenic
916171999 1:162008485-162008507 GCTGAGAGCTGTCTGTGTGCCGG - Intronic
916461298 1:165027623-165027645 CCAGAGAGCTGTCAGCTTGCAGG + Intergenic
916648778 1:166816216-166816238 GCTGAGACCTGAACACTTGCTGG - Intergenic
918789883 1:188812903-188812925 GCTGAGAGGTGACAGCATGCTGG + Intergenic
919513405 1:198493969-198493991 GCTGAGAGCTGGACTCTTGTTGG - Intergenic
922485344 1:225969585-225969607 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
923328199 1:232898956-232898978 GCTGAGGGCTGCACACTTGTCGG + Intergenic
1062901019 10:1147274-1147296 CCTGAGAGGTGCCCTCCTGCAGG - Intergenic
1064640860 10:17414632-17414654 GCAGACAGCTGCCTGCTGGCTGG + Intronic
1069992891 10:72325771-72325793 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
1072662554 10:97371620-97371642 GCTGAGATCTGCAGGGTTGCTGG + Intronic
1072753360 10:97999945-97999967 GCTGAGAGCTGCCCAGATGATGG + Intronic
1073609145 10:104926104-104926126 GCTGTGAGCTGCCTGCTTTCAGG + Intronic
1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG + Intergenic
1077309694 11:1882871-1882893 GCTCAAAGCTGCCAGCTGGCTGG + Intronic
1078146396 11:8724442-8724464 GCTGTGTGCTGCCTGCTTGCTGG - Intronic
1078891248 11:15560739-15560761 GTTGAGAGGTGGCAGCTTGCTGG + Intergenic
1079249052 11:18773843-18773865 GCTGGGGACTGCCCCCTTGCTGG + Intronic
1081670038 11:44937640-44937662 GCTGAGAGCTGCCCTCACCCTGG - Intronic
1083912412 11:65717974-65717996 GCTGATAGCTGGCCGCTGGGAGG - Exonic
1084406155 11:68974785-68974807 GCTGAGAGGTGACAGCGTGCTGG - Intergenic
1084619185 11:70257088-70257110 ACTGGGAGCTGCCCCCTAGCAGG - Intergenic
1085334187 11:75678646-75678668 GCTGAGAGCTGGACACTTGTCGG - Intergenic
1086397830 11:86434066-86434088 GCTGAGAGGTGACAGCGTGCTGG - Intergenic
1089800156 11:121021455-121021477 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
1090782642 11:130021488-130021510 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
1091388901 12:113110-113132 GCTAAGAGCTGCCAGCATGGAGG - Intronic
1093764932 12:22952335-22952357 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1094427354 12:30328706-30328728 GCTGAGAGCTGAACACTTGATGG + Intergenic
1096355489 12:50937766-50937788 GCTGAGGGCTGCATGCTTGATGG - Intergenic
1098051253 12:66455690-66455712 CCTGAGAGCTGGCCTCTAGCTGG - Intronic
1098671393 12:73235100-73235122 GCTGAGAGCTGGACACTTGTTGG - Intergenic
1099683377 12:85856707-85856729 GCTGAGAGCTGGGCACTTGTTGG - Intergenic
1102298292 12:111753876-111753898 GCTGAGAGCTGCCCACCTCATGG + Exonic
1103478954 12:121238613-121238635 GCTGGGTGCTGCCTGATTGCTGG + Exonic
1106537432 13:30659896-30659918 GCTGAGAGCTGAACACTTGAGGG - Intronic
1109364548 13:61338982-61339004 GCTGAGAGGTGACAGCCTGCTGG + Intergenic
1111243769 13:85508555-85508577 GCTGAGAGCTGGACACTTGTTGG + Intergenic
1111337198 13:86839800-86839822 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1118901119 14:69986777-69986799 GCTGAAAGCTGCCTTTTTGCAGG - Intronic
1121834152 14:97077075-97077097 GCAGAGAGCTGCCCCTTTGCAGG + Intergenic
1123419342 15:20118744-20118766 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
1123528564 15:21125286-21125308 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
1123737919 15:23202967-23202989 GTTGAAAGCTGCCCGCATGATGG - Intergenic
1124014358 15:25863187-25863209 GGTGCGAGCTCCCCGCCTGCGGG + Exonic
1124289128 15:28431636-28431658 GTTGAAAGCTGCCCGCATGATGG - Intergenic
1124294094 15:28485674-28485696 GTTGAAAGCTGCCCGCATGATGG + Intergenic
1125134814 15:36329015-36329037 GCTGAGGGCAACCCGCTTTCAGG - Intergenic
1125885624 15:43227093-43227115 GTTGAGAGGTGACAGCTTGCTGG - Intergenic
1126156841 15:45573936-45573958 GCTGAGAGCTGCACACTCGATGG - Intergenic
1127973376 15:63979480-63979502 GTTGAAAGCTGCCCAGTTGCAGG - Intronic
1128813388 15:70587710-70587732 GCTGAGAGGTGACAGCGTGCTGG - Intergenic
1131376690 15:91930238-91930260 GCTGAGAGCTGACCTGTGGCAGG - Intronic
1131868936 15:96741813-96741835 GCTGAGTGCTGCCCCTTCGCTGG + Intergenic
1132618754 16:854706-854728 GCTGACATGTGCCCCCTTGCAGG - Exonic
1132883547 16:2172657-2172679 GCTGAGAGCTGCCCGCTTGCTGG + Intronic
1136630726 16:31488004-31488026 GCGTTCAGCTGCCCGCTTGCGGG - Intronic
1137588690 16:49680232-49680254 GCTGAGAGCTGGGCACTTGTTGG + Intronic
1138033497 16:53579884-53579906 GCTGAGAGCTGAACACTTGTTGG - Intergenic
1138387232 16:56643968-56643990 GCTGAAAACTGCCCGGCTGCAGG + Intronic
1139750423 16:69106415-69106437 GCTGGGAGCTGGCCGGGTGCGGG - Intronic
1141136493 16:81468918-81468940 GCAGTGAGCTGCCTGCATGCTGG + Intronic
1143283281 17:5771060-5771082 GCTGAGAGGTGACAGCCTGCTGG + Intergenic
1143708744 17:8718612-8718634 GCTGAGAGGTGACAGCATGCTGG - Intergenic
1144695519 17:17301515-17301537 GCTGAGAGCTGGACACTTGTTGG + Intergenic
1147969190 17:44210629-44210651 GCTGACAGCTTCCCGCCTTCCGG + Intronic
1150201467 17:63362029-63362051 GCTGAGGGCTGCACACTTGATGG - Intronic
1151746413 17:76014109-76014131 GCTGGGAGCTGCCAGGGTGCAGG + Intronic
1152350141 17:79779489-79779511 GCTGGGCGCTGCTCGCCTGCCGG + Intronic
1152864171 17:82712423-82712445 TCTGAGAGCTGAACGCTAGCTGG - Intergenic
1156160405 18:34351483-34351505 GCTGAGAGCTGAACACTTGATGG + Intergenic
1156868163 18:41912164-41912186 CCTGAGAGCTTCCAGGTTGCTGG + Intergenic
1157120874 18:44910084-44910106 GCTGAGAACTGCCCGCCGTCTGG + Intronic
1157547646 18:48557779-48557801 GCAGACAGCTGCCCTCTTGCTGG + Intronic
1157890064 18:51407050-51407072 GGTGGAAGCTGCCAGCTTGCTGG + Intergenic
1159473033 18:68880539-68880561 GCTGAGAGGTGACAGCATGCTGG - Intronic
1160510052 18:79448361-79448383 GCTGCGCGCTGCCCGGTTCCAGG + Intronic
1161642332 19:5432137-5432159 GCTCAGAGCTGTCCCTTTGCAGG + Intergenic
1162091166 19:8280887-8280909 GCTGAGAGGTGACAGCGTGCTGG - Intronic
1162093400 19:8295725-8295747 GCTGAGAGGTGACAGCGTGCTGG - Intronic
1162106919 19:8375576-8375598 GCTGAGAGGTGACAGCGTGCTGG + Intronic
1162966012 19:14156454-14156476 GCTGAGGGCTGCTCGCCTGGGGG - Intronic
1164566086 19:29327062-29327084 GCTGGGAGCAGGCCGCATGCTGG + Intergenic
1166141891 19:40809648-40809670 GCTGTGAGCTGCGCACTTCCAGG + Intronic
1166830768 19:45638522-45638544 GCTCGGAGCTGCCTTCTTGCCGG - Exonic
1167236409 19:48318605-48318627 GCTGAGTTCTGCCCCCTTACTGG - Intronic
1202688854 1_KI270712v1_random:72076-72098 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
928373832 2:30759404-30759426 GCTGAGGGCTGCCGGCTCCCGGG - Intronic
933957581 2:87384023-87384045 GCTCCTTGCTGCCCGCTTGCTGG + Intergenic
934241701 2:90275918-90275940 GCTCCTTGCTGCCCGCTTGCTGG + Intergenic
934271472 2:91540767-91540789 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
939612915 2:144332239-144332261 GCTGAGAGCCGCGCGCTTCCCGG - Intronic
940134920 2:150425190-150425212 GCTCAGCGCTGCCCCCCTGCGGG - Intergenic
941151442 2:161919561-161919583 GCTGAGAGCTGCACACTTGATGG + Intronic
941404852 2:165075074-165075096 GCTGAGAGCTGGACACTTGTTGG + Intergenic
941831656 2:169967674-169967696 GCTGAGAGCAGCCACATTGCAGG + Intronic
941968023 2:171319502-171319524 GCAGATAGCTGCCCTCTTGGAGG - Exonic
944482719 2:200174600-200174622 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
947846831 2:233251518-233251540 GCAGAGAGGTGGCCGCTTGGGGG - Intronic
948376730 2:237525745-237525767 GCTGAGCTCTGCCCGCCTGGAGG + Exonic
948596469 2:239082635-239082657 GCTGTGGCCTGCCCGCTTGCAGG + Intronic
949047126 2:241877334-241877356 GCTGGGAGCTGCCCGATGGCAGG - Intergenic
1169513807 20:6295219-6295241 GCTGGCAGCTGCCTCCTTGCTGG + Intergenic
1172624262 20:36338182-36338204 GCTGAGAGCTGGGCACTGGCAGG + Intronic
1175254072 20:57628618-57628640 GCTGAGAGATGACAGCGTGCTGG + Intergenic
1175383399 20:58578894-58578916 GCTGAGTGCTTCCCACGTGCCGG + Intergenic
1176019730 20:62956509-62956531 GCTGTGACCTGCCCGAGTGCTGG + Intronic
1176096605 20:63347230-63347252 GCTGAGAGCAGACCGCTCACGGG - Intronic
1176408060 21:6432349-6432371 GCTGAGAGCTGCCCTGTGTCTGG - Intergenic
1176668909 21:9713607-9713629 GCTGGGAGCTGACTGCATGCTGG + Intergenic
1176966710 21:15219128-15219150 GCTGAGAGGTGACAGCATGCTGG - Intergenic
1178398655 21:32265147-32265169 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
1179683551 21:43040675-43040697 GCTGAGAGCTGCCCTGTGTCTGG - Intergenic
1181351464 22:22261511-22261533 GCTCCTTGCTGCCCGCTTGCTGG - Intergenic
1181451692 22:23026905-23026927 GCTGGCAGATGCCAGCTTGCTGG - Intergenic
1181493473 22:23275070-23275092 GCTGACAGCTGCCTGCCTGGTGG - Intronic
1184464183 22:44659339-44659361 GCAGAGAGCTGCCAGCCTCCTGG - Intergenic
950256739 3:11512140-11512162 GCTGAGAGGTGACAGCATGCTGG - Intronic
950465900 3:13153508-13153530 GCTGGGAGCAGCCCCCTTGGTGG - Intergenic
952016186 3:28959526-28959548 GCTGAGAGCTGAACACTTGATGG + Intergenic
952408587 3:33026806-33026828 GCTGAGAGCTGAACACTCGCTGG + Intronic
954093131 3:48301248-48301270 GGTGAGGGCTGCGCGGTTGCAGG - Intronic
954746936 3:52792693-52792715 GCTGTGAGCTGCCAGCTGTCGGG + Intergenic
955847417 3:63180413-63180435 GATGATGGCTGCCCCCTTGCAGG - Intergenic
956462261 3:69484575-69484597 GCTGAGAGCTGAACACTTGATGG - Intronic
956487619 3:69739469-69739491 GCCGAGCTCTGCCCGCTCGCCGG - Exonic
958195370 3:90236096-90236118 GCTGAGAGCTGAACACTTGATGG + Intergenic
958678070 3:97292672-97292694 CCTGAGAGCTGGACGCTAGCTGG - Intronic
958678139 3:97293091-97293113 ACTGAGAGCTGGGCCCTTGCTGG - Intronic
958678152 3:97293161-97293183 GCTGAGAGCTGGACGCTTGCTGG - Intronic
959375462 3:105583813-105583835 TCTGAGAGCTGCTTACTTGCTGG + Intergenic
960333898 3:116392946-116392968 GCTGAGAGCTGGACACTTGATGG + Intronic
960690651 3:120342590-120342612 GCTGAGAGCTGAACACTTGAAGG + Intronic
961721474 3:128899695-128899717 GCTGAGTGCTGCTCACTTGAAGG + Intronic
967685270 3:192409874-192409896 GCTCAGAGCCGCGGGCTTGCGGG + Intronic
967858268 3:194134320-194134342 GCTGCGTGCTGCCTGCTGGCCGG - Intergenic
968480142 4:829565-829587 GCAGAGCGCTGCCCTCCTGCTGG - Intergenic
968534281 4:1113544-1113566 GCGCAGAGCTGCCCGCCTTCGGG - Intronic
968805860 4:2772037-2772059 GCTGAGAGGTGCTCCCTTGCCGG - Intergenic
971092456 4:23361104-23361126 ACTGAGAGCTGGACGCTTGTGGG + Intergenic
974827679 4:67151697-67151719 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
975663075 4:76706788-76706810 GCTGCTAGTTGCCTGCTTGCTGG - Intronic
977487288 4:97665412-97665434 GCTGAGAGCTGAACACTTGTTGG - Intronic
978301027 4:107269951-107269973 GCTGAGAGCTGGACACTTGTTGG - Intronic
980043466 4:127964781-127964803 GCTGAGAGGTGACAGCGTGCTGG - Intronic
983380105 4:166981322-166981344 GCTGAGAGCTGGACACTTGTTGG - Intronic
984296680 4:177862272-177862294 ACTGAGAGCTGGACACTTGCTGG + Intronic
985405874 4:189637906-189637928 GCTGGGAGCTGACTGCATGCTGG - Intergenic
986270644 5:6227827-6227849 GGTGACAGCTGCGCTCTTGCTGG - Intergenic
987696520 5:21341223-21341245 TCTGAGAGGTGACAGCTTGCTGG + Intergenic
988201862 5:28078196-28078218 ACTGAGAGGTGACAGCTTGCTGG - Intergenic
988489216 5:31692508-31692530 GCTGAGAGGTGACAGCCTGCTGG - Intronic
988755678 5:34245347-34245369 TCTGAGAGGTGACAGCTTGCTGG - Intergenic
990461436 5:56035304-56035326 GCTGAGAGGTGGCAGCGTGCTGG + Intergenic
991527223 5:67574089-67574111 GCTGAGATCTGCACACTTGTTGG + Intergenic
991743932 5:69711118-69711140 TCTGAGAGGTGACAGCTTGCTGG - Intergenic
991753777 5:69844124-69844146 TCTGAGAGGTGACAGCTTGCTGG + Intergenic
991795504 5:70290850-70290872 TCTGAGAGGTGACAGCTTGCTGG - Intergenic
991803394 5:70400851-70400873 TCTGAGAGGTGACAGCTTGCTGG + Intergenic
991823302 5:70586386-70586408 TCTGAGAGGTGACAGCTTGCTGG - Intergenic
991833093 5:70719237-70719259 TCTGAGAGGTGACAGCTTGCTGG + Intergenic
991887871 5:71290369-71290391 TCTGAGAGGTGACAGCTTGCTGG - Intergenic
995146051 5:108787717-108787739 GCTGAGAGCTGGATGCTTGTTGG + Intronic
997283130 5:132660929-132660951 GCTGAGAGCTGGCTGCTGGCTGG - Exonic
998160636 5:139810996-139811018 GCTGAGAGCTCCCCACAAGCAGG + Intronic
998176260 5:139904007-139904029 GCTCAGGGCTGCTCGCCTGCAGG + Intronic
1003956592 6:11170891-11170913 GCTGAGAGGTGACAGCCTGCTGG + Intergenic
1004883628 6:20032172-20032194 GCTGAGAGGTGACAGCATGCTGG + Intergenic
1005035653 6:21552827-21552849 GCTGAGAGGTGACAGCATGCTGG - Intergenic
1005266587 6:24118445-24118467 GCTAAAAGCTACCCGCTTGAGGG + Intergenic
1005554321 6:26957123-26957145 TCTGAGAGGTGACAGCTTGCTGG - Intergenic
1005749140 6:28866984-28867006 ACTGAGAGGTGACAGCTTGCTGG - Intergenic
1007243148 6:40441647-40441669 GCTGAGAGCTGCCAGCCTGTGGG - Intronic
1007765703 6:44158664-44158686 GCTGAGGGCTACCCGCTTTAGGG - Intergenic
1008038701 6:46774417-46774439 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
1009800648 6:68533251-68533273 GCTGAGAGGTGACAGCATGCTGG + Intergenic
1013081570 6:106817308-106817330 TCTGAGAGCTGACAGCATGCTGG - Intergenic
1016210871 6:141531826-141531848 GCTGAGAGCTGGACACTAGCTGG + Intergenic
1021097284 7:16548119-16548141 GCTGAGAGCTGGACACTTGTTGG + Intronic
1021686841 7:23194270-23194292 GGTGAGAGGTGACAGCTTGCTGG - Intronic
1024381127 7:48697486-48697508 GGTGAGCGCTGGCTGCTTGCAGG + Intergenic
1024825503 7:53385705-53385727 GCTGAGAGGTGACAGCATGCTGG - Intergenic
1026589596 7:71683423-71683445 GCTGAGAGCCGCCTGGTTACAGG - Intronic
1031242030 7:119258014-119258036 GCTGAGAGCTGAACACTTGAAGG - Intergenic
1032387244 7:131533358-131533380 GCTGAGAGCTGCCCCCTTAGGGG + Intronic
1032658298 7:133955373-133955395 GCTGAGAGCTGAACACTTGACGG - Intronic
1034154932 7:148948898-148948920 GCTGAGAGGTGACAGCATGCTGG + Intergenic
1034977728 7:155457956-155457978 GGCGAGAGCTGCGCGCATGCAGG - Intergenic
1035374737 7:158400633-158400655 GCTGGGAGTTGCCCTCTTGCAGG + Intronic
1035781907 8:2234223-2234245 GCTGAGAGCTGCCTGGTGGGAGG + Intergenic
1035810210 8:2485183-2485205 GCTGAGAGCTGCCTGGTGGGAGG - Intergenic
1036182648 8:6598402-6598424 GCTCAGAGCTGCACTCTGGCCGG - Intronic
1036418999 8:8578583-8578605 ACTGAGAGCTGCCTGGTTGCTGG - Intergenic
1036441119 8:8781934-8781956 GCTGAGAGGTGACAGCGTGCTGG - Intergenic
1037957637 8:23071332-23071354 ACTGAGAGGTGACAGCTTGCTGG - Intergenic
1039069196 8:33634376-33634398 GCTGAGAGGTGACAGCGTGCTGG - Intergenic
1043640084 8:82441239-82441261 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
1046445252 8:114311168-114311190 GCTGAGAGGTGACAGCGTGCTGG + Intergenic
1048254471 8:132895313-132895335 GCAGGGAGCTGCCCTCCTGCTGG - Intronic
1049252288 8:141595740-141595762 GCTGAGAGCTGCTTGGTTGTGGG + Intergenic
1049786203 8:144452005-144452027 CCTGAGACCTGCCCACTTTCTGG + Intronic
1052466765 9:28839464-28839486 GCTGAGAGCTGCATACTTGATGG - Intergenic
1052971027 9:34377169-34377191 GCCGAGCCCCGCCCGCTTGCGGG - Intergenic
1053393784 9:37754044-37754066 CCTGAGAGCACCCCGCCTGCGGG - Intronic
1053445095 9:38146536-38146558 GCTGAGAGCTGGACACTTGTTGG + Intergenic
1053475213 9:38377601-38377623 GCTGCGTGCTGCGCGCTTGCGGG + Intergenic
1056097105 9:83266599-83266621 GCTCAGATCTGCTTGCTTGCTGG - Intronic
1057563655 9:96149131-96149153 GATGAAAGCAGCCCACTTGCTGG - Intergenic
1058091978 9:100814751-100814773 GCTGAGAGCTGAGCACTTGATGG + Intergenic
1060222225 9:121770612-121770634 CCTGGGAGCTGCCCGCTACCTGG - Exonic
1060618826 9:125044406-125044428 GCTGAGAGCTGGACACTTGCTGG + Intronic
1060748612 9:126154280-126154302 CCTGAGAGGTGCCCTCTGGCTGG - Intergenic
1060939918 9:127537202-127537224 TCTGAGAGCTAGGCGCTTGCAGG - Intronic
1062080685 9:134621863-134621885 GAGGAGAGCTGCCCCCTGGCAGG + Intergenic
1062348742 9:136128481-136128503 GCTCCGTGCTGCCCGCTAGCTGG + Intergenic
1203656957 Un_KI270753v1:7328-7350 GCTGGGAGCTGACTGCATGCTGG - Intergenic
1187679016 X:21747644-21747666 TCTGAGAGCTGCCAGCCGGCTGG + Intronic
1187736717 X:22312291-22312313 ACTGAGAGCTGCCCTGGTGCAGG - Intergenic
1190287228 X:48969767-48969789 GCAGGGAGCTGCCTGCTGGCAGG + Exonic
1190369539 X:49727532-49727554 GCTGAGAGCTGAGCACTTGTTGG + Intergenic
1191016400 X:55814016-55814038 GCTGAGAGCTGGACACTTGTTGG + Intergenic
1193709048 X:84857146-84857168 GCTGAGAGGTGACAGCGTGCTGG - Intergenic
1195884524 X:109625102-109625124 GCTGAGCCCTGCCCGCCGGCCGG - Exonic
1196751468 X:119121412-119121434 GCTGAGAGCTGACAGCTGTCTGG + Intronic
1197056887 X:122132435-122132457 GCTGAGCTGTGCCAGCTTGCAGG + Intergenic
1197783540 X:130179061-130179083 GCTGCGAGCAGCCTGCTTCCTGG + Intronic
1198660498 X:138963243-138963265 GCTGAGAGCTGTCCACCTGTGGG - Intronic
1198759726 X:140018603-140018625 GCAGAGGTCTGCCCACTTGCTGG + Intergenic
1198779061 X:140215447-140215469 GCAGAGGTCTGCCCACTTGCTGG - Intergenic
1199094919 X:143726752-143726774 GCTGAGAGGTGACAGCATGCTGG - Intergenic
1199187968 X:144939229-144939251 GCTGAGAGCTGAATGCTTGTTGG - Intergenic