ID: 1132884539

View in Genome Browser
Species Human (GRCh38)
Location 16:2176823-2176845
Sequence CCATCTAGGGTGGGGATGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132884539 Original CRISPR CCATCTAGGGTGGGGATGGA GGG (reversed) Exonic
900116744 1:1032368-1032390 CCAGCTAAGGTGGGGTTGGTGGG + Intronic
900381275 1:2385258-2385280 CCATCTAGGGTGGGGGTGGGCGG - Intronic
900991209 1:6099236-6099258 CCAGCAAGGGTGGGGGTGGGTGG - Exonic
901632550 1:10655023-10655045 CCAGCTGGGGTGGGGTGGGAGGG - Intronic
901900772 1:12360178-12360200 CCACCTAGGGAAGGGATAGAGGG + Intronic
901917507 1:12511281-12511303 CCACCTAGGGCGGGGCTGGGTGG + Exonic
902151989 1:14450722-14450744 ACATCAAGTGTGGGGAAGGAGGG + Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
903941949 1:26938092-26938114 CCAACCAGGGTGGGGAGGGCTGG - Intronic
904867857 1:33596178-33596200 CCAAGTAGGGTGAGGAGGGAGGG - Intronic
908342516 1:63196425-63196447 CTATCTGGGGTGGGCAGGGAAGG - Intergenic
911158008 1:94655465-94655487 GCAACTGGGGTGGGGATGGGGGG + Intergenic
911429756 1:97769827-97769849 CCATTTAGGGTGGGAATATAAGG + Intronic
911552910 1:99306171-99306193 CCATCGAGGGTAGGGGTGAATGG + Exonic
911665032 1:100542280-100542302 CCTTTTGGGGTGGGGCTGGAGGG + Intergenic
912629632 1:111235503-111235525 CCATGTGGGGTGGGGAGGAAAGG + Intronic
915466689 1:156102517-156102539 CTCTCGAGGGTGGAGATGGAAGG - Intronic
917439635 1:175055655-175055677 CCTTCTAGGCTGGGGATGATGGG - Intergenic
917582242 1:176391075-176391097 CCAGCAAGGGTGCTGATGGACGG - Intergenic
918014040 1:180615565-180615587 CCATCTTGGGCTGGGAAGGAGGG + Intergenic
919999366 1:202785232-202785254 CCAGCTAGGGTTAGGCTGGAAGG - Intronic
920365613 1:205446830-205446852 CCATCTAAGCTGGGGCAGGAGGG + Intronic
921283247 1:213587277-213587299 CTATCAAGGGTGGGGATAGAGGG + Intergenic
921503310 1:215933895-215933917 CCCTCTAGGGTTGACATGGATGG - Intronic
1064319232 10:14286811-14286833 ACACCAAGGGAGGGGATGGAGGG + Intronic
1064339803 10:14475717-14475739 CCATCGATGGTGGGGGTGGGAGG - Intergenic
1066436139 10:35398040-35398062 CCATGTGGAGTGGGCATGGATGG + Intronic
1066975370 10:42363511-42363533 GCAGCTGGGGTTGGGATGGAAGG - Intergenic
1067287178 10:44915003-44915025 CCGTCCAGGCTGGGCATGGAGGG + Intronic
1067297083 10:44980738-44980760 GCGTCCAGGGTGGGGCTGGAGGG + Intronic
1068855581 10:61794379-61794401 CCATCAAGGATGGCTATGGAAGG + Intergenic
1069566373 10:69466020-69466042 CCACCTTGTGTGGGGATAGAGGG + Intronic
1069567457 10:69473387-69473409 TCATCAAGGCTGGGGAGGGAAGG + Intronic
1071466265 10:85942431-85942453 CCCCCTAGTGTGGGGAAGGAAGG - Intronic
1072417989 10:95264778-95264800 AAGTCTAGGGTGGGGGTGGAGGG - Intronic
1072539445 10:96387073-96387095 CCACCTCTGGTGGGGAAGGAAGG + Exonic
1074857408 10:117483603-117483625 TCATACAGGGTGAGGATGGAGGG + Intergenic
1075125790 10:119697900-119697922 CCATCAAGTGTTGGGATGGGAGG - Intergenic
1075168484 10:120091299-120091321 CCATCCAAAGTGGGGAGGGATGG + Intergenic
1075814800 10:125256686-125256708 CCAGCCAGGGTGGGGATGGAGGG + Intergenic
1076036489 10:127202534-127202556 GAACCTAAGGTGGGGATGGAGGG - Intronic
1077228748 11:1449468-1449490 CCATCCAGCGTGGGGGTGGACGG - Intronic
1077436292 11:2540743-2540765 CCCTCTAGGGTGGCAATGGGAGG + Intronic
1078355589 11:10629479-10629501 CCCTCTAGGGTCGGGAGGGAAGG - Intronic
1079052264 11:17172427-17172449 TCATCTGGAGTGTGGATGGATGG - Intronic
1081784199 11:45734996-45735018 CTATCTGGGGTGGGAGTGGAGGG + Intergenic
1083788780 11:64970927-64970949 ACAGCTAGGCTGGGGTTGGAGGG + Intronic
1083910176 11:65703389-65703411 CCATCCAAGGTGGAGCTGGAGGG - Intergenic
1084673452 11:70621026-70621048 CCATCTGAAATGGGGATGGATGG + Intronic
1085326898 11:75613245-75613267 CCATGTAGGGCAGGGAAGGAAGG - Intronic
1085854007 11:80155534-80155556 CGATGGAGGGTGGGGATGGTGGG + Intergenic
1088304655 11:108395198-108395220 CCATGTGGGATGGGCATGGATGG + Intronic
1088843282 11:113644353-113644375 CCATCTAGAGATGGGATGAAGGG - Intergenic
1091527998 12:1324882-1324904 CCATGTGAGGTGGGGATGAATGG - Intronic
1092141809 12:6189203-6189225 CCATGAGGGGTGGGGATGGGCGG - Intergenic
1093945008 12:25098516-25098538 CCATCTACAGTGGGGAAGGCTGG - Intronic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1100521938 12:95383465-95383487 CCATCTAGGGTTTGGATGGATGG + Intergenic
1101444374 12:104727094-104727116 TCATTTGGGGTGGGGGTGGATGG - Intronic
1101836345 12:108298529-108298551 CCCTGTAGGGTGGAGCTGGACGG - Intronic
1102173932 12:110862310-110862332 CCATCGAGGGTGGGCATGGGAGG - Intronic
1102626484 12:114239465-114239487 CCATGTAGGGCCGGCATGGAGGG - Intergenic
1102982862 12:117256106-117256128 CCATCTAGGATGGGGTGGGAAGG + Intronic
1103136638 12:118513337-118513359 GCAGCTGGGGTGGGGATGGAGGG + Intergenic
1103558280 12:121778946-121778968 CCATGTGGGGTGGAGATGGGAGG + Exonic
1108699339 13:52930502-52930524 CCTTCTGGGGTGGAGGTGGAGGG + Intergenic
1112920963 13:104612512-104612534 CCATCAAGGGTGATGAGGGAGGG - Intergenic
1113796475 13:113061576-113061598 GCAACGAGGGTGGGGAGGGAGGG - Intronic
1116991624 14:51283558-51283580 CCATCTGGGTTGGGGAGGTAAGG - Intergenic
1118765047 14:68904040-68904062 CCATGTTGGGTAGGGAAGGAAGG - Intronic
1119168719 14:72516415-72516437 CCAGAGAGGGTGGGGAAGGAAGG - Intronic
1119380677 14:74226250-74226272 CCTGGTAGGGTGGGGGTGGAGGG - Intergenic
1121737046 14:96225902-96225924 CCTGCTAGGGTGGGAGTGGAGGG - Intronic
1122177407 14:99931248-99931270 AGATCTGGGGTGGGGAGGGAGGG - Intronic
1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG + Intronic
1122871419 14:104640707-104640729 CCATCCATGCTGGGGATGGGGGG - Intergenic
1122916011 14:104859335-104859357 CGATGGAGGGTGGTGATGGAGGG - Intergenic
1129233522 15:74209719-74209741 CCCTCTAGGAAGGGGAGGGAGGG - Intronic
1129302909 15:74636574-74636596 CAATGTAGGGAGGAGATGGACGG + Intronic
1130293102 15:82622238-82622260 GGAGCTAGGGTGGGGCTGGAAGG - Intronic
1130990394 15:88872538-88872560 CCACATTGGGTAGGGATGGATGG - Intronic
1132153072 15:99475944-99475966 CTATCTGGGGTGGGGAGGGAGGG - Intergenic
1132721896 16:1320689-1320711 CCGTCTGCGGTGGGCATGGATGG + Intronic
1132763187 16:1520925-1520947 CTAGCTGGGGTGGGTATGGAGGG + Intronic
1132884533 16:2176810-2176832 GGATGGAGGGTGGGGATGGAGGG - Exonic
1132884539 16:2176823-2176845 CCATCTAGGGTGGGGATGGAGGG - Exonic
1133008788 16:2898757-2898779 GGACCTGGGGTGGGGATGGAAGG - Intronic
1135262947 16:20997230-20997252 CCAGCTCTGCTGGGGATGGAGGG + Intronic
1135533906 16:23277997-23278019 CCAGGCAGGGTGGGGAGGGAGGG + Intergenic
1136021770 16:27445105-27445127 CCATATGGGGTGGGCATGGTGGG - Intronic
1136026003 16:27469536-27469558 CCTTCTAGCTTGGGGAAGGACGG - Exonic
1136287588 16:29253497-29253519 GCATCTGTGCTGGGGATGGAGGG + Intergenic
1136673312 16:31876983-31877005 GCATTTGGGGTTGGGATGGAAGG + Intronic
1137784665 16:51128392-51128414 ACATCTAGGTTGGGGTTGGCTGG + Intergenic
1139828829 16:69780087-69780109 CCCTCTAGGGTAGGGGAGGAGGG - Intronic
1142007575 16:87696998-87697020 CCGTCTTGGGTGTGGATGGAGGG + Exonic
1143426444 17:6843018-6843040 CCAGCTGGGGTGAGGCTGGATGG + Intergenic
1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG + Intergenic
1145721994 17:27082346-27082368 CCATGGAGGGTGGGAAAGGAAGG + Intergenic
1146886841 17:36476477-36476499 ACACCTAGGGTAGGGGTGGAGGG - Intergenic
1146902962 17:36600221-36600243 CCATGAAGGGTGGGGAGGGAAGG - Exonic
1148486596 17:47994985-47995007 CCATCCAGGCTTGGGAAGGAGGG + Intergenic
1148637031 17:49156719-49156741 CCAAGGAGGGAGGGGATGGAAGG + Intronic
1149576323 17:57715987-57716009 CCATCTGGGGTGGGAGTGGTAGG + Intergenic
1152960368 18:76106-76128 CCGTCAAGGCTGGGGATGGCGGG - Intergenic
1153893672 18:9540479-9540501 CCAGCTGGGGAGGGGAAGGAAGG + Intergenic
1154064569 18:11094990-11095012 CCACCAAGTGTGGGGGTGGAAGG + Intronic
1155236765 18:23827613-23827635 TGATTTAGGGTGGGGCTGGATGG + Intronic
1155324055 18:24648364-24648386 ATTTCTGGGGTGGGGATGGAGGG + Intergenic
1155394993 18:25377631-25377653 CCATCTAAGTTGGGGAGGTAAGG - Intergenic
1157347608 18:46853782-46853804 CTATCTTGGGTGGGGATGGGAGG + Intronic
1160968965 19:1759077-1759099 CCACCTGGGGTGGGGGTGGGGGG - Intronic
1161093457 19:2375345-2375367 CCATCACTGATGGGGATGGAGGG + Intergenic
1163109737 19:15152335-15152357 TCATTTAGGGTGGGGCTGAAAGG - Intergenic
1163122386 19:15225823-15225845 CCCTCTGGGGTGGGGATGGGTGG - Intergenic
1163393647 19:17046075-17046097 CCATCCAGGGCAGGGAGGGAGGG - Intergenic
1165255629 19:34576086-34576108 CTACCTAGTTTGGGGATGGATGG + Intergenic
1166103243 19:40583582-40583604 ACATCTGGGGTGGGCAGGGAGGG - Exonic
1168297975 19:55386990-55387012 CAAGTCAGGGTGGGGATGGATGG + Intronic
1168412276 19:56147379-56147401 GCAGCTGGTGTGGGGATGGAGGG - Intronic
1168518829 19:57032259-57032281 CCATCTACTGTGGGGATTTAAGG + Intergenic
925337971 2:3112438-3112460 CCATGCAGAGTGGGGCTGGAGGG - Intergenic
926996363 2:18740410-18740432 CCATCTACGGTTTGGGTGGATGG - Intergenic
928968756 2:37004510-37004532 GCATCTAGGCTGGGAAAGGAAGG - Intronic
929592204 2:43154693-43154715 ACATTTGGAGTGGGGATGGATGG + Intergenic
929598043 2:43188375-43188397 CCATCTAGGATGGGCACGGACGG - Intergenic
931165412 2:59741848-59741870 ACATGCATGGTGGGGATGGAGGG - Intergenic
932953223 2:76318072-76318094 TCATCTAAGGTGAGGGTGGAAGG + Intergenic
933198731 2:79423264-79423286 GCAACTTTGGTGGGGATGGATGG - Intronic
933287246 2:80397764-80397786 CCATATAGGGTGTGGACGTATGG + Intronic
933294398 2:80472710-80472732 TGATCTAGGGTGGGGAGAGATGG + Intronic
935368853 2:102323657-102323679 CCACCAAGGGAGGGGATTGAAGG + Intronic
937253239 2:120537241-120537263 CCACCAAGGGCAGGGATGGAGGG - Intergenic
937781393 2:125842894-125842916 GCATCTAGGGTGCAGATGCAAGG + Intergenic
940830655 2:158461651-158461673 CAATATAGGGTAGGGAGGGAGGG + Intronic
941117519 2:161488768-161488790 CCACCTGGGGTGGTGATGGCTGG + Intronic
944228751 2:197372695-197372717 TCATCCAGGGTGTGGAGGGAGGG + Intergenic
947065208 2:226216811-226216833 GCACCTAGGGCGGGGAGGGAGGG + Intergenic
947403818 2:229754300-229754322 TCATCACTGGTGGGGATGGAAGG + Intergenic
947959695 2:234225433-234225455 TCAACTAGGGTGGTCATGGAAGG + Intergenic
1170923345 20:20700294-20700316 CTACCTAGAGGGGGGATGGAGGG + Intronic
1171275756 20:23855569-23855591 CCCTCTCAGGTGGGGATGGAAGG + Intergenic
1172026728 20:31953686-31953708 CCACCTGGTGTGGGGAAGGAGGG + Intergenic
1172208642 20:33182102-33182124 CATTCTGGGGTGTGGATGGAGGG - Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174822329 20:53737452-53737474 CCATACAGAGGGGGGATGGAGGG + Intergenic
1174956359 20:55103087-55103109 ACATCAAGGGTGAGGTTGGAGGG + Intergenic
1175127777 20:56765202-56765224 CCAGCTCTGGTGGGGATGGACGG - Intergenic
1176131313 20:63497948-63497970 CCATGTTTGGTGGGGAGGGAAGG + Intronic
1176546205 21:8201316-8201338 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
1176565156 21:8384362-8384384 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
1177417093 21:20807976-20807998 CCATAAATGGTGGGGGTGGAGGG - Intergenic
1179180255 21:39038397-39038419 CCTTCTAGGCTGGGCATGGCAGG - Intergenic
1179199604 21:39204189-39204211 CCACCTAGGAAGGGGATGGAAGG + Intronic
1180192706 21:46173743-46173765 GCAGCTGGGGTGGGGATGGGGGG - Intronic
1181756128 22:25026301-25026323 CCATCTAGGTGGGGGCTGGCTGG + Intronic
1181804399 22:25366273-25366295 CCACCGAGGATGGGGCTGGAGGG + Intronic
1182134671 22:27890234-27890256 GCTTCCAGGGTTGGGATGGAGGG - Intronic
1182842201 22:33400387-33400409 CCATCTGGGGGAGGGATGGGAGG + Intronic
1183235973 22:36618025-36618047 CCATCCTGGGTGGAGGTGGAGGG + Intronic
1183264994 22:36819427-36819449 TCACCTCGGGTGGGGGTGGAGGG + Exonic
1183305821 22:37082540-37082562 TCACCTAGGCTGGGGATGGCTGG - Intronic
1183414842 22:37676181-37676203 CCTTCTAGGTCGGGGGTGGAGGG + Intronic
1184109307 22:42385590-42385612 CCAGCCAGGGTGGGGAGGGAGGG - Intronic
1185323482 22:50213933-50213955 CCATCTAGGGTTGGGAGCGGTGG - Intronic
1203251077 22_KI270733v1_random:117553-117575 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
949925503 3:9037844-9037866 CCCTCCAGGCTGGCGATGGAAGG - Intronic
950568616 3:13786421-13786443 GCATCTGGGGTGTGGGTGGAGGG + Intergenic
950934215 3:16822340-16822362 CCTTGAAGGGTGGGTATGGATGG + Intronic
951411375 3:22371805-22371827 ACATTTAGGGTGGGGTTGGGAGG - Intronic
951574968 3:24104184-24104206 ACATCAAGGGAGGGGAAGGATGG - Intergenic
953910953 3:46892807-46892829 CCTTCTGGGGTAGGGATGGAGGG + Intronic
955740395 3:62084715-62084737 CTACCTATGGTGGGGAAGGAGGG - Intronic
958427590 3:93997061-93997083 CCATCTGGGGGGGTGATGGGAGG - Intronic
960286243 3:115832120-115832142 CCATGTAGAGTGGGGATAGGAGG + Intronic
961723035 3:128908637-128908659 GCCCCTAGGGTGGGGGTGGAGGG - Intronic
962255159 3:133865485-133865507 CCATCTGGGGTGGGGGAAGAGGG + Intronic
963891172 3:150637530-150637552 CCATCTTGGCTGGGGTGGGAGGG - Intergenic
964392650 3:156213628-156213650 CCATGCAGGGTGGGGATTGTTGG + Intronic
964518099 3:157534334-157534356 CTAGCTAGGGTGGTGAAGGAAGG - Intergenic
968648558 4:1751523-1751545 CCATCTGGGGTGGGGGTTGTGGG - Intergenic
969522619 4:7687343-7687365 CTATCTGGGGTGGGGCAGGAGGG + Intronic
971240549 4:24884940-24884962 ACATCTTGGTTGGGGATAGACGG + Intronic
972002054 4:34049740-34049762 CCGTCTGGGATTGGGATGGAGGG + Intergenic
972769293 4:42181511-42181533 TCATCCAGGGTGCGGAAGGAAGG + Intergenic
972986177 4:44768786-44768808 CCATATAGTTTGGGGATGGGGGG + Intergenic
973278647 4:48336231-48336253 CCATCTGGGGTGGGGATTGAGGG - Intergenic
974237503 4:59200691-59200713 GCAGCTAGGATGGGGATGGGAGG - Intergenic
974847287 4:67366388-67366410 CTAATAAGGGTGGGGATGGAAGG - Intergenic
976740306 4:88349548-88349570 CCCCCTGGGGTGGGGATGGGAGG - Intergenic
977510172 4:97952657-97952679 CCATCTCTGATGGGGATGGCAGG + Intronic
977586537 4:98780825-98780847 CAAGCCAGGGTGGGCATGGAGGG + Intergenic
979546618 4:121947370-121947392 CCCTCCAGGGTTGGGAGGGAGGG + Intronic
984531742 4:180924345-180924367 CCATCTAGGAGGGAGATGCATGG - Intergenic
985128111 4:186715122-186715144 CCTTCTGGTGGGGGGATGGAGGG - Intronic
985421019 4:189785355-189785377 CCAGCTTGGGTGGGTATAGAAGG - Intergenic
987333476 5:16877374-16877396 CCAACTAGTGTGGGGACAGAAGG - Intronic
997985959 5:138501859-138501881 CCAGCTGGGGTGGGCCTGGAGGG - Intergenic
998512053 5:142721797-142721819 CTATCTAGGGTGTGGATGGATGG + Intergenic
998614838 5:143728439-143728461 ACATCCAGAGTTGGGATGGAAGG + Intergenic
999594219 5:153184437-153184459 CTAACTAGGGTGGGGGTGCAGGG - Intergenic
1001259898 5:170219448-170219470 CCACCTACTGTGGGGCTGGATGG - Intergenic
1001537053 5:172505459-172505481 CCATCTAGGGAGTCGATGCAGGG - Intergenic
1001764057 5:174231229-174231251 TCATCTAGGGTGCAGATGGGAGG - Intronic
1001953699 5:175833692-175833714 GGATCTGGGGTGGGGATGGGAGG + Intronic
1004329662 6:14709910-14709932 CCATTTGGGGTGGAAATGGAGGG + Intergenic
1005012673 6:21350536-21350558 CCATCTAGGGTTGGAGTAGAGGG - Intergenic
1005155606 6:22802645-22802667 CTATCTAGGGTAGGAATGTAGGG + Intergenic
1008698650 6:54072346-54072368 CCATCAAGTGAGGAGATGGAAGG - Intronic
1011563845 6:88652831-88652853 GCATTTAGGGTAAGGATGGAGGG + Intronic
1011620399 6:89237326-89237348 GCTTCCAGGGTGGGGAGGGAAGG + Intergenic
1011802568 6:91034201-91034223 CCACCTGGGGGTGGGATGGATGG + Intergenic
1012640059 6:101599068-101599090 ACTACTAGAGTGGGGATGGAGGG - Intronic
1013403787 6:109824161-109824183 CCAAGTGGGGTGGGAATGGAGGG + Intronic
1017140014 6:151181898-151181920 ACATGTAGGGTCAGGATGGATGG + Intergenic
1017216920 6:151918806-151918828 CAATATAGGGAAGGGATGGAGGG + Intronic
1017446015 6:154508598-154508620 CAAGCTAGCGTGGGCATGGATGG + Intronic
1017963925 6:159247226-159247248 CCAAGGAGGGTGGGGAGGGAGGG - Intronic
1019336487 7:485303-485325 CCATCAAAGGTGGGAAGGGAGGG - Intergenic
1019912153 7:4107106-4107128 ACATCCAGGGTGGGGAGGGTGGG + Intronic
1020383368 7:7569749-7569771 TCGACTAGGGAGGGGATGGAGGG + Intronic
1023535431 7:41203665-41203687 CCAGCAGGGGTGGGAATGGAAGG - Intergenic
1024257058 7:47547144-47547166 CCCTCCAGGGTGAGGAGGGAGGG + Intronic
1024863909 7:53880825-53880847 CCATCAGTGGTGGGGCTGGAAGG + Intergenic
1026774558 7:73223361-73223383 CCAGCTTGGGTGGGGAGGGGAGG - Intergenic
1026829113 7:73600598-73600620 CCAAGTAGGGTGGGGATGAGAGG + Intronic
1027015416 7:74776750-74776772 CCAGCTTGGGTGGGGAGGGGAGG - Intronic
1027072615 7:75169205-75169227 CCAGCTTGGGTGGGGAGGGGAGG + Intergenic
1027622336 7:80504831-80504853 TCATCTAGGGTGAGGTTGGGGGG + Intronic
1028840560 7:95425377-95425399 CCCTCTAGAGTGGAGAGGGAGGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032196861 7:129794445-129794467 CCATCTTGGCTGGGGACAGAAGG - Intergenic
1033288495 7:140062221-140062243 CCGTGTGGGGTGGGGAGGGAGGG - Intronic
1033577771 7:142702530-142702552 CCATCTAGGAAGGAGATGGGTGG + Intergenic
1034211474 7:149367296-149367318 GCATCTAGGGTGGGGAGAGGGGG + Intergenic
1034940045 7:155224791-155224813 CCATCCAGGGAGGGGCTGGGAGG + Intergenic
1038037259 8:23696869-23696891 CCAGAAAGGGTGGGGAGGGAAGG - Intergenic
1038334648 8:26636350-26636372 CCACGTAGTGTGGGGATGGTTGG + Intronic
1038387725 8:27165276-27165298 ACATCTAGGGTGGGAAAGAAAGG + Intergenic
1044434930 8:92150821-92150843 CTGTCTGGGGTGGGGGTGGAGGG + Intergenic
1046939862 8:119920672-119920694 CGATCTAGGGTCAGGGTGGAAGG + Intronic
1048307966 8:133296879-133296901 CCAGCTAGGGGGGAGATGAATGG + Exonic
1048319561 8:133387813-133387835 CCCTCTGGGGTGGGGGAGGAGGG + Intergenic
1048439295 8:134448087-134448109 ACAGGTAGGGTGGGGAAGGAGGG - Intergenic
1049425807 8:142537439-142537461 CTTTCCTGGGTGGGGATGGAGGG - Intronic
1049473052 8:142784735-142784757 CCTTCCAGGGTGGGGACGGACGG + Intergenic
1049685894 8:143939201-143939223 CCGTGTTGGGTGGGGATGGCTGG + Intronic
1052891262 9:33702339-33702361 CCGTCTAGGAAGGAGATGGATGG + Intergenic
1053042768 9:34888904-34888926 CATTCTAGGGTGGGGCTGGGAGG + Intergenic
1056786191 9:89594098-89594120 CCCTCTAGGGTGGCTTTGGAGGG + Intergenic
1057582946 9:96303588-96303610 CCTTCTGGGGGTGGGATGGAGGG + Intergenic
1058765958 9:108182968-108182990 CCATGTAAGGTGTGGAGGGAAGG + Intergenic
1059130964 9:111748919-111748941 ACATCTAGGGTGGAGAAGGAAGG - Intronic
1059396091 9:114035033-114035055 CAATCTGGGGTGGGGTTGCAGGG - Intronic
1060468490 9:123929387-123929409 CCACCTAAGGTGTGGATGGCCGG - Intronic
1203467482 Un_GL000220v1:100820-100842 GGGTGTAGGGTGGGGATGGAGGG + Intergenic
1186399535 X:9244547-9244569 CCAGCTGGGGTGGGGGTGGGGGG - Intergenic
1186893809 X:13986518-13986540 CCATCTATGGTGGAGAATGAAGG + Intergenic
1189492743 X:41482646-41482668 CCCTCTGGGGTGGAGATGGTGGG - Intergenic
1192557657 X:72103258-72103280 ACATCTAGGATTGGGATTGAGGG - Intergenic
1195546462 X:106117430-106117452 CCATCAAGGGACAGGATGGATGG - Intergenic
1198942399 X:141971002-141971024 CCTTCTAGGGATGGGATAGATGG - Intergenic
1201485662 Y:14491841-14491863 CCATCTATGTTGGGGTTTGATGG - Intergenic