ID: 1132884899

View in Genome Browser
Species Human (GRCh38)
Location 16:2178367-2178389
Sequence CGCCTGGCCGGGGGCTCCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132884899_1132884914 3 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884914 16:2178393-2178415 CCCGGTGGGCGCCCCGGCCCGGG 0: 1
1: 0
2: 3
3: 45
4: 366
1132884899_1132884918 11 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884918 16:2178401-2178423 GCGCCCCGGCCCGGGTCCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 275
1132884899_1132884910 -3 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884910 16:2178387-2178409 GCGGTCCCCGGTGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 12
4: 179
1132884899_1132884921 15 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884921 16:2178405-2178427 CCCGGCCCGGGTCCAGGGGCCGG 0: 1
1: 1
2: 2
3: 50
4: 442
1132884899_1132884912 2 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884912 16:2178392-2178414 CCCCGGTGGGCGCCCCGGCCCGG 0: 1
1: 0
2: 2
3: 29
4: 272
1132884899_1132884917 10 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1132884899_1132884916 9 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884916 16:2178399-2178421 GGGCGCCCCGGCCCGGGTCCAGG 0: 1
1: 0
2: 2
3: 44
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132884899 Original CRISPR CGCCTGGCCGGGGGCTCCAA GGG (reversed) Exonic