ID: 1132884899

View in Genome Browser
Species Human (GRCh38)
Location 16:2178367-2178389
Sequence CGCCTGGCCGGGGGCTCCAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132884899_1132884918 11 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884918 16:2178401-2178423 GCGCCCCGGCCCGGGTCCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 275
1132884899_1132884914 3 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884914 16:2178393-2178415 CCCGGTGGGCGCCCCGGCCCGGG 0: 1
1: 0
2: 3
3: 45
4: 366
1132884899_1132884921 15 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884921 16:2178405-2178427 CCCGGCCCGGGTCCAGGGGCCGG 0: 1
1: 1
2: 2
3: 50
4: 442
1132884899_1132884910 -3 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884910 16:2178387-2178409 GCGGTCCCCGGTGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 12
4: 179
1132884899_1132884916 9 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884916 16:2178399-2178421 GGGCGCCCCGGCCCGGGTCCAGG 0: 1
1: 0
2: 2
3: 44
4: 415
1132884899_1132884912 2 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884912 16:2178392-2178414 CCCCGGTGGGCGCCCCGGCCCGG 0: 1
1: 0
2: 2
3: 29
4: 272
1132884899_1132884917 10 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132884899 Original CRISPR CGCCTGGCCGGGGGCTCCAA GGG (reversed) Exonic
900312853 1:2042852-2042874 TGCCAGGCCGGGAGATCCAAAGG + Intergenic
900396321 1:2454613-2454635 CACCTGGGAGGGGGCTCCAGAGG - Intronic
900421812 1:2559030-2559052 AGCCTGGCATGAGGCTCCAAGGG - Intronic
900495544 1:2974389-2974411 CGCCTGGCCAGGAGAGCCAAGGG + Intergenic
900578646 1:3396625-3396647 GGGCTGGCTGGGGGCTCCCAGGG - Intronic
901628956 1:10638966-10638988 CGCGGGGCCGGGGGCGCCCAGGG + Exonic
901644733 1:10710292-10710314 TGCCTGGCCAGGGACTTCAATGG + Intronic
903343683 1:22671073-22671095 GGCCTGGCGGGGGGCTCAATGGG - Intergenic
903389479 1:22953848-22953870 CGCCTGGCCGCGGGCTTCTACGG - Exonic
903874544 1:26464497-26464519 AGCCTGGCCAGGACCTCCAAGGG - Intronic
904724870 1:32539639-32539661 AGCCTGGCCGCGGGCTCTGACGG + Intronic
911498854 1:98661774-98661796 CTCCCGGCCGGGGGCGCCAACGG + Exonic
915549489 1:156624206-156624228 CGCCTCGCCTGGGTCTCCCAGGG + Intronic
917141603 1:171841374-171841396 CGCCTGGCCTGGTGGTCCGATGG + Intergenic
1062965836 10:1607220-1607242 CCCCTGGCCGAGGTCTCCGAGGG + Intronic
1067337055 10:45374498-45374520 GGCCTGGGCGGGGGCGCCGAGGG + Intronic
1071527343 10:86366266-86366288 AGGCTGGGCGGGGGCCCCAACGG - Intronic
1076604970 10:131683502-131683524 CGCCTTGCCGGGGGCCCCTGGGG + Intergenic
1077354628 11:2109369-2109391 CGGCTGGCCGGGAGCTCCCGGGG - Intergenic
1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG + Intronic
1083667933 11:64285525-64285547 CGCCCGGCCGGGGGCGGCAACGG - Intronic
1084096198 11:66913125-66913147 CGCTTGGCCTGTGGCGCCAAAGG + Intronic
1084526372 11:69700906-69700928 CGCCTGTCCTGGGTCGCCAAGGG - Intronic
1088586090 11:111361165-111361187 CACGTGGGCGGGGGCTCCATGGG - Intronic
1089883213 11:121794854-121794876 CGCCTCGCCGGGGGCTGCCCTGG - Intergenic
1090262363 11:125330775-125330797 GGCCAGGCCGGGAGCTGCAAGGG - Intronic
1094493420 12:30975407-30975429 GGCCTGGCCTGGGGCTTCAAGGG - Intronic
1096226505 12:49869762-49869784 GGCCTGCCCTGGGGCTCCCAGGG - Exonic
1101605728 12:106247082-106247104 CGCCTGGCAGGGTGGGCCAAGGG - Intronic
1102426991 12:112851608-112851630 CGCATGGCCTGGGGCTCCCTGGG - Intronic
1103807424 12:123584385-123584407 AGCCTGGACGGCGGCTCCGAAGG - Intergenic
1113093559 13:106639360-106639382 CGCCTTGCTGGAGGCTCCAGTGG - Intergenic
1113517595 13:110915174-110915196 CCCCTGCCCGGCGGCTCCAGAGG - Intergenic
1113900877 13:113797225-113797247 CCCCTGGCCGGGGCCTCCCAGGG + Intronic
1113946935 13:114049755-114049777 CCCCTGCCAGGGGCCTCCAAGGG - Intronic
1124484418 15:30102430-30102452 CGCCTGGCAGGGGGCAAGAAAGG + Intergenic
1124539491 15:30571427-30571449 CGCCTGGCAGGGGGCAAGAAAGG + Intergenic
1124759159 15:32436145-32436167 CGCCTGGCAGGGGGCAAGAAAGG - Intergenic
1125536157 15:40441869-40441891 CGCCGGGCCGGGGGCGGCAGGGG + Intronic
1126095289 15:45084269-45084291 CGCCAGGCTGGTTGCTCCAAAGG + Intergenic
1128136862 15:65270229-65270251 TGCCTGGCTGGGGTCTCCCAGGG - Intronic
1128322266 15:66702121-66702143 TGCAGGGCCGGAGGCTCCAAGGG - Intergenic
1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG + Intronic
1128979970 15:72179050-72179072 CCCCTGGCAGCGGGCTCCAGAGG + Intronic
1131388522 15:92028244-92028266 CCCCTGGCTGGGGACTTCAACGG - Intronic
1132606140 16:794501-794523 AGCCTGGCCTGGGGCTGCGAGGG + Intronic
1132639160 16:969926-969948 CCCCTGGCCAGGGGATCCAGAGG + Intronic
1132884899 16:2178367-2178389 CGCCTGGCCGGGGGCTCCAAGGG - Exonic
1133171950 16:3987158-3987180 GCCCAGGCTGGGGGCTCCAAGGG - Intronic
1133212815 16:4272602-4272624 GGGCTGGCCGGGGGCTGCAGTGG + Intronic
1137426435 16:48384958-48384980 CGCCGGGCCCGGGGCTCCAGGGG + Intronic
1138443759 16:57050446-57050468 CCCCTCTCCGGGGCCTCCAAGGG - Intronic
1139798497 16:69502196-69502218 CACCTGTCCGGAGGCTTCAAAGG - Intergenic
1141573466 16:84948652-84948674 CGCCCGGCCGGGCACTCCCACGG + Intergenic
1142266873 16:89068016-89068038 TGCCTGCCCGGGGGCTCCTGAGG + Intergenic
1142478746 17:205164-205186 CACCTCGTCGGGGGCTCCTAAGG + Intergenic
1142572010 17:880910-880932 AGCCTGGGCCAGGGCTCCAAGGG + Intronic
1145190690 17:20841015-20841037 CGCCTGGGCCGGGCCTCCACCGG - Intronic
1145254323 17:21314411-21314433 GGCCTGGCTGGGAGCCCCAATGG - Exonic
1146281701 17:31549406-31549428 CTCCTTGCCAGGGGCTGCAAGGG + Intergenic
1147145497 17:38482287-38482309 CGCCTGCCCCGGGCCTCCCAGGG + Intronic
1152347279 17:79760837-79760859 CTCCTGGCCTGGCCCTCCAAGGG - Intergenic
1152781405 17:82228817-82228839 CTCCGGGCCGGGGGCGCCGACGG + Intronic
1152941288 17:83174006-83174028 CGCCTCGTCGGGGCCTCCAGGGG - Intergenic
1153626386 18:7025462-7025484 CACCTGGCCGTGGGCCCCAGGGG - Intronic
1160568066 18:79798915-79798937 CGCGCGGGCGGGGGCTCCACCGG - Intergenic
1160683785 19:424230-424252 CGCCCGGCTGGGGGCTCCCTCGG + Intronic
1161309398 19:3585667-3585689 GGCGCGGCCGGGGGCTCCGAGGG - Exonic
1163316156 19:16542124-16542146 CGCCTTGCCGGGGACCCCAAGGG + Intronic
1163407961 19:17135490-17135512 GGGCTGGCCGGGGGCTCGCACGG - Intronic
1167661430 19:50798136-50798158 CGCCTGGCCTGGTGCTCCAGGGG - Exonic
1168317157 19:55489362-55489384 CGCCTGGCCGATGGCCCCCATGG + Exonic
1168318230 19:55493612-55493634 CGCCTGGCCGATGGCCCCCACGG + Exonic
926109667 2:10173814-10173836 CGCCAGGCCAAGGGCTCCAGAGG - Intronic
926133096 2:10317785-10317807 CGCCAGGGCAGGGCCTCCAATGG - Intronic
934697405 2:96410041-96410063 TGCCTGGCGGGGAGCCCCAAGGG - Intergenic
935124072 2:100207528-100207550 AGCCTGGCCCGGGGCTGAAAAGG + Intergenic
941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG + Intergenic
948455999 2:238104911-238104933 AGCCTGGATGGGGGCTCCAGAGG + Intronic
948599872 2:239101898-239101920 CCCGGGGCCGGGGGCTCCCAGGG - Intronic
948599938 2:239102078-239102100 CCCCGGGCCGGGGGCTTCCAGGG - Intronic
948599952 2:239102114-239102136 CCCCGGGCCGGGGGCTTCCAGGG - Intronic
1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG + Exonic
1172613537 20:36268320-36268342 CCCCAGGGCGGGGGCTCCATTGG + Intronic
1175911482 20:62407238-62407260 GGCCGGGCCCGGGGCTCCACCGG + Exonic
1176125230 20:63472089-63472111 AGCCTGGCCGGGGTCGCCGATGG + Intronic
1179220277 21:39400659-39400681 TGCCTGGCCTGGGATTCCAATGG - Intronic
1179563866 21:42234492-42234514 CACCTGGCTGGGGGCTGCACTGG + Intronic
1181041858 22:20196107-20196129 GGCCTGGCTGGGGGCTCAGAGGG - Intergenic
1181100579 22:20536277-20536299 GGCCTGGCCTGTGGCTCCCAGGG - Intronic
1183028986 22:35087817-35087839 TGCCTGGCCCAGGGCTCCCATGG - Intergenic
1183516522 22:38270050-38270072 CTCCTTGGCGGGGCCTCCAAAGG + Intronic
1184415796 22:44351075-44351097 CACCTGCCCAGGGGCCCCAAAGG + Intergenic
1185019002 22:48362627-48362649 CCCCAGGTCGGGGGATCCAATGG + Intergenic
950410282 3:12831612-12831634 CGACTGGCCGAGGACTCCATAGG - Intronic
954194571 3:48989132-48989154 AGGCAGGCCAGGGGCTCCAAGGG - Intergenic
958833355 3:99115655-99115677 GGTCTGGCCTTGGGCTCCAATGG + Intergenic
959570500 3:107878024-107878046 CGGATGGCCCAGGGCTCCAAAGG - Intergenic
968588981 4:1448434-1448456 AGCCTGGGCTGGGGCCCCAAGGG - Intergenic
968703526 4:2067570-2067592 CGCCTGCCCTGGGGCACCCAGGG + Exonic
968879911 4:3293352-3293374 CGCCCGGCCGGAGGCCCCACAGG - Intronic
969657619 4:8507249-8507271 CGCCTGGTCGGGGGCCCCCATGG - Intergenic
971216737 4:24669005-24669027 CGGCTGGCTGGGGGCTCCTGGGG + Intergenic
971248682 4:24953185-24953207 CATCTGGCTGGGGGCTCCACTGG + Intronic
980305346 4:131053849-131053871 GGCCTGGCAGGGGGCTGGAAGGG - Intergenic
984821923 4:183889682-183889704 GGCCTGGCCGGGGACTTGAATGG + Intronic
985649097 5:1099093-1099115 CGCCTGGGCAGGGGCACCACCGG - Intronic
985995552 5:3595387-3595409 CGCGCGGCCGGGGCCTCCAGGGG - Intergenic
1003567008 6:7230434-7230456 GGCCTGGGCGGGGGCCACAAGGG + Exonic
1004174529 6:13328395-13328417 CTCCTGGCCCTGGGCCCCAACGG - Intronic
1006440981 6:34053476-34053498 CGCCTGGCCTGGGGCCACACAGG + Intronic
1015923292 6:138286778-138286800 CGAATGGCGGGGAGCTCCAAAGG + Exonic
1018856559 6:167679085-167679107 CCCCTGGCCGGGGGCTGCGCTGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1027041461 7:74964592-74964614 CGCCTGGGGGGGGGCTCCCCCGG - Intergenic
1030176537 7:106660534-106660556 CGCCTGGCCGCGGGCTGTAGGGG + Exonic
1031629667 7:124032293-124032315 CCCCTGGCTGGGGGCTCCCCCGG + Exonic
1032024759 7:128432183-128432205 CTCCTGGCCTGTGGCTCCAGGGG - Intergenic
1035345280 7:158193241-158193263 CGGCTGGCCAGGGGCCCCATGGG + Intronic
1039068726 8:33631786-33631808 CCGCTGGCCGCGGGCTCTAACGG + Intergenic
1049539920 8:143203718-143203740 CTCCTGGCCAGGGGCTCCCAGGG + Intergenic
1049540028 8:143204392-143204414 TGCCTGGCACTGGGCTCCAAGGG + Intergenic
1052974457 9:34400922-34400944 CGCCGGGGCGGGGCCGCCAAGGG - Exonic
1055290499 9:74778052-74778074 CGCCTGGGCTGGGGCTAGAAAGG + Intronic
1059021232 9:110579182-110579204 CGCGTGGCCGTGGGCACCACGGG + Exonic
1060547924 9:124471503-124471525 AGCCTGGCCTGGGGCTCAGAGGG - Intronic
1060988702 9:127836148-127836170 CTCCCGGCCGGGGGCCCCAGAGG + Intronic
1061209987 9:129185897-129185919 CGCCTGGCCTGTGGCTTCAAAGG + Intergenic
1062249951 9:135588925-135588947 CCCTTGGGCAGGGGCTCCAAGGG - Intergenic
1062278715 9:135742578-135742600 CCCGTGCCCGGGGGCGCCAAAGG + Intronic
1062318959 9:135981226-135981248 AGCCTGGCAGGGGGCACCCACGG - Intergenic
1062658127 9:137614630-137614652 GGCCTGGCCGGGGGCTCACTGGG - Exonic
1185463969 X:344566-344588 CGCCGGGCCGGGGGTTCACAGGG + Intronic
1192847943 X:74925179-74925201 CGGCTGCCCGGCTGCTCCAAGGG + Exonic