ID: 1132884910

View in Genome Browser
Species Human (GRCh38)
Location 16:2178387-2178409
Sequence GCGGTCCCCGGTGGGCGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132884896_1132884910 4 Left 1132884896 16:2178360-2178382 CCTAGAGCCCTTGGAGCCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 283
Right 1132884910 16:2178387-2178409 GCGGTCCCCGGTGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 12
4: 179
1132884899_1132884910 -3 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884910 16:2178387-2178409 GCGGTCCCCGGTGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 12
4: 179
1132884893_1132884910 23 Left 1132884893 16:2178341-2178363 CCCGCGGGCGCAGGGTCTGCCTA 0: 1
1: 0
2: 1
3: 5
4: 75
Right 1132884910 16:2178387-2178409 GCGGTCCCCGGTGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 12
4: 179
1132884894_1132884910 22 Left 1132884894 16:2178342-2178364 CCGCGGGCGCAGGGTCTGCCTAG 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1132884910 16:2178387-2178409 GCGGTCCCCGGTGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 12
4: 179
1132884900_1132884910 -4 Left 1132884900 16:2178368-2178390 CCTTGGAGCCCCCGGCCAGGCGG 0: 1
1: 0
2: 3
3: 23
4: 227
Right 1132884910 16:2178387-2178409 GCGGTCCCCGGTGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132884910 Original CRISPR GCGGTCCCCGGTGGGCGCCC CGG Exonic