ID: 1132884917

View in Genome Browser
Species Human (GRCh38)
Location 16:2178400-2178422
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132884904_1132884917 0 Left 1132884904 16:2178377-2178399 CCCCGGCCAGGCGGTCCCCGGTG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1132884903_1132884917 1 Left 1132884903 16:2178376-2178398 CCCCCGGCCAGGCGGTCCCCGGT 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1132884896_1132884917 17 Left 1132884896 16:2178360-2178382 CCTAGAGCCCTTGGAGCCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 283
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1132884900_1132884917 9 Left 1132884900 16:2178368-2178390 CCTTGGAGCCCCCGGCCAGGCGG 0: 1
1: 0
2: 3
3: 23
4: 227
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1132884909_1132884917 -6 Left 1132884909 16:2178383-2178405 CCAGGCGGTCCCCGGTGGGCGCC 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1132884907_1132884917 -2 Left 1132884907 16:2178379-2178401 CCGGCCAGGCGGTCCCCGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1132884899_1132884917 10 Left 1132884899 16:2178367-2178389 CCCTTGGAGCCCCCGGCCAGGCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207
1132884905_1132884917 -1 Left 1132884905 16:2178378-2178400 CCCGGCCAGGCGGTCCCCGGTGG 0: 1
1: 0
2: 1
3: 14
4: 189
Right 1132884917 16:2178400-2178422 GGCGCCCCGGCCCGGGTCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type