ID: 1132886002

View in Genome Browser
Species Human (GRCh38)
Location 16:2182263-2182285
Sequence CAGACGCATGGGGCCACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1740
Summary {0: 1, 1: 0, 2: 2, 3: 120, 4: 1617}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132885998_1132886002 -9 Left 1132885998 16:2182249-2182271 CCGAGTCATGGACACAGACGCAT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1132886002 16:2182263-2182285 CAGACGCATGGGGCCACACCTGG 0: 1
1: 0
2: 2
3: 120
4: 1617
1132885990_1132886002 29 Left 1132885990 16:2182211-2182233 CCAGGCAGCCACGAGTACAGCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1132886002 16:2182263-2182285 CAGACGCATGGGGCCACACCTGG 0: 1
1: 0
2: 2
3: 120
4: 1617
1132885994_1132886002 21 Left 1132885994 16:2182219-2182241 CCACGAGTACAGCACCATGGGGA 0: 1
1: 0
2: 4
3: 23
4: 109
Right 1132886002 16:2182263-2182285 CAGACGCATGGGGCCACACCTGG 0: 1
1: 0
2: 2
3: 120
4: 1617
1132885995_1132886002 7 Left 1132885995 16:2182233-2182255 CCATGGGGAGACACACCCGAGTC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1132886002 16:2182263-2182285 CAGACGCATGGGGCCACACCTGG 0: 1
1: 0
2: 2
3: 120
4: 1617
1132885997_1132886002 -8 Left 1132885997 16:2182248-2182270 CCCGAGTCATGGACACAGACGCA 0: 1
1: 0
2: 1
3: 13
4: 131
Right 1132886002 16:2182263-2182285 CAGACGCATGGGGCCACACCTGG 0: 1
1: 0
2: 2
3: 120
4: 1617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132886002 Original CRISPR CAGACGCATGGGGCCACACC TGG Intronic
900153594 1:1193604-1193626 CAGGCGCATGCCACCACACCCGG + Intronic
900196417 1:1378327-1378349 CAGGCGCACGCCGCCACACCCGG + Intergenic
900275271 1:1821990-1822012 CAGGAGCATGCTGCCACACCTGG - Intronic
900660748 1:3781836-3781858 CAGGTGCATGGCACCACACCTGG - Intronic
901315546 1:8305202-8305224 CAGGCACATGCCGCCACACCTGG - Intergenic
901346234 1:8545824-8545846 CAGACGCGTGCCACCACACCCGG + Intronic
901480848 1:9524121-9524143 TAGGCGCATGCTGCCACACCTGG - Intergenic
901608977 1:10481962-10481984 CAGGCGCATGCCACCACACCTGG + Intronic
901861636 1:12078419-12078441 CAGGCGCTTGGCACCACACCTGG - Intronic
902047440 1:13536385-13536407 CAGGCGCATGCCACCACACCTGG + Intergenic
902049225 1:13548744-13548766 CAGACGCGTGCCACCACACCTGG - Intergenic
902284304 1:15396665-15396687 CAGGCACATGCCGCCACACCCGG - Intronic
902307704 1:15555242-15555264 CAGGAGCATGCTGCCACACCTGG - Intronic
902317218 1:15630984-15631006 CAGGCGCATGCTGCCACACCTGG + Intronic
902705805 1:18203449-18203471 CAGGTGCATGCCGCCACACCTGG + Intronic
902827425 1:18986564-18986586 TAGACGCATGCCACCACACCTGG + Intergenic
902915743 1:19638189-19638211 CAGGCACATGCCGCCACACCTGG + Intronic
902929208 1:19718508-19718530 CAGGCGCATGCCACCACACCTGG - Intronic
903090739 1:20913947-20913969 CAGGCGCATGCCGCCACGCCTGG + Intronic
903191405 1:21658423-21658445 CAGGCGCATGCCACCACACCTGG - Intronic
903279128 1:22240086-22240108 CAGGCGCATGCCACCACACCTGG + Intergenic
903333167 1:22607838-22607860 CAGGCGCATGCCACCACACCTGG + Intergenic
903464061 1:23539902-23539924 AAGACGCAGGGGGACCCACCAGG - Intergenic
903532194 1:24039628-24039650 CAGGCGCATGCCACCACACCTGG - Intergenic
903594491 1:24483830-24483852 CAGGCGCATGCCACCACACCTGG - Intergenic
903595200 1:24488823-24488845 CAGACGCCTGCCACCACACCCGG - Intergenic
903609743 1:24601896-24601918 CAGGCGCACGCCGCCACACCCGG - Intronic
903842805 1:26256386-26256408 CAGGCGCATGCCACCACACCTGG - Intronic
903905700 1:26684566-26684588 CAGGCGCATGACACCACACCCGG + Intergenic
903932176 1:26868954-26868976 CAGGCGCATGCCGCCACACCTGG - Intergenic
903947590 1:26973433-26973455 CAGGCGCATGCCACCACACCCGG - Intergenic
903960209 1:27052321-27052343 CAGGCGCATGCCGCCACGCCCGG - Intergenic
904234616 1:29107038-29107060 CAGGCGCATGCCACCACACCTGG - Intronic
904249717 1:29214502-29214524 CAGACGCATGCCACCACACCCGG + Intronic
904521819 1:31101586-31101608 CAGGCGCATGCCACCACACCTGG - Intergenic
904530245 1:31163855-31163877 CAGGCGCATGCCACCACACCCGG - Intergenic
904550700 1:31314807-31314829 CAGGCGCATGCCACCACACCTGG + Intronic
904557718 1:31376044-31376066 CAGGCGCATGGCACCACGCCTGG + Intronic
904653133 1:32021757-32021779 CAGGCGCATGACACCACACCTGG + Intronic
904658607 1:32068113-32068135 CAGGTGCACGTGGCCACACCCGG - Intergenic
904687064 1:32268049-32268071 CAGGCGCGTGCCGCCACACCTGG - Intronic
904867259 1:33590262-33590284 CAGACTCATGCCACCACACCTGG + Intronic
905073073 1:35244882-35244904 CAGGCACATGCCGCCACACCTGG - Intergenic
905084235 1:35356065-35356087 CAGGCGCATGCCGCCACATCTGG - Intronic
905155605 1:35977533-35977555 CAGACACATGTTACCACACCTGG + Intronic
905195285 1:36271734-36271756 CAGACGCATACCACCACACCCGG + Intronic
905373782 1:37503816-37503838 CAGGCGCCTGCCGCCACACCTGG - Intronic
905408110 1:37751060-37751082 CAGGGGCATGCAGCCACACCCGG - Intronic
905431036 1:37923918-37923940 CAGACGCAAGCCACCACACCTGG + Intronic
905574857 1:39035915-39035937 CAGGCGCGTGCTGCCACACCTGG + Intergenic
905681507 1:39875343-39875365 CAGACGCATGCCACCACGCCTGG - Intronic
905729242 1:40284607-40284629 CAGGCGCATGCCACCACACCCGG - Intronic
905759155 1:40539170-40539192 CAGGCGCATGCCACCACACCCGG + Intronic
905760001 1:40548379-40548401 CAGGCGCATGCCACCACACCTGG + Intergenic
905992341 1:42349258-42349280 CAGGCGCATGCCACCACACCCGG + Intergenic
906012202 1:42538185-42538207 CAGACACATGCCACCACACCTGG - Intronic
906012536 1:42542500-42542522 CAGGCACATGGCACCACACCTGG + Intronic
906077353 1:43061813-43061835 CAGGCGCCTGCAGCCACACCCGG - Intergenic
906232685 1:44179180-44179202 CAGACGCATGCTACCACACCCGG - Intergenic
906298873 1:44666984-44667006 CAGGCACATGGTACCACACCTGG + Intronic
906397527 1:45479963-45479985 CAGGCGCATGCCACCACACCCGG + Intronic
906429718 1:45745721-45745743 CAGGCGCATGCCACCACACCTGG - Intronic
906463509 1:46056191-46056213 CAGGCGCATGCCACCACACCCGG + Intronic
906625324 1:47320235-47320257 CAGGCGCATGCCACCACACCCGG - Intergenic
906772433 1:48496918-48496940 CAGACGCATGCCACCACACCTGG + Intergenic
906989529 1:50723256-50723278 CAGGAGCATGCCGCCACACCTGG - Intronic
907208865 1:52800664-52800686 CAGGCGCATGCCACCACACCTGG - Intronic
907361124 1:53916040-53916062 CAGACACATGCCACCACACCTGG - Intergenic
907361414 1:53918979-53919001 CAGGCGCATGCCACCACACCTGG + Intronic
907511961 1:54968284-54968306 CAGGCGCATGCCACCACACCCGG + Intergenic
907886702 1:58598597-58598619 CAGACGCATGGGGGCATCCTTGG - Intergenic
907894745 1:58676271-58676293 CAGGCGCATGCCACCACACCTGG - Intronic
907966415 1:59334283-59334305 CAGGCACATGGCACCACACCTGG + Intronic
908518380 1:64916693-64916715 CAGATGCATGCCACCACACCTGG - Intronic
908545763 1:65160735-65160757 CAGGCGCATGCCACCACACCTGG + Intronic
908760484 1:67507192-67507214 CAGGCGCATGCCACCACACCCGG + Intergenic
909027042 1:70494162-70494184 CAGATGCATGCTGCCACACCTGG - Intergenic
909191389 1:72557090-72557112 CAGGCACATGCCGCCACACCCGG + Intergenic
909668772 1:78165095-78165117 CAGACGCATGCCACCACACCTGG - Intergenic
909853421 1:80498323-80498345 CAGACACGTGCCGCCACACCTGG - Intergenic
909940350 1:81604104-81604126 CAGGCGCATGCCACCACACCCGG + Intronic
910259060 1:85278400-85278422 CAGGCGCATGCCACCACACCCGG + Intergenic
910326334 1:86012444-86012466 CAGGCGCATGCCACCACACCAGG - Intronic
910595516 1:88976212-88976234 CAGGCGCATGCCACCACACCCGG - Intronic
910888480 1:91991847-91991869 CAGGCGCATGGCGCCATGCCCGG - Intronic
910932383 1:92455327-92455349 CAGGCTCATGCTGCCACACCTGG - Intergenic
910939514 1:92518038-92518060 CAGGTGCATGGCACCACACCTGG + Intronic
910942838 1:92555705-92555727 CAGGCACATGCCGCCACACCTGG - Intronic
911008353 1:93252178-93252200 CAGGTGCATGCTGCCACACCTGG + Intronic
911039553 1:93581017-93581039 CAGGCGCATGCCACCACACCTGG - Intronic
911053182 1:93689386-93689408 CAGACGCGTGCCACCACACCCGG - Intronic
911070559 1:93828833-93828855 CAGGCGCATGCTACCACACCCGG + Intronic
911135758 1:94438142-94438164 CAGGCGCATGCCACCACACCCGG - Intronic
911156852 1:94645521-94645543 CAGACGCACGCCACCACACCTGG - Intergenic
911214543 1:95178091-95178113 CAGGCGCATGCTGCCACACCCGG + Intronic
911583192 1:99658801-99658823 CAGATGCATGTCACCACACCTGG - Intronic
912039979 1:105377691-105377713 CAGATGCATGCCACCACACCTGG - Intergenic
912236775 1:107860261-107860283 CACATGCATGGCACCACACCTGG + Intronic
912662885 1:111549505-111549527 CAGGCGCATGCCACCACACCAGG - Intronic
912704344 1:111900812-111900834 CAGGCGCATGCCACCACACCCGG - Intronic
912832634 1:112967307-112967329 CAGGCGCATGCCACCACACCAGG + Intergenic
912862295 1:113224972-113224994 CAGGCGCGTGCCGCCACACCTGG + Intergenic
912970937 1:114282213-114282235 CAGGCGCATGCCACCACACCTGG - Intergenic
912992112 1:114498504-114498526 CAGGCGCATGCCACCACACCTGG - Intronic
913203703 1:116516851-116516873 AAGAAGCTTGTGGCCACACCAGG - Intronic
913356224 1:117925308-117925330 CAGATGCATGCCACCACACCTGG - Intronic
913475187 1:119230286-119230308 CAGGCGCATGCCGCCACGCCTGG + Intergenic
913586554 1:120280273-120280295 CAGACGCCTGCTACCACACCTGG + Intergenic
913621632 1:120618097-120618119 CAGACGCCTGCTACCACACCTGG - Intergenic
914372073 1:147035027-147035049 CAGGTGCATGCCGCCACACCTGG + Intergenic
914604259 1:149238116-149238138 CAGACGCCTGCTACCACACCTGG - Intergenic
914692833 1:150046588-150046610 CAGGCGCATGCAACCACACCTGG + Intergenic
914735194 1:150409785-150409807 CAGACGCATGCCACCACACCCGG + Intronic
914749579 1:150525320-150525342 CAGGTGCATGGCACCACACCTGG - Intergenic
914800496 1:150958392-150958414 CAGATGCATGCCACCACACCCGG + Intronic
915404758 1:155651265-155651287 CAGACGCCTGGCACCACGCCCGG - Intergenic
915451715 1:156009914-156009936 CAGGCGCATGCCACCACACCTGG + Intronic
915483620 1:156204627-156204649 CAGGCGCCTGCTGCCACACCCGG + Intronic
915501755 1:156323903-156323925 CAGGCGCATGCAACCACACCTGG + Intronic
915844012 1:159243361-159243383 CAGGCGCATGCCACCACACCAGG + Intergenic
915968318 1:160331803-160331825 CAGATGCATGTGACCACACCTGG - Intronic
916220282 1:162437311-162437333 CAGGCGCACGCCGCCACACCCGG - Intergenic
916259516 1:162827255-162827277 CAGGCGCATGCCACCACACCTGG + Intronic
916275715 1:162991162-162991184 CAGGCACATGCCGCCACACCTGG - Intergenic
916677881 1:167079347-167079369 CAGGTGCATGCTGCCACACCTGG - Intronic
916800341 1:168209994-168210016 CAGGCGCATGCTACCACACCTGG - Intergenic
917129832 1:171729800-171729822 CAGGCGCATGCCACCACACCTGG + Intronic
917431326 1:174972709-174972731 CGGGCGCATGCCGCCACACCTGG - Intronic
917837446 1:178952611-178952633 CAGGCGCATGCCACCACACCTGG - Intergenic
917937237 1:179880968-179880990 CAGGCGCATGCCGCCACGCCCGG - Intergenic
917954678 1:180082455-180082477 CAGGCGCATGCTGCCACACCTGG + Intronic
918252238 1:182713324-182713346 CAGGCGCATGCCACCACACCTGG + Intergenic
918262298 1:182806979-182807001 CAGGCGCATGTCACCACACCTGG + Intronic
918350477 1:183650398-183650420 CAGGCGCATGCCACCACACCTGG - Intronic
918606469 1:186432926-186432948 CAGGCGCATGGCAACACACCAGG + Intergenic
918685004 1:187403420-187403442 CAGGCGCATGCCACCACACCTGG - Intergenic
919237453 1:194864689-194864711 CAGACGCATGCCACCATACCTGG + Intergenic
919407535 1:197203465-197203487 CAGGCGCATGCTACCACACCGGG + Intergenic
919906388 1:202081323-202081345 CAGGTGCATGGTACCACACCCGG - Intergenic
920065042 1:203263203-203263225 CAGATGCATGCCACCACACCTGG + Intronic
920138588 1:203790806-203790828 CAGATGCATGCCACCACACCTGG + Intergenic
920527351 1:206677063-206677085 CAGGCGCATGCAACCACACCAGG - Intronic
921082665 1:211755193-211755215 CAGGCGCATGCTGCCACACCTGG - Intronic
921247033 1:213255162-213255184 CACAGGCATGGGACCACACTTGG - Intronic
921661029 1:217803053-217803075 CAGGCGCATGCCACCACACCTGG + Intronic
922026590 1:221755444-221755466 CAGGCGCATGCCACCACACCTGG + Intergenic
922380613 1:225020352-225020374 CAGACACATGCCACCACACCTGG - Intronic
922453755 1:225757701-225757723 CAGGCGCATGCCACCACACCTGG - Intergenic
922459182 1:225801546-225801568 CAGGCGCATGCCACCACACCTGG - Intergenic
922532107 1:226352633-226352655 CAGGCGCATGCCACCACACCAGG - Intergenic
923151055 1:231233693-231233715 CAGGCGCATGCCACCACACCCGG + Intronic
923164250 1:231344362-231344384 CAGGCGCATGTCACCACACCTGG - Intronic
923173116 1:231435321-231435343 CAGACACATGCCACCACACCCGG - Intergenic
923184094 1:231552846-231552868 CAGACGCAAGAGGCCATACATGG - Intronic
923992177 1:239451079-239451101 CAGATGCATGCCACCACACCTGG - Intronic
924239374 1:242026340-242026362 CAGGCGCCTGCCGCCACACCTGG - Intergenic
924396658 1:243628440-243628462 CAGAGGCATGCCACCACACCTGG + Intronic
924516713 1:244772106-244772128 CAGGCGCATGCTACCACACCTGG - Intergenic
924541042 1:244981038-244981060 CAGACGCCTGCCACCACACCTGG - Intronic
1062851365 10:745280-745302 CAGGCACATGCTGCCACACCTGG + Intergenic
1062899933 10:1135933-1135955 CAGATGCATGCCACCACACCTGG + Intergenic
1062920955 10:1279456-1279478 CAGACACAGGGTGCCATACCTGG + Intronic
1062942098 10:1430595-1430617 CAGATGCATGCCGCCACACCTGG - Intronic
1063247869 10:4241976-4241998 TAAACCCATGGGGCCACATCTGG - Intergenic
1063422922 10:5927927-5927949 CAGATGCATGCCACCACACCTGG - Intronic
1063610590 10:7558532-7558554 CAGGTGCATGCTGCCACACCTGG + Intergenic
1063627262 10:7701853-7701875 CAGGCGCATGCCACCACACCTGG + Intergenic
1063974759 10:11406350-11406372 CAGACACCTGCAGCCACACCAGG + Intergenic
1064019243 10:11796081-11796103 CAGAGGCATGCCACCACACCCGG - Intergenic
1064053088 10:12074981-12075003 CAGGCACATGCGACCACACCCGG - Intronic
1064107660 10:12513656-12513678 CAGATGCATGCCACCACACCTGG - Intronic
1064130343 10:12703724-12703746 CAGGCGCATGCCACCACACCTGG - Intronic
1064161352 10:12949260-12949282 CTTACTCATGTGGCCACACCCGG - Intronic
1064207204 10:13334396-13334418 CAGGCGCATGCTACCACACCCGG - Intronic
1064548616 10:16476224-16476246 CAGACGCGTGCCACCACACCTGG + Intronic
1064556428 10:16551126-16551148 CAGACACATGCCACCACACCCGG - Intergenic
1064747539 10:18492476-18492498 CAGGCGCATGCCACCACACCCGG - Intronic
1064762881 10:18639349-18639371 CAGGCGCATGCCACCACACCTGG - Intronic
1064948286 10:20817222-20817244 CAGGCACATGCTGCCACACCTGG - Intronic
1065183743 10:23151917-23151939 CAGGCGCATGCCACCACACCTGG - Intergenic
1065337993 10:24674389-24674411 CAGGCGCATGCCACCACACCTGG - Intronic
1065379582 10:25076336-25076358 CAGGCGCATGCTACCACACCCGG + Intergenic
1065608583 10:27447166-27447188 CAGGCGCATGCTACCACACCCGG + Intergenic
1065905692 10:30249136-30249158 CAGAAGCATGCCACCACACCTGG + Intergenic
1065925417 10:30431064-30431086 CAGGCGCATGCCACCACACCCGG - Intergenic
1065948432 10:30628015-30628037 CAGACACATGCCACCACACCCGG - Intronic
1065999236 10:31088638-31088660 CAGGCCCATGCTGCCACACCCGG - Intergenic
1066398428 10:35050176-35050198 CAGGCGCATGCCACCACACCAGG - Intronic
1066414058 10:35203186-35203208 CAGACGCACGCCACCACACCTGG + Intronic
1066496996 10:35951791-35951813 CAGGTGCATGCCGCCACACCTGG + Intergenic
1066552310 10:36572517-36572539 CAGGCACATGCCGCCACACCTGG + Intergenic
1066604227 10:37143509-37143531 CAGGTGCATGCCGCCACACCTGG - Intronic
1066689549 10:38012572-38012594 CAGGCGCATGCTGCCACGCCTGG + Intronic
1067097109 10:43308754-43308776 CAGATGCCCAGGGCCACACCTGG - Intergenic
1067115112 10:43429482-43429504 CAGGCGCATGCCACCACACCTGG - Intergenic
1067487760 10:46667735-46667757 CAGATGCATGCCACCACACCTGG - Intergenic
1067607046 10:47674272-47674294 CAGATGCATGCCACCACACCTGG + Intergenic
1068329597 10:55545551-55545573 CAGGCGCACGCTGCCACACCTGG + Intronic
1069034419 10:63631689-63631711 CAGTCGCATGCCACCACACCTGG + Intergenic
1069036203 10:63648522-63648544 CAGGCGCGTGGCACCACACCTGG - Intergenic
1069287671 10:66736326-66736348 CAGGCGCACGCCGCCACACCCGG + Intronic
1069359565 10:67626037-67626059 CAGATGCATGCCACCACACCTGG - Intronic
1069445872 10:68472587-68472609 CAGACGCATGCCACCACGCCCGG - Intergenic
1069470033 10:68679814-68679836 CAGGCGCATGCCACCACACCTGG + Intronic
1069483374 10:68803906-68803928 CAGACGCGTGCTACCACACCCGG - Intergenic
1069507797 10:69017289-69017311 CAGGCGCACGCGGCCACGCCCGG - Intergenic
1069561934 10:69436573-69436595 CAGGCGCATGCCACCACACCTGG + Intergenic
1069667302 10:70171068-70171090 CAGGCGCATGTCACCACACCTGG + Intergenic
1069812322 10:71171457-71171479 CAGATGCATGCCACCACACCTGG + Intergenic
1069937637 10:71929335-71929357 CAGACGCCCGCCGCCACACCCGG + Intergenic
1069979414 10:72241984-72242006 CAGATGCATGCCACCACACCTGG + Intergenic
1069985677 10:72281483-72281505 CAGGCACATGCTGCCACACCCGG + Intergenic
1069989307 10:72304779-72304801 CAGGCGCATGCCGCCACGCCCGG - Intergenic
1069998435 10:72357819-72357841 CAGGCGCATGCCACCACACCTGG - Intergenic
1070047853 10:72857087-72857109 CAGACACATGTCGCCACATCTGG + Intronic
1070088187 10:73256758-73256780 CAGGCGCATGCCACCACACCCGG - Intronic
1070335211 10:75449007-75449029 CAGGCGCATGCCACCACACCTGG - Intronic
1070569927 10:77633170-77633192 CAGGCGCACGCTGCCACACCTGG - Intronic
1070646054 10:78203240-78203262 CAGCAACATGAGGCCACACCAGG - Intergenic
1070871526 10:79758263-79758285 CAGACGCGAGCTGCCACACCTGG - Intergenic
1070897652 10:79998581-79998603 CAGACGCATGCCACCACGCCCGG - Intergenic
1070954243 10:80454153-80454175 CAGGCGCCCGGGGCCGCACCGGG + Exonic
1071397353 10:85237340-85237362 CAGGCACATGCCGCCACACCCGG + Intergenic
1071622602 10:87135634-87135656 CAGATGCATGCCACCACACCTGG + Intronic
1071638458 10:87280471-87280493 CAGACGCGAGCTGCCACACCTGG - Intergenic
1071656784 10:87457481-87457503 CAGACGCGAGCTGCCACACCTGG + Intergenic
1071863875 10:89703893-89703915 CAGGCGCATGCCACCACACCCGG + Intronic
1072104425 10:92260406-92260428 CAGGCGCATGCCACCACACCTGG - Intronic
1072139348 10:92575678-92575700 CAGACGCATGCCACCACGCCTGG - Intergenic
1072252806 10:93594996-93595018 CAGACGCATGTCACCCCACCTGG - Intronic
1072645760 10:97252198-97252220 CAGGCGCATGCCACCACACCTGG - Intronic
1072691620 10:97575766-97575788 CAGGCGCATGCCGCCACGCCTGG - Intronic
1072704274 10:97669006-97669028 CAGGTGCATGGCACCACACCTGG + Intronic
1072752115 10:97988575-97988597 CAGGCACATGCTGCCACACCCGG - Intronic
1073015744 10:100397774-100397796 CAGGCGCATGCCACCACACCTGG + Intergenic
1073191521 10:101653976-101653998 CAGATGCATGCCACCACACCTGG - Intronic
1073283812 10:102375029-102375051 CAGGTGCATGTGACCACACCTGG - Intronic
1073350710 10:102817814-102817836 CAGTCGCATGCCACCACACCTGG - Intergenic
1073357904 10:102871402-102871424 CAGGCGCGTGCCGCCACACCCGG - Intronic
1073490068 10:103847454-103847476 CAGGCGCATGCCTCCACACCTGG + Intronic
1073503475 10:103964187-103964209 CAGATGCATGACACCACACCCGG + Intergenic
1073513345 10:104056437-104056459 CAGGCGCATGTCACCACACCTGG - Intronic
1073706334 10:105988561-105988583 CAGATGCATGCCACCACACCAGG - Intergenic
1073781283 10:106841325-106841347 CAGGCGCATGCCACCACACCAGG - Intronic
1074461991 10:113646751-113646773 CAGACAAATGGGGCCAAAGCAGG + Intronic
1074576440 10:114674145-114674167 CAGGCGCATGCCACCACACCTGG - Intronic
1074751780 10:116593813-116593835 CAGGCGCCTGCGACCACACCTGG - Intronic
1074951637 10:118342523-118342545 CAGACGCATTGGCCTACAGCAGG - Intergenic
1075199347 10:120389189-120389211 CAGGTGCCTGGGACCACACCTGG + Intergenic
1075583168 10:123637647-123637669 CAGACTCCTGGGGCCCCACTGGG - Intergenic
1075730479 10:124632579-124632601 CAGCTGCCTGGGGCCACATCGGG + Intronic
1075757922 10:124830300-124830322 CAGGTGCATGCTGCCACACCTGG - Intronic
1076525636 10:131110859-131110881 CACACGCATGGGGCACCTCCAGG - Intronic
1076846285 10:133071068-133071090 CAACCGCTGGGGGCCACACCCGG + Intronic
1077328004 11:1971949-1971971 CAGGCACGTGGGGCCACCCCAGG + Intronic
1078223155 11:9368524-9368546 CAGGTGCATGCCGCCACACCTGG + Intergenic
1078325431 11:10376806-10376828 CAGGCGCATGCCGCCACACCCGG + Intronic
1078481507 11:11680165-11680187 CAGACGCACGCCACCACACCTGG - Intergenic
1079000771 11:16753503-16753525 CAGGTGCATGCCGCCACACCAGG + Intronic
1079001423 11:16760273-16760295 CAGGCGCATGCCACCACACCCGG + Intergenic
1079170171 11:18086257-18086279 CAGGCACATGACGCCACACCTGG - Intronic
1079353112 11:19709690-19709712 CAGGCGCATGCCACCACACCCGG - Intronic
1079628481 11:22645363-22645385 CAGGCGCATGCTACCACACCTGG - Intronic
1079770657 11:24454441-24454463 CAGACGCGTGCCACCACACCCGG + Intergenic
1080581435 11:33647231-33647253 TAGGCGCATGCCGCCACACCTGG - Intronic
1080741842 11:35072505-35072527 CAGACGCTTGCAGCCACACCTGG - Intergenic
1081129432 11:39360165-39360187 CAGATGCATGCCACCACACCTGG - Intergenic
1081261479 11:40966646-40966668 CAGAGGCATGAGGCTACCCCAGG - Intronic
1081464667 11:43305334-43305356 CAGGCGCGTGCCGCCACACCCGG - Intergenic
1081571106 11:44291549-44291571 CAGGCACATGCCGCCACACCTGG + Intronic
1081580774 11:44350160-44350182 CAGAAGCATGCCACCACACCTGG + Intergenic
1081796112 11:45821114-45821136 CAGGCGCATGCAGCCACGCCCGG - Intergenic
1081801717 11:45864475-45864497 CAGGCACATGCTGCCACACCCGG - Intronic
1081883066 11:46470617-46470639 CAGGCCCATGGTGCCACACCTGG - Intronic
1081904092 11:46655428-46655450 CAGACGCATGCCACCACGCCCGG - Intronic
1081987081 11:47313455-47313477 CAGGCGTATGCTGCCACACCTGG + Intronic
1082055944 11:47816631-47816653 CAGACGCATGCCACCACACCCGG - Intronic
1082082660 11:48024338-48024360 CAGACGCATGCCACCACAGCCGG + Intronic
1082232719 11:49788368-49788390 CAGGCGCACGCAGCCACACCTGG - Intergenic
1082848732 11:57746470-57746492 CAGGCGCATGCTGCCACACCCGG + Intronic
1083443489 11:62691907-62691929 CAGGCGCCTGCGACCACACCTGG - Intronic
1083466633 11:62851270-62851292 CAGCCGCATGCCACCACACCCGG - Intergenic
1083760932 11:64817186-64817208 CAGGCGCATGCCACCACACCTGG - Intergenic
1083764766 11:64836479-64836501 CAGACGGATGGGCCCCCAGCTGG - Exonic
1084025719 11:66447814-66447836 CAGGCGCACGGCGTCACACCAGG + Intronic
1084073399 11:66752984-66753006 CAGCCGCATACTGCCACACCTGG - Intronic
1084077828 11:66795442-66795464 CAGGCGCATGCCACCACACCTGG + Intronic
1084102087 11:66956440-66956462 CAGGCGCATGCCACCACACCTGG - Intronic
1084120465 11:67066108-67066130 CAGACTCCTGGGCCCACTCCTGG - Intronic
1084303374 11:68265628-68265650 CAGGCGCATGCCACCACACCTGG + Intronic
1084401225 11:68944605-68944627 CAGACGCGTGCCACCACACCTGG + Intergenic
1084504669 11:69557880-69557902 CAGGCGCATGCCACCACACCTGG + Intergenic
1084522276 11:69671041-69671063 CAGACACATGGCACCACGCCCGG + Intronic
1084861397 11:72020728-72020750 CAGGCGCATGCCACCACACCTGG - Intronic
1084999381 11:73016158-73016180 CAGGCGCATGCTACCACACCCGG - Intronic
1085193080 11:74646113-74646135 CAGGCGCATGCCACCACACCTGG + Intronic
1085461249 11:76695166-76695188 CAGACGCATGCCACCACACCCGG - Intergenic
1085484161 11:76847895-76847917 CAGGCGCATGACACCACACCTGG + Intergenic
1085602388 11:77866981-77867003 CAGGCGCATGTCACCACACCCGG + Intronic
1085624070 11:78058553-78058575 CAGACGCTTGCCACCACACCTGG + Intronic
1085670685 11:78461808-78461830 CAGACGCATGCCACCACACCCGG - Intronic
1086036712 11:82424672-82424694 CAGATGCATGCTGCCACGCCCGG - Intergenic
1086164573 11:83762721-83762743 CAGGCGCATGCCGCCACGCCTGG + Intronic
1086278074 11:85155725-85155747 CAGGCGCATGCCACCACACCTGG - Intronic
1086459735 11:86994712-86994734 CAGGCGCATGGCACCCCACCTGG - Intergenic
1086498575 11:87428884-87428906 CAGATGCATGCCACCACACCCGG + Intergenic
1087243083 11:95802395-95802417 CAGACACATGCCACCACACCTGG + Intronic
1087434042 11:98090418-98090440 CAGGCGCATGCCACCACACCGGG + Intergenic
1087754135 11:102037301-102037323 CAGATGCATGCCACCACACCTGG + Intergenic
1087813718 11:102635595-102635617 CAGACACATGCCACCACACCCGG - Intergenic
1088297661 11:108318217-108318239 CAGGCGCATGCTGCCACGCCTGG - Intronic
1088303886 11:108387668-108387690 CAGATGCATGTCACCACACCTGG + Intronic
1088505498 11:110522995-110523017 CAGCCGCATGCCACCACACCAGG + Intergenic
1088666800 11:112101345-112101367 CAGGCGCATGCCACCACACCCGG - Intronic
1088935043 11:114391027-114391049 CAGACGCCTGCCACCACACCTGG - Intergenic
1088950141 11:114560402-114560424 CAGGTGCATGCTGCCACACCTGG + Intergenic
1089113418 11:116074671-116074693 CAGCCTCCTGGGGCCACAGCAGG - Intergenic
1089261393 11:117226276-117226298 CAGGCGCATGCCACCACACCCGG + Intronic
1089440723 11:118514581-118514603 CAGGCGCATGCTACCACACCCGG + Intronic
1089468609 11:118703032-118703054 CAGGCGCATGCCACCACACCGGG - Intergenic
1089479832 11:118795492-118795514 CAGGTGCATGCTGCCACACCCGG - Intergenic
1089503183 11:118944876-118944898 CAGGCGCATGCCGCCACACCCGG + Intronic
1089542401 11:119197556-119197578 CAGGCGCATGCCACCACACCTGG + Intergenic
1089627637 11:119761760-119761782 CAGACACATGCCACCACACCTGG + Intergenic
1089972134 11:122702665-122702687 CAGGCGCATGCTACCACACCCGG + Intronic
1090195866 11:124816414-124816436 CAGGTGCATGCTGCCACACCTGG - Intergenic
1090262030 11:125328128-125328150 CAGAGGCTGGAGGCCACACCAGG + Intronic
1090778480 11:129985639-129985661 CAGATGCATGCCACCACACCTGG - Intronic
1202810983 11_KI270721v1_random:27129-27151 CAGGCACGTGGGGCCACCCCAGG + Intergenic
1091466483 12:689192-689214 CAGGCGCATGCCACCACACCCGG - Intergenic
1091700900 12:2661117-2661139 CAGGCACATGGCACCACACCTGG - Intronic
1092120708 12:6041834-6041856 CAAAAGCATGGGTCCACAGCAGG + Intronic
1092188861 12:6502985-6503007 CAGGCGCATGCCACCACACCTGG + Intronic
1092189184 12:6505720-6505742 CAGATGCATGCCACCACACCCGG - Intronic
1092300832 12:7248556-7248578 CAGATGCATGCCACCACACCTGG - Intergenic
1092489879 12:8935481-8935503 TAGACGCATGCTGCCACACCAGG - Intronic
1092795871 12:12109933-12109955 CAGACACATGCCACCACACCTGG + Intronic
1092815707 12:12310754-12310776 CAGGCGCATGCCACCACACCCGG + Intergenic
1092819990 12:12344610-12344632 CAGACGCATGCCACCACGCCCGG + Intronic
1092878530 12:12869727-12869749 CAGGCGCATGCCACCACACCCGG + Intergenic
1093024078 12:14230863-14230885 CAGATGCATGCAACCACACCTGG + Intergenic
1093028758 12:14268729-14268751 CAGACGCCTGCCACCACACCTGG - Intergenic
1093178438 12:15940492-15940514 CAGGCGCATGCCACCACACCTGG + Intronic
1093497942 12:19779328-19779350 CACACTAATGGGGCCCCACCTGG + Intergenic
1094255439 12:28419897-28419919 CAGGCACATGGCACCACACCTGG + Intronic
1094307875 12:29040912-29040934 CAGGTGCATGCTGCCACACCTGG - Intergenic
1094424078 12:30300989-30301011 CAGGCGCATGCCACCACACCTGG + Intergenic
1094463758 12:30728410-30728432 CAGGCGCATGCCACCACACCTGG - Intronic
1094550481 12:31446289-31446311 CAGGCGCATGACACCACACCTGG + Intronic
1094607718 12:31963200-31963222 CAGGCGCATGCCACCACACCTGG - Intronic
1094685815 12:32713700-32713722 CAGGCACATGTGACCACACCTGG - Intronic
1094704359 12:32899803-32899825 CAGACGCGAGCCGCCACACCTGG - Intergenic
1094824877 12:34262173-34262195 CAGGCGCATGCCACCACACCTGG - Intergenic
1095437912 12:42211600-42211622 CAGGCGCATGCCACCACACCTGG - Intronic
1095691575 12:45095446-45095468 CAGGCGCATGCCACCACACCTGG - Intergenic
1095700068 12:45182165-45182187 CAGGCGCATGCCACCACACCCGG + Intergenic
1095785254 12:46102293-46102315 CAGAAGAATCGGGTCACACCTGG - Intergenic
1095889926 12:47226514-47226536 CAGGCGCATGCCACCACACCCGG + Intronic
1095913457 12:47452312-47452334 CAGGCGCATGCCACCACACCTGG + Intergenic
1096064836 12:48731346-48731368 CAGGCACATGCTGCCACACCTGG - Intergenic
1096094910 12:48928185-48928207 CAGAGGCATGCCACCACACCCGG + Intronic
1096097678 12:48947447-48947469 CAGGCGCATGCCACCACACCTGG + Intronic
1096099899 12:48964116-48964138 CAGACACATGCCACCACACCTGG - Intergenic
1096269851 12:50156259-50156281 CAGGCGCACGCTGCCACACCCGG - Intronic
1096288327 12:50319599-50319621 CAGGCGCATGCCACCACACCGGG + Intergenic
1096312353 12:50532370-50532392 CAGGCGCATGCCACCACACCTGG - Intronic
1096314981 12:50556683-50556705 CAGGCGCATGCCACCACACCTGG + Intronic
1096326270 12:50664989-50665011 CAGGTGCATGCTGCCACACCCGG + Intronic
1096391101 12:51229799-51229821 CAGGTGCATGGCACCACACCCGG + Intergenic
1096511982 12:52135645-52135667 CAGGTGCATGGCACCACACCCGG + Intergenic
1096632452 12:52937226-52937248 CAGGTGCATGCTGCCACACCAGG - Intronic
1096654127 12:53078041-53078063 CAGGTGCATGCTGCCACACCTGG - Intronic
1096740915 12:53693565-53693587 CAGGCGCCTGCCGCCACACCTGG - Intergenic
1096939221 12:55323970-55323992 CAGGCACATGCTGCCACACCCGG - Intergenic
1096972147 12:55675690-55675712 CAGGCGCATGCCACCACACCCGG + Intergenic
1096988009 12:55774603-55774625 CAGGTGCATGCCGCCACACCTGG - Intronic
1097027762 12:56070490-56070512 CAGGCGCATGCCACCACACCTGG + Intergenic
1097032275 12:56098267-56098289 CAGATGCATGCCGCCACGCCTGG - Intronic
1097047203 12:56196040-56196062 CAGGCGCATGCCGCCACGCCCGG + Intergenic
1097074809 12:56384945-56384967 CAGGCGCATGCCACCACACCCGG - Intergenic
1097207490 12:57335348-57335370 CAGACGCCTGCCACCACACCTGG + Intronic
1097274797 12:57805674-57805696 CAGGCGCATGCTGCCACACCCGG + Intronic
1097481473 12:60131720-60131742 CAGAAGCATGCCACCACACCTGG - Intergenic
1097774152 12:63626919-63626941 CAGGCGCGTGCTGCCACACCCGG + Intronic
1097797926 12:63883799-63883821 CAGGCGCCTGCCGCCACACCCGG + Intronic
1097853395 12:64436400-64436422 CAGATGCATGCTACCACACCTGG + Intronic
1097854131 12:64443595-64443617 CAGGCGCATGCCACCACACCTGG + Intronic
1097875897 12:64643000-64643022 CAGGCACATGGCACCACACCTGG + Intronic
1097933903 12:65223444-65223466 CAGACACATGCCACCACACCCGG + Intronic
1097997720 12:65907758-65907780 CAGAACCATGCGGCCACAACAGG - Intronic
1098011307 12:66055659-66055681 CAGTCGCATGCCACCACACCGGG + Intergenic
1098021568 12:66161381-66161403 CAGACACATGCCACCACACCTGG + Intronic
1098251443 12:68573936-68573958 CAGGCACATGCCGCCACACCTGG + Intergenic
1098571487 12:71992459-71992481 CAGGCGCATGCCACCACACCTGG - Intronic
1098913777 12:76236758-76236780 CTCAGGCATGTGGCCACACCTGG + Intergenic
1099245464 12:80188393-80188415 CAGGCGCATGCCACCACACCCGG - Intergenic
1099481247 12:83169223-83169245 CAGGCGCATGCTGCCACACCTGG - Intergenic
1099949952 12:89290751-89290773 CAGGCACATGCTGCCACACCCGG - Intergenic
1099953663 12:89331726-89331748 CAGACACATGCAACCACACCAGG - Intergenic
1100231889 12:92617406-92617428 CAGGCGCATGCCACCACACCCGG - Intergenic
1100343435 12:93703501-93703523 CAGGCGCATGCCACCACACCTGG + Intronic
1100600856 12:96110410-96110432 CAGGCGCATGCTGCCACGCCCGG + Intergenic
1100998320 12:100328133-100328155 CAGGCGCATGCTACCACACCTGG - Intronic
1101695342 12:107120440-107120462 CAGATGCATGCCACCACACCGGG + Intergenic
1101744123 12:107525182-107525204 CAGGCGCATGCCACCACACCTGG - Intronic
1101858548 12:108464040-108464062 CAGATGCATGCCACCACACCTGG - Intergenic
1101889959 12:108704327-108704349 CAGATGCCTGCCGCCACACCCGG - Intronic
1101901065 12:108791614-108791636 CAGGCGCATGCTACCACACCCGG - Intronic
1101912726 12:108872528-108872550 CAGGCGCATGCCACCACACCCGG - Intronic
1102082226 12:110107742-110107764 CAGACGCATGCCGCCACGCCTGG - Intergenic
1102095395 12:110236555-110236577 CAGGCGCATGCCACCACACCTGG + Intergenic
1102200150 12:111052235-111052257 CAGCCTCATGGGGCCATACAAGG - Intronic
1102273089 12:111556671-111556693 CAGGCGCATGCCACCACACCTGG - Intronic
1102302231 12:111779330-111779352 CAGGCGCATGCGACCACACTTGG + Intronic
1102864393 12:116362384-116362406 CAGACGCGTGCCACCACACCCGG - Intergenic
1103297440 12:119900099-119900121 CAGACACATGGCACCACACCTGG + Intergenic
1103568609 12:121829888-121829910 CAGAGGCAAGGGGTCACCCCTGG + Intronic
1103583612 12:121934947-121934969 CAGGCGCATGCAACCACACCTGG + Intronic
1103620931 12:122186774-122186796 CAGGCGCATGCCACCACACCCGG - Intronic
1103650981 12:122432248-122432270 CAGACACGTGCCGCCACACCTGG - Intergenic
1103706720 12:122878792-122878814 CAGGCGCATGCCACCACACCTGG + Intronic
1103752785 12:123177390-123177412 CAGGCGCATGCCACCACACCTGG - Intronic
1103757125 12:123217338-123217360 CAGGCGCATGCTACCACACCCGG + Intronic
1104432004 12:128724168-128724190 CAGACATATGTTGCCACACCAGG - Intergenic
1104455759 12:128911070-128911092 CAGGCGCATGCCGCCACACCCGG + Intronic
1104637759 12:130448641-130448663 CAGACGCACAGGGCCACAGTTGG - Intronic
1105202912 13:18194776-18194798 CAGACTCCTGCGGCCTCACCAGG - Intergenic
1105422081 13:20262018-20262040 CAGGCGCATGCCGCCACGCCTGG + Intergenic
1105463531 13:20614956-20614978 CAGGCGCCTGCCGCCACACCTGG + Intronic
1105513250 13:21068769-21068791 CAGACGCATGCTACCACGCCTGG + Intergenic
1105521178 13:21132082-21132104 CAGGCGCATGCCACCACACCTGG - Intergenic
1105528193 13:21195288-21195310 TAGACGCATGCTGCCACGCCCGG + Intergenic
1105977777 13:25488592-25488614 CAGGCGCATGCCACCACACCTGG - Intronic
1106127275 13:26910824-26910846 CCGAGGCATGGGGTCACAGCAGG + Intergenic
1106271202 13:28155445-28155467 CAGACACATGCAACCACACCTGG - Intronic
1106274828 13:28194012-28194034 CAGACGCCTGCCACCACACCTGG - Intronic
1106484610 13:30161162-30161184 CAGGCGCATGCCACCACACCCGG + Intergenic
1106829149 13:33559712-33559734 CAGGCGCATGCCACCACACCTGG - Intergenic
1107238953 13:38209547-38209569 CAGGCGCATGCCACCACACCTGG - Intergenic
1107243040 13:38260469-38260491 CAGGCGCATGCCACCACACCTGG - Intergenic
1107335787 13:39353583-39353605 CAGGCGCATGACACCACACCTGG - Intronic
1107358055 13:39589247-39589269 CAGGCGCATGCCACCACACCTGG + Intronic
1107392884 13:39985532-39985554 CAGGCACATGGCACCACACCCGG + Intergenic
1107591401 13:41910440-41910462 CTGACGCATGCCACCACACCCGG - Intronic
1107928289 13:45285549-45285571 CAGGCGCATGCCACCACACCCGG + Intergenic
1107947041 13:45428349-45428371 CAGGCGCATGCCACCACACCCGG + Intergenic
1107955225 13:45505042-45505064 CAGGCGCATGCAGCCACGCCTGG - Intronic
1108337711 13:49463146-49463168 CGGGCGCATGCCGCCACACCCGG + Intronic
1108692100 13:52868680-52868702 CAGAGACATGGGGCAACAGCTGG + Intergenic
1109251733 13:60028914-60028936 CAGGCGCATGCCACCACACCTGG - Intronic
1109380069 13:61548255-61548277 CAGGTGCATGGCACCACACCGGG + Intergenic
1109438547 13:62338931-62338953 CAGGCGCATGCCACCACACCAGG + Intergenic
1109466454 13:62739595-62739617 CAGGCGCATGCCACCACACCCGG + Intergenic
1110043466 13:70796959-70796981 CAGGTGCATGTGACCACACCTGG + Intergenic
1110211367 13:72977346-72977368 CAGGCGCATGCCACCACACCTGG + Intronic
1110263252 13:73509940-73509962 CAGACACATGCCACCACACCTGG - Intergenic
1110893870 13:80724368-80724390 CAGACGCATGCCACCACATCTGG - Intergenic
1111233361 13:85374190-85374212 CAGGCGCATGCCACCACACCCGG - Intergenic
1111940017 13:94598638-94598660 CAGGCGCATGCTACCACACCTGG + Intergenic
1111978799 13:94995636-94995658 CAGGCGCATGCCACCACACCAGG - Intergenic
1113553049 13:111208181-111208203 CAGACACGTGGCACCACACCCGG + Intronic
1114225903 14:20738326-20738348 CAGACACATGTCGCCACGCCCGG - Intronic
1114459992 14:22880230-22880252 CAGGTGCATGCCGCCACACCTGG - Exonic
1114478908 14:23019050-23019072 CAGGCGCATGCCACCACACCTGG + Intronic
1114666061 14:24377788-24377810 CAGAAGCTTGGGGCCAACCCTGG + Exonic
1114713280 14:24799930-24799952 CAGACGCATGTCACCACACCTGG + Intergenic
1114848996 14:26359901-26359923 CAGGCGCATGCCGCCACTCCTGG - Intergenic
1114955967 14:27819643-27819665 CAGGCGCATGTCACCACACCTGG - Intergenic
1115087949 14:29539584-29539606 CAGACGCCTGACACCACACCTGG - Intergenic
1115169860 14:30492251-30492273 CAGATGCATGCCACCACACCCGG - Intergenic
1115510711 14:34135519-34135541 CCGACGCATGCCACCACACCCGG + Intronic
1115561755 14:34588989-34589011 CAGATGCATGCTACCACACCTGG - Intronic
1115609445 14:35037367-35037389 CAGGCGCATGCCACCACACCTGG - Intergenic
1115671066 14:35612226-35612248 CAGACGCATGCCACCACGCCTGG - Intronic
1115920777 14:38370926-38370948 CAGACACATGGCACCACACCTGG - Intergenic
1115965983 14:38888692-38888714 CAGGCGCATGCCACCACACCTGG - Intergenic
1115980470 14:39046328-39046350 CAGACACATGCGACCATACCCGG - Intronic
1115984420 14:39089029-39089051 CAGGCGCATGCCACCACACCCGG - Intronic
1115991490 14:39155069-39155091 CAGACACATGCCACCACACCCGG + Intronic
1116270444 14:42758408-42758430 CAGGCACATGCTGCCACACCTGG + Intergenic
1116474991 14:45329681-45329703 CAGGTGCATGCTGCCACACCTGG + Intergenic
1116881699 14:50176865-50176887 CAGGCGCATGCCACCACACCTGG - Intronic
1117068663 14:52035819-52035841 CAGACACATGCCACCACACCTGG + Intronic
1117157933 14:52959121-52959143 CAGACGCATGCCAACACACCAGG - Intergenic
1117399220 14:55343391-55343413 CAGGCGCATGCCACCACACCCGG + Intronic
1117722654 14:58642549-58642571 CAGGCACATGCTGCCACACCCGG - Intronic
1117922618 14:60741316-60741338 CAGGTGCATGGCACCACACCTGG + Intronic
1117960656 14:61158642-61158664 CAGACACATGCCACCACACCTGG + Intergenic
1118124428 14:62884481-62884503 CAGGCGCATACTGCCACACCTGG - Intronic
1118174366 14:63423236-63423258 CAGGCGCATGCCACCACACCCGG + Intronic
1118178334 14:63464878-63464900 CAGACACATGCCACCACACCTGG - Intronic
1118293315 14:64546353-64546375 CAGGCGCATGCCACCACACCCGG + Intergenic
1118327247 14:64789911-64789933 CAGAGGCATGAGGCGACACTGGG + Intronic
1118357903 14:65030597-65030619 CAGATGCATGCCACCACACCTGG - Intronic
1118584390 14:67339136-67339158 CAGGCGCATGCTGCCACACCTGG + Intronic
1118819673 14:69336865-69336887 CAGGTGCATGCCGCCACACCCGG + Intronic
1118922268 14:70160300-70160322 CAGACGCATGTCACCACGCCTGG - Intronic
1118928381 14:70215220-70215242 CAGGCGCATGCTGCCACACCAGG + Intergenic
1118935103 14:70280567-70280589 CAGACGCATGCCACCATACCCGG - Intergenic
1119221432 14:72910996-72911018 TAGGCGCATGGCACCACACCCGG - Intergenic
1119355030 14:73999343-73999365 CAGGCGCATGCCACCACACCTGG - Intronic
1120147906 14:81000072-81000094 CAGGCGCATGCCACCACACCTGG + Intronic
1120282494 14:82457041-82457063 CAGATGCATGCCACCACACCCGG + Intergenic
1120548561 14:85841056-85841078 CAGGCGCCCGCGGCCACACCAGG - Intergenic
1120642148 14:87028508-87028530 CAGGCGCGTGCCGCCACACCTGG + Intergenic
1120650391 14:87125188-87125210 CAGGCGCATGCTGCCACACCTGG + Intergenic
1120939745 14:89935863-89935885 CAGGTGCATGCCGCCACACCTGG - Intronic
1121045347 14:90783792-90783814 CAGCCGCATGCCACCACACCTGG - Intronic
1121066623 14:90973298-90973320 CAGATGCATGCCACCACACCTGG - Intronic
1121223274 14:92302376-92302398 CAGACACATGCTGCCACACCTGG - Intergenic
1121271896 14:92643194-92643216 CAGGCGCATGCCACCACACCTGG + Intronic
1121659991 14:95627639-95627661 CAGGCGCACAGGGCCACACCCGG - Intergenic
1121696003 14:95912931-95912953 CAGGCGCCTGCCGCCACACCTGG + Intergenic
1121964258 14:98289636-98289658 CAGACGCCTGCCACCACACCTGG + Intergenic
1122086017 14:99305448-99305470 CAGGAGCATGCCGCCACACCTGG + Intergenic
1122182103 14:99963062-99963084 CAGGCGCATGCCACCACACCCGG + Intergenic
1122210757 14:100172447-100172469 CAGGTGCATGCTGCCACACCTGG - Intergenic
1122434629 14:101686796-101686818 CAGGCACATGTCGCCACACCCGG + Intergenic
1122530833 14:102425716-102425738 CAGACGCATGCCACCACGCCTGG + Intronic
1122565042 14:102647819-102647841 CAGACGCGTGCCACCACACCTGG + Intronic
1122565903 14:102655808-102655830 CAGACGCCTGTGACCACACCCGG - Intronic
1122697764 14:103565096-103565118 CAGGCGCATGCTGCCACGCCTGG + Intronic
1122753215 14:103955064-103955086 CACAGGCATGAGCCCACACCCGG + Intronic
1122778433 14:104133399-104133421 CAGACTCCTGGGGCGAAACCTGG + Intergenic
1202908916 14_GL000194v1_random:99050-99072 CAGGCGCATGGAAACACACCTGG - Intergenic
1123464861 15:20507398-20507420 CAGGCACATGGAACCACACCTGG + Intergenic
1123470997 15:20551850-20551872 CAGGCGCCTGCCGCCACACCCGG + Intergenic
1123647061 15:22448851-22448873 CAGGCGCCTGCCGCCACACCCGG - Intergenic
1123653256 15:22493631-22493653 CAGGCACATGGAACCACACCTGG - Intergenic
1123686248 15:22799637-22799659 CAGGCGCCTGCCGCCACACCTGG - Intronic
1123731298 15:23146840-23146862 CAGGCGCCTGCCGCCACACCCGG + Intergenic
1123743676 15:23302494-23302516 CAGGCACATGGAACCACACCTGG - Intergenic
1123749436 15:23344255-23344277 CAGGCGCCTGCCGCCACACCCGG + Intergenic
1124015662 15:25872505-25872527 CAGGCGCATGCCACCACACCTGG - Intergenic
1124108211 15:26761250-26761272 CAGGCGCATGTCACCACACCTGG - Intronic
1124175990 15:27424694-27424716 CAGACGCCTGCCACCACACCTGG + Intronic
1124196725 15:27638125-27638147 CAGAGGCATGCCACCACACCTGG - Intergenic
1124275585 15:28323377-28323399 CAGGCACATGGAACCACACCTGG + Intergenic
1124307116 15:28588224-28588246 CAGGCACATGGAACCACACCTGG - Intergenic
1124665374 15:31587496-31587518 CAGACGCCTGCCACCACACCTGG - Intronic
1125461599 15:39912474-39912496 CAGGCGCATGCCACCACACCTGG - Intronic
1125555034 15:40577633-40577655 CAGGCGCATGCCACCACACCCGG - Intergenic
1125670896 15:41472039-41472061 CAGGCGCATGCCACCACACCTGG + Intronic
1125904013 15:43373789-43373811 CAGGCGCCTGCCGCCACACCCGG + Intronic
1126025976 15:44446485-44446507 CAGGCGCATGCCACCACACCCGG - Intronic
1126038189 15:44566840-44566862 CAGGTGCATGCCGCCACACCTGG + Intronic
1126438547 15:48662170-48662192 CAGGTGCATGTGGCCACACCTGG - Intergenic
1126613850 15:50556389-50556411 CAGGCACATGCTGCCACACCAGG - Intronic
1127021692 15:54755730-54755752 CAGGCGCATGCCACCACACCCGG + Intergenic
1127089738 15:55455572-55455594 CAGGCGCATGCCACCACACCTGG + Intronic
1127161106 15:56187351-56187373 CAGGCGCATGTTGCCACACCTGG + Intronic
1127165251 15:56238974-56238996 CAGGCGCACGATGCCACACCTGG + Intronic
1127465607 15:59241558-59241580 CAGGCGCATGCCACCACACCTGG - Intronic
1127494416 15:59496460-59496482 CAGGCGCAGGCCGCCACACCTGG - Intronic
1127800588 15:62473949-62473971 CAGATGCATGCCACCACACCTGG - Intronic
1127823001 15:62676755-62676777 CAGGCGCATGCTGCCACACCCGG + Intronic
1127979835 15:64026384-64026406 CAGGCGCATGCCACCACACCAGG + Intronic
1128031690 15:64486379-64486401 CAGGCGCACGTCGCCACACCCGG - Intronic
1128045315 15:64612870-64612892 CAGACGCATGCCACCACACCTGG - Intronic
1128135133 15:65257272-65257294 CAGGCGCATGCCACCACACCTGG - Intronic
1128149455 15:65354046-65354068 CAGGCGCATGCCACCACACCTGG + Intronic
1128216748 15:65939635-65939657 CAGGCGCATGCCACCACACCTGG + Intronic
1128490591 15:68138615-68138637 CAGGCGCATGCCACCACACCTGG + Intronic
1128962787 15:72025501-72025523 CAGGCGCATGCAACCACACCTGG + Intronic
1129489350 15:75908413-75908435 CAGGCGCATGCAGCCATACCCGG + Intronic
1130237368 15:82148233-82148255 CAGGCGCATGCCACCACACCTGG - Intronic
1130309819 15:82743578-82743600 CAGGCGCATGATGCCACGCCCGG + Intergenic
1130391594 15:83460241-83460263 AAGACGGATGCTGCCACACCTGG + Intronic
1130519342 15:84650501-84650523 CAGGCGCATGCCACCACACCCGG + Intronic
1130605618 15:85313852-85313874 CAGACACATGCCACCACACCTGG + Intergenic
1130646510 15:85731938-85731960 CAGCCGCATGTCACCACACCTGG - Intronic
1131050464 15:89344129-89344151 CAGGCGCATGCCACCACACCTGG - Intergenic
1131088198 15:89596487-89596509 CAGGCGCATGCCACCACACCCGG + Intronic
1131292702 15:91120669-91120691 CAGGCGCATGCCACCACACCTGG - Intronic
1131580866 15:93641675-93641697 CAGGGGCATGCCGCCACACCTGG + Intergenic
1131695098 15:94868353-94868375 CAGGCGCATGCCACCACACCTGG + Intergenic
1131750732 15:95505390-95505412 CAGACACATGCCACCACACCTGG - Intergenic
1131807363 15:96136554-96136576 CAGGCGCACGCTGCCACACCTGG + Intergenic
1132008193 15:98249886-98249908 CAGATGCATGCCACCACACCCGG + Intergenic
1132020229 15:98354569-98354591 CAGGCGCATGTGACCACGCCTGG - Intergenic
1132849342 16:2017633-2017655 CAGGCGCATGCCACCACACCCGG + Intronic
1132886002 16:2182263-2182285 CAGACGCATGGGGCCACACCTGG + Intronic
1132893462 16:2215770-2215792 CAGGCGCATGGCACCACGCCCGG + Intergenic
1133151503 16:3835720-3835742 CAGGCGCCTGGCACCACACCTGG + Intronic
1133248475 16:4464755-4464777 CAGGCGCCTGCCGCCACACCCGG + Intronic
1133368092 16:5226875-5226897 CAGATGCATGCCACCACACCCGG + Intergenic
1133528385 16:6628885-6628907 CAGACGCATGCCACCACACCTGG - Intronic
1133615761 16:7475455-7475477 CAGGCGCATGCCACCACACCTGG + Intronic
1133731403 16:8581594-8581616 CAGGCGCATGCCACCACACCTGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1133785620 16:8970906-8970928 CAGGCGCATGCCACCACACCTGG + Intergenic
1134010156 16:10846072-10846094 CAGACGCCTGCCACCACACCCGG + Intergenic
1134065973 16:11228484-11228506 CAGAAGCTTGGGGCTGCACCTGG - Intergenic
1134544179 16:15094978-15095000 CAGGCGCATGCCACCACACCCGG + Intronic
1134751591 16:16629592-16629614 CAGGCGCATGCCACCACACCCGG - Intergenic
1134760341 16:16709092-16709114 CAGGTGCATGCCGCCACACCTGG + Intergenic
1134810623 16:17163904-17163926 CAGGCGCATGCCACCACACCTGG - Intronic
1134840639 16:17398985-17399007 CAGGTGCATGCCGCCACACCTGG + Intronic
1134877777 16:17717410-17717432 CAGGCGCATGCCACCACACCTGG - Intergenic
1134936449 16:18250087-18250109 CAGGCGCATGCCACCACACCTGG + Intergenic
1134985730 16:18650113-18650135 CAGGTGCATGCCGCCACACCTGG - Intergenic
1135024409 16:18988109-18988131 CAGGTGCATGCAGCCACACCTGG + Intronic
1135084141 16:19461429-19461451 CAGGCGCATGCCACCACACCCGG - Intronic
1135200664 16:20435173-20435195 CAGGCGCCTGCCGCCACACCTGG + Intronic
1135252693 16:20914429-20914451 CAGGCACATGCCGCCACACCTGG + Intronic
1135272705 16:21083156-21083178 CAGGCGCATGGCACCACGCCCGG + Intronic
1135279626 16:21142794-21142816 CAGGCGCATGCCACCACACCTGG + Intronic
1135302906 16:21345994-21346016 CAGATGCGTGCCGCCACACCTGG + Intergenic
1135361746 16:21821149-21821171 CAGGCGCATGCCACCACACCCGG + Intergenic
1135416067 16:22268812-22268834 CAGGCGCATGCCACCACACCTGG - Intronic
1135468678 16:22709765-22709787 CAGGTGCATGCCGCCACACCTGG + Intergenic
1135512661 16:23100628-23100650 CAGGCGCATGCCACCACACCTGG - Intronic
1135531112 16:23255442-23255464 CAGGCGCATGCCACCACACCTGG + Intergenic
1135593814 16:23725979-23726001 CAGATGCATGCCACCACACCTGG - Intergenic
1135705937 16:24675001-24675023 CAGACGCATGCCACCACAACTGG - Intergenic
1135737638 16:24945178-24945200 CAGATGCATGCCACCACACCTGG - Intronic
1136134446 16:28246522-28246544 CAGGCGCATGCCACCACACCTGG + Intergenic
1136299648 16:29325188-29325210 CAGATGCATGCCGCCACACCTGG + Intergenic
1136341508 16:29646931-29646953 CAGACGCCTGCCACCACACCTGG + Intergenic
1136448205 16:30336803-30336825 CAGACGCATGCCACCACTCCTGG + Intergenic
1137020704 16:35424233-35424255 CAGGCGCATGGCACCACCCCTGG - Intergenic
1137276818 16:46940177-46940199 CAGGCGCATGCTACCACACCTGG - Intergenic
1137381714 16:48005463-48005485 CAGGCGCATGCTGCCATACCTGG - Intergenic
1137431497 16:48421536-48421558 CAGGCGCATGCCACCACACCCGG - Intronic
1138380620 16:56599467-56599489 CAGGCGCATGCCACCACACCTGG + Intergenic
1138650131 16:58455503-58455525 CAGGTGCATGTCGCCACACCTGG - Intergenic
1138681789 16:58688991-58689013 CAGGCGCATGCCACCACACCTGG - Intergenic
1139050415 16:63118347-63118369 CAGGCGCATGCCACCACACCTGG - Intergenic
1139455131 16:67068335-67068357 CAGACACATGCCACCACACCTGG - Intronic
1139677458 16:68534369-68534391 CAGGCGCATGCCACCACACCCGG + Intronic
1139695898 16:68674590-68674612 CAGACGCATGCCACCATACCCGG - Intronic
1139719598 16:68841897-68841919 CAGATGCATGCCACCACACCCGG - Intergenic
1139721081 16:68855437-68855459 CAGGCGCATGCCACCACACCCGG - Intronic
1139749679 16:69101925-69101947 CAGGCGCAAGCTGCCACACCTGG + Intergenic
1139807835 16:69584469-69584491 CAGGTGCATGGCACCACACCTGG + Intronic
1139905157 16:70360136-70360158 CAGGCGCATACTGCCACACCTGG - Intronic
1139951030 16:70670126-70670148 CAGGCGCATGCCACCACACCTGG - Intronic
1140094559 16:71863838-71863860 CAGGCGCATGCCACCACACCTGG + Intronic
1140102187 16:71927344-71927366 CAGGCGCATGCCACCACACCTGG - Intronic
1140382810 16:74505710-74505732 CAGGCGCACGCCGCCACACCTGG - Intronic
1140390118 16:74579264-74579286 CAGGCGCATGCCACCACACCTGG - Intronic
1140572547 16:76125655-76125677 CAGGCGCATGCCACCACACCCGG - Intergenic
1140822984 16:78680264-78680286 CAGATGCATGCCACCACACCTGG - Intronic
1141189900 16:81816890-81816912 CAGGCACCTGGGGCCACATCCGG + Intronic
1141373945 16:83512523-83512545 CAGGCGCATGCCACCACACCTGG - Intronic
1142061367 16:88031945-88031967 CAGACGCGTGCCACCACACCTGG + Intronic
1142410962 16:89916495-89916517 CAGGCGCGTGCCGCCACACCCGG - Intronic
1142469896 17:157395-157417 AGGAAGCAGGGGGCCACACCAGG - Intronic
1142705631 17:1692083-1692105 CAGGCGCATGCCACCACACCCGG + Intergenic
1142776786 17:2146706-2146728 CAGGCGCATGCTGCCACGCCCGG + Intronic
1142865381 17:2787708-2787730 CAGGCGCATGCCGCCACACCTGG + Intronic
1143079972 17:4374359-4374381 CAGACGCCTGCCACCACACCTGG - Intergenic
1143151848 17:4811955-4811977 CAGACACATGCCACCACACCCGG + Intronic
1143220038 17:5254256-5254278 CAGACGCATGCCACCACGCCCGG + Intergenic
1143341322 17:6213610-6213632 CAGGCGCATGCCACCACACCTGG + Intergenic
1143360174 17:6363074-6363096 CAGGTGCATGGTGCCACACCCGG - Intergenic
1143491410 17:7287263-7287285 CAGGCGCATGCCACCACACCTGG + Exonic
1143990224 17:10952890-10952912 CAGGCGCATGCCACCACACCTGG + Intergenic
1144019245 17:11225433-11225455 CAGATGCATGCCACCACACCGGG + Intergenic
1144022062 17:11246345-11246367 CAGGCGCATGCCACCACACCCGG - Intronic
1144138185 17:12319471-12319493 CAGGCGCATGTCACCACACCTGG - Intergenic
1144212683 17:13028592-13028614 CAGACACATGCCACCACACCCGG + Intergenic
1144233681 17:13234956-13234978 CAGGTGCATGCCGCCACACCTGG - Intergenic
1144449815 17:15367305-15367327 CAGGCGCATGCTGCCACACCCGG + Intergenic
1144505585 17:15827685-15827707 CAGGCGCCTGGTACCACACCTGG + Intergenic
1144526863 17:15997956-15997978 CAGGCGCATGCCACCACACCCGG - Intronic
1144690033 17:17255333-17255355 CAGACGCATGCCACCACGCCTGG - Intronic
1144871523 17:18374879-18374901 CAGGCGCATGCCACCACACCTGG - Intergenic
1145169761 17:20645619-20645641 CAGGCGCCTGGTACCACACCTGG + Intergenic
1145177439 17:20713275-20713297 CAGGCGCATGCCACCACACCTGG + Intergenic
1145800163 17:27677425-27677447 CAGGCTCCTGGGGCCCCACCTGG - Intergenic
1145892546 17:28427233-28427255 CAGATGCATGCCACCACACCTGG - Intergenic
1146052543 17:29565468-29565490 CAGATGCATGCCACCACACCCGG + Intronic
1146074236 17:29713190-29713212 CAGGCGCATGCCACCACACCTGG - Intronic
1146102057 17:29992488-29992510 CAGGCGCATGCCACCACACCCGG + Intronic
1146167839 17:30604497-30604519 CAGGCGCATGGCGCCACGCCTGG + Intergenic
1146220299 17:31012711-31012733 CAGGTGCATGGCGCCACGCCCGG + Intergenic
1146314346 17:31795476-31795498 CAGACGCATGACACCACGCCTGG + Intergenic
1146337613 17:31988733-31988755 CAGGCGCATGCCACCACACCTGG + Intronic
1146859244 17:36282474-36282496 CAGGCGCATGCCACCACACCCGG + Intronic
1146959190 17:36958303-36958325 CAGGCGCATGCCACCACACCCGG + Intronic
1146998574 17:37343118-37343140 CAGATGCATGCCACCACACCTGG + Intronic
1147089566 17:38086560-38086582 CAGGCGCATGCCACCACACCCGG + Intergenic
1147107645 17:38233959-38233981 CAGGCGCATGCCACCACACCCGG - Intergenic
1147127151 17:38379013-38379035 CAGACGCCTGGCATCACACCCGG - Intronic
1147199804 17:38793069-38793091 CAGGCGCATGCCACCACACCCGG + Intronic
1147289797 17:39432609-39432631 CAGGCGCATGCTGCCACGCCTGG - Intronic
1147340277 17:39749691-39749713 CAGATGCATGTCACCACACCTGG - Intergenic
1147406075 17:40213313-40213335 CAGGCGCATGCCACCACACCTGG - Intergenic
1147679808 17:42234717-42234739 TAGACGCATGGCACCACACCTGG - Intronic
1147801682 17:43095437-43095459 CAGGCGCATGCCACCACACCCGG - Intronic
1147804273 17:43118904-43118926 CAGGCGCGTGCTGCCACACCCGG + Intronic
1147812854 17:43185556-43185578 CAGGCGCATGCCACCACACCTGG - Intronic
1148004218 17:44412527-44412549 CAGACGCATGCCACCACACCCGG + Intronic
1148014625 17:44512551-44512573 CAGGCGCATGGCACCACGCCCGG + Intergenic
1148027503 17:44598845-44598867 CAGACATATGCTGCCACACCTGG + Intergenic
1148278019 17:46323537-46323559 CAGGCGCATGCCACCACACCTGG + Intronic
1148300226 17:46541392-46541414 CAGGCGCATGCCACCACACCTGG + Intronic
1148340255 17:46869135-46869157 CAGAGGCCTCAGGCCACACCGGG - Intronic
1148404800 17:47401785-47401807 CAGGCGCATGCCACCACACCCGG + Intronic
1148421747 17:47553891-47553913 CAGGCGCATGCCACCACACCTGG + Intronic
1148488915 17:48010810-48010832 CAGGCGCATGCCACCACACCCGG + Intergenic
1148545118 17:48512713-48512735 CAGGCGCATGCCACCACACCGGG + Intergenic
1148715386 17:49712001-49712023 CAGGAGCATGCTGCCACACCCGG - Intronic
1148761431 17:50003818-50003840 CAGACGCCTGCCACCACACCTGG - Intergenic
1148959138 17:51378725-51378747 CAGGCGCATGCCACCACACCTGG + Intergenic
1149069764 17:52526122-52526144 CAGGCGCATGCCACCACACCTGG + Intergenic
1149146332 17:53497766-53497788 CAGGCGAATGATGCCACACCTGG - Intergenic
1149619397 17:58031428-58031450 CAGACACATGCCACCACACCTGG + Intergenic
1149688790 17:58555832-58555854 CAGGCGCATGCCACCACACCCGG - Intergenic
1149738201 17:59016632-59016654 CAGACACATGCAGCCATACCTGG - Intronic
1149807398 17:59631825-59631847 CAGGCGCATGCCACCACACCTGG - Intronic
1150048627 17:61937321-61937343 CAGACACATGTCACCACACCTGG + Intergenic
1150479122 17:65496241-65496263 CAGACACATGCCACCACACCTGG + Intergenic
1150543762 17:66131596-66131618 CAGGCGCCTGCCGCCACACCTGG - Intronic
1150556003 17:66254571-66254593 CAGATGCATGCCACCACACCCGG - Intronic
1150683067 17:67298652-67298674 CAGACGCATGCCACCACGCCCGG - Intergenic
1150685844 17:67320270-67320292 CAGATGCATGCCACCACACCTGG - Intergenic
1150835653 17:68561964-68561986 CAGGCGCATGCCACCACACCTGG + Intronic
1151045093 17:70910650-70910672 CAGACGCCTGCCACCACACCTGG - Intergenic
1151080643 17:71324911-71324933 CAGTCGCATGCCACCACACCCGG - Intergenic
1151178776 17:72310818-72310840 CAGGCGCATGTCACCACACCCGG - Intergenic
1151221513 17:72616214-72616236 CAGGCGCCTGGCACCACACCCGG - Intergenic
1151373002 17:73661212-73661234 CAGGCGCATGCCACCACACCAGG - Intergenic
1151556376 17:74848872-74848894 CAGGTGCATGCCGCCACACCTGG - Intronic
1152259202 17:79257721-79257743 CAGGCACATGGCACCACACCTGG + Intronic
1152527989 17:80900457-80900479 CAGGCGCATGCCACCACACCTGG + Intronic
1152649481 17:81485386-81485408 CAGACACATGCCACCACACCTGG + Intergenic
1152828230 17:82480787-82480809 CAGGCGCATGCCGCCACGCCTGG - Intronic
1153162852 18:2228091-2228113 CAGGTGCATGCAGCCACACCTGG - Intergenic
1153319368 18:3757263-3757285 CAGGCGCATGCCACCACACCAGG - Intronic
1153329204 18:3855754-3855776 CAGACGCGTGCCACCACACCAGG + Intronic
1153393625 18:4591991-4592013 CAGGCGCATGCCGCCACGCCTGG - Intergenic
1153465129 18:5380105-5380127 CAGACGCATGCCACCACACCTGG - Intergenic
1153634488 18:7101808-7101830 CAGATGCATGCCACCACACCTGG + Intronic
1153714794 18:7837595-7837617 CAGGCGCATGCCACCACACCTGG + Intronic
1153867387 18:9285064-9285086 CAGGCGCCCGCGGCCACACCCGG - Exonic
1153902054 18:9626035-9626057 CAGGCGCATGCCACCACACCCGG + Intergenic
1153919273 18:9773799-9773821 CAGGCCCATGTCGCCACACCCGG + Intronic
1154084452 18:11289601-11289623 CAGATGCATGCCACCACACCTGG + Intergenic
1154248327 18:12719864-12719886 CAGGCGCATGCCACCACACCCGG + Intronic
1154275197 18:12952922-12952944 CAGGCGCATGCCACCACACCCGG + Intronic
1154342642 18:13516990-13517012 CAGGCACATGCTGCCACACCCGG + Intronic
1155206298 18:23561152-23561174 CAGATGCATGCCACCACACCTGG + Intronic
1155219030 18:23667929-23667951 CAGGCACATGCGACCACACCCGG + Intergenic
1155276686 18:24195156-24195178 CAGGCGCGTCGTGCCACACCTGG - Intronic
1155382233 18:25236391-25236413 CAGACGCATGCCACCACGCCCGG - Intronic
1155444956 18:25901351-25901373 CAGGCGCATGCTACCACACCTGG - Intergenic
1155512301 18:26590224-26590246 CAGGCACATGGCACCACACCTGG + Intronic
1155546644 18:26922776-26922798 CAGGCGCATGCCACCACACCCGG + Intronic
1155963517 18:32015660-32015682 CAGGCGCATGCCACCACACCCGG - Intergenic
1155972940 18:32098708-32098730 CAGGCGCCTGCCGCCACACCCGG - Intronic
1155985317 18:32224739-32224761 CAGGCGCCTGCCGCCACACCTGG + Intronic
1156000304 18:32377704-32377726 CAGGCGCATGCCACCACACCTGG + Intronic
1156247282 18:35313405-35313427 CAGGCGCATGTTGCCACGCCTGG - Intergenic
1156316134 18:35970817-35970839 CAGGCGCATGCCGCCACACCTGG + Intergenic
1156330483 18:36117092-36117114 CAGGCGCATGCCACCACACCCGG - Intronic
1156639107 18:39068425-39068447 CAGGCGCATGCCACCACACCCGG - Intergenic
1156835688 18:41551181-41551203 CAGGCGCATGACACCACACCTGG - Intergenic
1157227060 18:45875912-45875934 CAAGCGCATGCCGCCACACCTGG - Intronic
1157330093 18:46697561-46697583 TAGGCGCATGCAGCCACACCTGG - Intronic
1157754028 18:50202578-50202600 CAGATGCATGACACCACACCTGG - Intergenic
1157770517 18:50340965-50340987 CAGGCGTATGGCACCACACCCGG - Intergenic
1157770691 18:50343277-50343299 CAGGCGCATGGCACCACATCTGG + Intergenic
1158233349 18:55284267-55284289 CAGGTGCATGCCGCCACACCTGG - Intronic
1158324367 18:56298107-56298129 CAGGCGCATGCCACCACACCTGG - Intergenic
1158695424 18:59698783-59698805 CAGATGCATGCTTCCACACCCGG + Intergenic
1158740183 18:60132993-60133015 CAGGTGCATGCTGCCACACCTGG + Intergenic
1159401620 18:67944006-67944028 CAGACACATGCCACCACACCAGG - Intergenic
1159440614 18:68475301-68475323 CAGGTGCATGCTGCCACACCTGG - Intergenic
1159972922 18:74676232-74676254 CAGATGCATGCTGCCACGCCCGG + Intronic
1160196697 18:76760879-76760901 CAGGTGCATGCCGCCACACCCGG + Intergenic
1160277213 18:77448210-77448232 CAACCGCATGGGACCACACACGG + Intergenic
1160375324 18:78407043-78407065 CAGACGCCTGGGGCCACCACAGG + Intergenic
1160600140 18:80006239-80006261 CAGGCGCATGCCACCACACCCGG - Intronic
1160702036 19:512304-512326 CAGACGCACGTCACCACACCTGG + Intronic
1160816205 19:1036998-1037020 CAGGTGCATGCTGCCACACCCGG + Intronic
1161217826 19:3103353-3103375 CAGGCGCATGCCACCACACCCGG + Intronic
1161353765 19:3807760-3807782 CATACGCATGGGCACACACATGG - Intronic
1161372092 19:3918408-3918430 CAGGCGCATGCCACCACACCTGG - Intronic
1161451232 19:4346557-4346579 CAGACGCATGCCACCACACCCGG + Intronic
1161673326 19:5626899-5626921 CAGATGCATGCCACCACACCGGG - Intronic
1161693236 19:5749944-5749966 CAGGCGCATGCCACCACACCAGG + Intronic
1161702282 19:5802185-5802207 CAGCCCCATGTGGTCACACCAGG - Intergenic
1161893717 19:7064064-7064086 CAGGCGCATGCCACCACACCTGG + Intergenic
1161896959 19:7089717-7089739 CAGGCGCATGCCACCACACCCGG - Intergenic
1162051373 19:8035889-8035911 CAGGCGCATGCCACCACACCTGG - Intronic
1162375315 19:10301630-10301652 CAGACACATGCCGCCACACCTGG + Intergenic
1162390042 19:10384296-10384318 CAGGCGCATGCCACCACACCCGG + Intergenic
1162429378 19:10618315-10618337 CAGACACATGCTGCCACACCCGG + Intronic
1162547659 19:11340188-11340210 CAGACGCACGCCACCACACCTGG - Intronic
1162553304 19:11370575-11370597 CAGGCGCATGCTGCCACTCCTGG - Intergenic
1162638131 19:11986456-11986478 CAGACGCCTGCCACCACACCTGG + Intergenic
1162776097 19:12980509-12980531 CAGGCGCATGCCACCACACCTGG + Intergenic
1162849466 19:13419532-13419554 CAGATGCATGCCACCACACCTGG - Intronic
1163122825 19:15228140-15228162 CAGGTGTATGGGGCCACCCCAGG - Intronic
1163260870 19:16189163-16189185 CAGGCGCATGCCACCACACCTGG + Intronic
1163528612 19:17836423-17836445 CAGGCGCATGCCACCACACCCGG + Intronic
1163629408 19:18409972-18409994 CAGGCGCATGACACCACACCTGG + Intergenic
1163678015 19:18665197-18665219 CAGGCGCATGCCACCACACCTGG + Intronic
1163684800 19:18705458-18705480 CAGGCGCATGCCACCACACCTGG + Intronic
1163808109 19:19412487-19412509 CAGATGCATGCCACCACACCTGG - Intronic
1163933156 19:20418372-20418394 CAGGCGCATGCTGCCACACCTGG - Intergenic
1164035970 19:21455351-21455373 CAGATGCATGCCACCACACCTGG - Intronic
1164201450 19:23022242-23022264 CAGACACCTGGCACCACACCTGG - Intergenic
1164252971 19:23500101-23500123 CAGGCGCATGCCACCACACCTGG - Intergenic
1164980566 19:32610647-32610669 CAGGTGCATGCCGCCACACCTGG - Intronic
1165041534 19:33071432-33071454 CAGGCGCATGCCACCACACCTGG - Intergenic
1165131843 19:33637543-33637565 CAGGCGCACGCTGCCACACCCGG + Intronic
1165441865 19:35833025-35833047 CAGGCGCATGCCACCACACCCGG + Intronic
1165471610 19:36007551-36007573 AAGAAGAATGGGGCTACACCAGG + Intronic
1165507684 19:36244706-36244728 CAGGCGCATGCCACCACACCCGG - Intronic
1165538295 19:36468769-36468791 CAGATGCATGCCACCACACCTGG - Intronic
1165666442 19:37633494-37633516 CAGGCGCATGTGACCACGCCTGG + Exonic
1165760462 19:38318424-38318446 CAGACGCATGCCACCACACTTGG + Intergenic
1165780469 19:38430751-38430773 CAGGCGCATACTGCCACACCTGG - Intergenic
1165820536 19:38672381-38672403 CAGATGCATGCCACCACACCTGG + Intronic
1165826080 19:38706554-38706576 CAGGTGCATGCAGCCACACCTGG + Intronic
1165856698 19:38883221-38883243 CAGGCGCATGCCACCACACCAGG + Intronic
1165877057 19:39015482-39015504 CAGGCGCATGCCACCACACCTGG - Intronic
1165920659 19:39296048-39296070 CAGGCGCATGCCACCACACCTGG + Intergenic
1165988480 19:39791502-39791524 CAGGCGCATGCCACCACACCTGG - Intergenic
1166324239 19:42039328-42039350 CAGGCGCATGCCACCACACCTGG - Intronic
1166564760 19:43757063-43757085 CAGGCGCATGCCACCACACCCGG - Intergenic
1166628188 19:44380244-44380266 CAGGCGCATGCCGCCACGCCCGG - Intronic
1166736544 19:45089082-45089104 CAGGCGCATGACACCACACCCGG + Intronic
1166834730 19:45660397-45660419 CAGACGCATGCCACCATACCTGG - Intergenic
1166928140 19:46283735-46283757 CAGACGCATGCCATCACACCAGG - Intergenic
1167000662 19:46744524-46744546 CAGGCGCATGTCACCACACCCGG + Intronic
1167032854 19:46975011-46975033 CAGGCGCATGCCACCACACCCGG + Intronic
1167075928 19:47249176-47249198 CAGGCGCACGCCGCCACACCCGG - Intergenic
1167570450 19:50284508-50284530 CAGGCACATGCCGCCACACCCGG + Intronic
1167670031 19:50846252-50846274 CAGGCGCATGCCACCACACCTGG - Intergenic
1168008935 19:53514339-53514361 CAGACACATGCCACCACACCCGG + Intergenic
1168026473 19:53647327-53647349 CAGACACATGCCACCACACCTGG - Intergenic
1168247715 19:55122015-55122037 CAGACGCCTGCCACCACACCTGG + Intergenic
1168270242 19:55245833-55245855 CAGAAACAAGGGCCCACACCAGG + Intronic
1168306010 19:55436458-55436480 CAGGCGCATGCCACCACACCTGG - Intronic
1168367965 19:55805680-55805702 CAGTTGCATGCCGCCACACCCGG + Intronic
1168605053 19:57752012-57752034 CAGGCACATGCTGCCACACCTGG + Intronic
1168623620 19:57898796-57898818 CAGGCACATGCCGCCACACCCGG - Intronic
1168654042 19:58113833-58113855 CAGGCGCATGCCACCACACCTGG - Intronic
1168675359 19:58273936-58273958 CAGGCGCATGCCACCACACCCGG + Intronic
1168716161 19:58528749-58528771 CAGGCGCATGCCACCACACCTGG - Intronic
1202633504 1_KI270706v1_random:21666-21688 CAGGTGCATGGCACCACACCTGG + Intergenic
925916758 2:8612486-8612508 CAGGTGCATGCCGCCACACCTGG - Intergenic
926139092 2:10357885-10357907 GAGAGGGAGGGGGCCACACCTGG + Intronic
926179987 2:10633967-10633989 CAGACACATGTCACCACACCTGG + Intronic
926270629 2:11363516-11363538 CAGGCGCATGCCACCACACCAGG + Intergenic
926750044 2:16191448-16191470 CAGGCGCATGCCACCACACCTGG + Intergenic
927396370 2:22655727-22655749 CAGACGCATGCCACCACACCAGG + Intergenic
927776060 2:25904184-25904206 CAGGCGCATGCCACCACACCTGG - Intergenic
927968658 2:27289457-27289479 CAGACACATGCCACCACACCTGG + Intronic
928074686 2:28253257-28253279 CAGGCGCATGCCACCACACCTGG - Intronic
928295440 2:30079014-30079036 CAGGCGCATGCCACCACACCTGG + Intergenic
928498478 2:31861081-31861103 CAGGTGCATGCTGCCACACCTGG + Intergenic
928575255 2:32648268-32648290 CAGGCGCATGCCACCACACCTGG + Intronic
928589967 2:32803862-32803884 CAGATGCATGCCACCACACCTGG - Intronic
928812894 2:35250506-35250528 CAGGCGCATGCCACCACACCTGG + Intergenic
928863033 2:35883180-35883202 CAGGTGCATGTGACCACACCTGG + Intergenic
928967344 2:36990042-36990064 CAGGCGCATGCCACCACACCTGG + Intronic
929497743 2:42461016-42461038 CAGACGCATGCTGCCACGCCTGG - Intronic
929560535 2:42953690-42953712 CAGAAGCATGCCACCACACCTGG - Intergenic
929562401 2:42964019-42964041 CAGGCACATGCTGCCACACCTGG - Intergenic
929636883 2:43532268-43532290 CAGGCGCATGGTGCCACTCCCGG - Intronic
929639758 2:43565943-43565965 CAGGCGCATGCCGCTACACCTGG - Intronic
929722368 2:44383305-44383327 CAGGCGCATGCCACCACACCCGG + Intronic
930126777 2:47804705-47804727 AAGAGGCATAGGGCCTCACCTGG - Intronic
930322287 2:49871182-49871204 CAGGCGCATGCCTCCACACCCGG + Intergenic
930649915 2:53954183-53954205 CAGGCGCGTGCCGCCACACCCGG - Intronic
930682997 2:54277533-54277555 CAGGCGCATGCCACCACACCTGG - Intronic
930804444 2:55476281-55476303 CAGACTCATGCCACCACACCTGG + Intergenic
931082184 2:58786337-58786359 CAGGCGCCTGCGGCCACGCCCGG - Intergenic
931259160 2:60601607-60601629 CAGGCACATGCCGCCACACCTGG + Intergenic
931574144 2:63702166-63702188 TAGACGCATGCCACCACACCCGG + Intronic
931702610 2:64921209-64921231 CAGATGCATGCCACCACACCTGG - Intergenic
932190855 2:69740822-69740844 CAGGCGCATGCCACCACACCCGG + Intronic
932272217 2:70420244-70420266 CAGAAGCCTGGGGCCAAAGCAGG - Intergenic
932318554 2:70802841-70802863 CAGGCGCATGCCACCACACCTGG - Intergenic
932611781 2:73205021-73205043 CAGGCACATGCCGCCACACCTGG + Intronic
932995278 2:76844275-76844297 CAGACGCATGCCACCACGCCCGG + Intronic
933238772 2:79896138-79896160 CAGGCACATGGCACCACACCTGG - Intronic
933323398 2:80805803-80805825 CAGGCACATGCTGCCACACCTGG - Intergenic
933646519 2:84817488-84817510 CAGACACATGATACCACACCTGG - Intronic
933681443 2:85105105-85105127 CAGGCGCATGCCACCACACCTGG - Intergenic
933794735 2:85910477-85910499 CAGGCGCATGCCACCACACCCGG - Intergenic
933936705 2:87210550-87210572 CAGGTGCATGCTGCCACACCTGG + Intergenic
934795102 2:97093615-97093637 CAGGCGCATGCCGCCACGCCCGG + Intronic
935008325 2:99104615-99104637 CAGGCGCATGCCACCACACCTGG + Intronic
935157086 2:100492992-100493014 CAGGCACATGGCGCCACGCCTGG - Intergenic
935255063 2:101302835-101302857 CAGGTGCATGCTGCCACACCTGG - Intronic
935520873 2:104103623-104103645 CAGGCGCATGCCACCACACCTGG - Intergenic
935546054 2:104400404-104400426 CAGACGCCTGCCACCACACCAGG + Intergenic
935785593 2:106545624-106545646 CAGACGCATACCACCACACCTGG - Intergenic
935889658 2:107662479-107662501 CAGGTGCATGCTGCCACACCCGG - Intergenic
936356440 2:111755275-111755297 CAGGTGCATGCTGCCACACCTGG - Intergenic
936590395 2:113798235-113798257 CAGGCGCATGCCACCACACCCGG + Intergenic
937948913 2:127368477-127368499 CAGGCGCATGCCACCACACCCGG - Intronic
938022260 2:127915669-127915691 CAGGCGCCTGTCGCCACACCTGG + Intergenic
938033321 2:128014477-128014499 CAGACGCATGCCACCACACCTGG + Intronic
938125349 2:128667088-128667110 CAGAGGCATGAAGCCGCACCAGG - Intergenic
938284213 2:130095168-130095190 CAGGCGCATGCTGCCACACCCGG + Intronic
938297563 2:130187901-130187923 TACAAGCATGGGGCCACACCTGG - Intronic
938334854 2:130483735-130483757 CAGGCGCATGCCACCACACCCGG + Intronic
938354967 2:130636934-130636956 CAGGCGCATGCCACCACACCCGG - Intronic
938403516 2:131013741-131013763 CAGGCGCATGCCGCCACACCCGG + Intronic
938431394 2:131243723-131243745 CAGGCGCATGCTGCCACACCCGG - Intronic
938459207 2:131486763-131486785 TACAAGCATGGGGCCACACCTGG + Intronic
938549558 2:132367712-132367734 CAGGCACATGCTGCCACACCTGG + Intergenic
938577050 2:132614691-132614713 CAGGCGCATGCCACCACACCAGG + Intronic
938824773 2:134993866-134993888 CAGGTGCATGGCACCACACCTGG - Intronic
938859111 2:135348114-135348136 CAGGCGCATGCCACCACACCCGG - Intronic
938897656 2:135768339-135768361 CAGGCGCATGCCACCACACCTGG + Intronic
940182339 2:150948911-150948933 CAGACACATGCCACCACACCTGG + Intergenic
940707201 2:157120179-157120201 CAGGCGCATGCTGCCACACCTGG + Intergenic
940967214 2:159852559-159852581 CAGGTGCATGCTGCCACACCTGG + Intronic
941661540 2:168200532-168200554 CAGGCGCATGCCACCACACCTGG - Intronic
941675095 2:168335498-168335520 CACACGCACGCTGCCACACCCGG - Intergenic
941712350 2:168727404-168727426 CAGGCGCATGCCACCACACCCGG - Intronic
941713410 2:168739026-168739048 CAGGCACATGCTGCCACACCCGG + Intronic
941833290 2:169987109-169987131 CAGATGCAAGGCACCACACCCGG - Intronic
942103734 2:172612800-172612822 CAGAGGCATGCCACCACACCTGG + Intergenic
942572423 2:177327598-177327620 CAGGCGCATGCCACCACACCTGG - Intronic
942671544 2:178381494-178381516 CAGGCGCATGCCACCACACCCGG + Intronic
942885996 2:180924816-180924838 CAGACACATGCCACCACACCTGG + Intergenic
943248816 2:185490759-185490781 CAGGCGCATGCCACCACACCCGG + Intergenic
943333553 2:186588394-186588416 CAGGCGCATGCCGCCACGCCCGG + Intergenic
943729274 2:191284773-191284795 CAGGCACATGCTGCCACACCTGG + Intronic
944106775 2:196087607-196087629 CAGTCGCATGCCACCACACCTGG + Intergenic
944112573 2:196149304-196149326 CAGGCGCGTGGCACCACACCCGG + Intronic
944242793 2:197501618-197501640 CAGGCGCATGCCACCACACCCGG - Intronic
944376390 2:199048847-199048869 CAGACACATGCCACCACACCTGG + Intergenic
944722849 2:202441121-202441143 CAGGCGCATGCTGCCACACCTGG + Intronic
945089417 2:206164978-206165000 CAGGCGCATGCCACCACACCTGG - Intergenic
945611783 2:212012885-212012907 CAGATGCATGTCACCACACCTGG + Intronic
945619953 2:212123258-212123280 CAGGCGCATGCCGCCACGCCCGG - Intronic
945971603 2:216236684-216236706 CAAAGGCATGGTGCCACAGCAGG - Intergenic
946229144 2:218280952-218280974 CAGACGCATGCCACCACGCCCGG + Intronic
946570542 2:221019349-221019371 CAGGCGCATGCCACCACACCTGG + Intergenic
946942617 2:224785621-224785643 CAGACGCCTGCCACCACACCCGG + Intronic
947157690 2:227179092-227179114 CAGATGCATGCCACCACACCTGG + Intronic
947218542 2:227771056-227771078 CAGACGCATGCCACCACACCAGG - Intergenic
947410807 2:229837490-229837512 CAGGCGCATGCCACCACACCTGG - Intronic
947416054 2:229897503-229897525 CAGGCGCATGCCACCACACCTGG - Intronic
947580260 2:231311625-231311647 CAGGCGCATGCCACCACACCTGG - Intronic
947788971 2:232851560-232851582 CAGGCACATGCCGCCACACCTGG + Intronic
947931105 2:233965989-233966011 CAGGCGCATGCCACCACACCCGG + Intronic
947956544 2:234196993-234197015 CAGGTGCATGCTGCCACACCTGG - Intergenic
948056646 2:235013549-235013571 CAGACGAGTTGGGCCCCACCAGG + Intronic
948072213 2:235137034-235137056 CAGACGCATGCCACCACACCTGG + Intergenic
948248004 2:236502810-236502832 CAGGCGCATGCCACCACACCCGG - Intronic
948516542 2:238507493-238507515 CAGACGCGTGCCACCACACCTGG + Intergenic
1168824338 20:799299-799321 CAGGCGCATGACGCCACGCCTGG - Intergenic
1169032393 20:2420100-2420122 CAGGCGCATGCCGCCACGCCCGG - Intronic
1169124506 20:3117539-3117561 CAGGCACATGCCGCCACACCCGG - Intronic
1169157385 20:3343303-3343325 CAGGCGCATGCCACCACACCTGG + Intronic
1169225786 20:3855919-3855941 CAGGCGCATGCCACCACACCTGG + Intronic
1169314017 20:4573077-4573099 CAGGCGCATGCCACCACACCCGG + Intergenic
1169431238 20:5538287-5538309 TAGACGCATGCCACCACACCCGG - Intergenic
1169569535 20:6891054-6891076 CAGGTGCATGCTGCCACACCTGG + Intergenic
1169976633 20:11336492-11336514 CAGAAGCATGCCACCACACCTGG - Intergenic
1170424305 20:16223368-16223390 CAGGCGCATGCTGCCACACCCGG + Intergenic
1170559306 20:17542454-17542476 CAGGTGCATGGCACCACACCTGG - Intronic
1170645905 20:18195611-18195633 CAGGCGCATGCCACCACACCCGG + Intergenic
1171179869 20:23084562-23084584 CAGACGCCTGGGGACCCACTGGG + Exonic
1171483580 20:25470715-25470737 CAGATGCATGCCGCCACTCCTGG - Intronic
1171526886 20:25820674-25820696 CAGGCGCATGCCGCCACTCCCGG + Intronic
1171549941 20:26035211-26035233 CAGGCGCATGCCGCCACTCCCGG - Intergenic
1171997285 20:31741619-31741641 CAGGCGCATGCCACCACACCCGG + Intronic
1172139112 20:32709290-32709312 CAGGCGCATGCCACCACACCCGG - Intronic
1172244589 20:33437282-33437304 CAGATGCATGCCACCACACCTGG - Intronic
1172437633 20:34941210-34941232 CAGGCGCATGCTGCCACACCTGG - Intronic
1172483091 20:35283149-35283171 CAGGCGCATCCCGCCACACCCGG - Intronic
1172495450 20:35379661-35379683 CAGGCGCATGCCACCACACCTGG - Intronic
1172508947 20:35486155-35486177 CAGGCGCATGCTACCACACCTGG + Intronic
1172516765 20:35540308-35540330 TAGACGCATGCCACCACACCTGG + Intergenic
1172556424 20:35845916-35845938 CAGACGCATCCAACCACACCTGG + Intronic
1172569814 20:35961070-35961092 CAGACGCCTGCCACCACACCCGG + Intronic
1172877795 20:38176617-38176639 CAGCCGCATCTGGCCACACAAGG + Intergenic
1172930383 20:38582252-38582274 CAGATGCATGCCACCACACCTGG - Intronic
1173102994 20:40104924-40104946 CAGGCGCATGCCACCACACCTGG - Intergenic
1173253115 20:41375037-41375059 CAGAATCCTGGGGCCCCACCAGG - Intergenic
1173260513 20:41430974-41430996 CAGGCGCATGCCACCACACCTGG + Intronic
1173509859 20:43618622-43618644 CAGGCGCATGCCACCACACCTGG + Intronic
1173607296 20:44340641-44340663 CAGGCGCATGCCACCACACCTGG - Intronic
1173977480 20:47197928-47197950 CAGACGCATGCCACCACACCTGG + Intergenic
1174012148 20:47458598-47458620 CAGACGTGTGCGACCACACCTGG - Intergenic
1174015703 20:47486486-47486508 CAGGCGCATGCTGCCACGCCTGG + Intergenic
1174327840 20:49793571-49793593 CAGGCACATGGCACCACACCTGG + Intergenic
1174376807 20:50131477-50131499 CAGGCGCATGCCACCACACCTGG - Intronic
1174403214 20:50287349-50287371 CAGGCGCATGCCGCCACGCCGGG + Intergenic
1174668266 20:52281483-52281505 CAGATGCATGCCACCACACCCGG + Intergenic
1174780916 20:53387904-53387926 CAGGCGCATGCTGCCACACCTGG - Intronic
1174818926 20:53710793-53710815 CAGGCGCATGCCACCACACCTGG - Intergenic
1174829121 20:53796791-53796813 CAGGCGCATGCCACCACACCTGG - Intergenic
1174904793 20:54539145-54539167 CAGGCGCAGGCTGCCACACCTGG - Intronic
1174984424 20:55434481-55434503 CAGACGCCTGCCACCACACCTGG + Intergenic
1175064264 20:56272170-56272192 GAGACGCCTGGAGCCACACCAGG - Intergenic
1175102673 20:56590846-56590868 CAGACGCATGCCACCACACCCGG + Intergenic
1175202189 20:57285695-57285717 CAGGCGCATGCCACCACACCTGG + Intergenic
1175864633 20:62168669-62168691 CAGGCGCATGCCACCACACCTGG - Intronic
1176151538 20:63593875-63593897 CAGGCGCACGCCGCCACACCCGG - Intronic
1176202882 20:63871183-63871205 CAGACGCCTGCCACCACACCTGG + Intronic
1176628275 21:9113756-9113778 CAGGCGCATGGAAACACACCTGG - Intergenic
1176715045 21:10343229-10343251 CAGACTCCTGCGGCCTCACCAGG + Intergenic
1176725783 21:10431463-10431485 CAGGCGCATGCTGCCACCCCTGG + Intergenic
1177228531 21:18288681-18288703 CAGGCGCATGCTGCCACACCTGG + Intronic
1177469287 21:21536532-21536554 CAGGCGCACGCTGCCACACCAGG + Intronic
1177819582 21:26016712-26016734 CAGGCGCATGCCACCACACCTGG + Intronic
1178016177 21:28348163-28348185 CAGGCGCATGCTACCACACCTGG + Intergenic
1178210122 21:30520625-30520647 CAGGCGCCTGCCGCCACACCTGG - Intergenic
1178295133 21:31403288-31403310 CAGACGCGTGCCACCACACCCGG + Intronic
1178312968 21:31544868-31544890 CAGGCGCATGCTGCCACGCCTGG - Intronic
1178517224 21:33258160-33258182 CAGACGCATGCCACCACGCCTGG - Intronic
1178787884 21:35671340-35671362 CAGGCGCACGGTGCCACGCCCGG + Intronic
1179252240 21:39680950-39680972 CAGGCGCATGCCACCACACCCGG - Intergenic
1179478291 21:41661859-41661881 CAGACGCACGCCACCACACCCGG + Intergenic
1179996445 21:44976565-44976587 CAGAGGCCTGGGGCCACCACGGG - Intronic
1180225570 21:46390168-46390190 CAGACGCATGCCACCACGCCTGG - Intronic
1180251647 21:46594146-46594168 CAGGCGCATGCTGCCACGCCTGG - Intergenic
1180367209 22:11951624-11951646 CAGGTGCATGGCACCACACCTGG - Intergenic
1180603303 22:17036709-17036731 CAGACTCCTGCGGCCTCACCAGG - Intergenic
1180669745 22:17543700-17543722 CAGATGCATGCCACCACACCCGG + Intronic
1180737637 22:18030100-18030122 CAGGCACATGACGCCACACCTGG + Intergenic
1180750915 22:18123715-18123737 CAGGCGCACGCTGCCACACCTGG + Intronic
1180885413 22:19240096-19240118 CAGATGCATGCCACCACACCCGG + Intronic
1181000586 22:19986241-19986263 CAGACCCTGGGGGCCACACCAGG + Intronic
1181021664 22:20106745-20106767 CAGAGGCGCAGGGCCACACCAGG - Intronic
1181095536 22:20502802-20502824 CAGGCCCATGCTGCCACACCTGG - Intronic
1181145481 22:20842953-20842975 TAGACGCATGCCGCCACGCCTGG - Intronic
1181176565 22:21040632-21040654 CAGGCGCACGCCGCCACACCTGG - Intergenic
1181263706 22:21617407-21617429 CAGGCGCATGCCACCACACCTGG + Intronic
1181486368 22:23234338-23234360 TCAACGCATGGGGCCACCCCAGG - Intronic
1181596196 22:23916476-23916498 CAGGCACATGCTGCCACACCCGG - Intergenic
1181716336 22:24732678-24732700 CAGGCGCCTGCCGCCACACCCGG - Intronic
1181726103 22:24812025-24812047 CAGGCGCATGCTACCACACCCGG - Intronic
1181734262 22:24869375-24869397 CAGATGCATGCCACCACACCTGG - Intronic
1181945832 22:26516982-26517004 CAGGCGCATGCCACCACACCCGG + Intergenic
1182095909 22:27625643-27625665 CAGGCGCATGCCACCACACCTGG + Intergenic
1182126903 22:27822493-27822515 CAGGCGCATGCTACCACACCTGG + Intergenic
1182139759 22:27943384-27943406 CAGAGGCATGCCACCACACCTGG - Intergenic
1182161236 22:28123838-28123860 CAGGCACATGCCGCCACACCTGG - Intronic
1182260489 22:29070614-29070636 CAGAGGCATGCCACCACACCTGG - Intergenic
1182415086 22:30216357-30216379 CAGACCCATGCCACCACACCTGG - Intergenic
1182529302 22:30942860-30942882 CAGACGCACGCTGCCACGCCCGG - Intronic
1182556660 22:31133061-31133083 CAGGGGCAGGGGGCCACATCAGG - Intronic
1182582014 22:31319641-31319663 CAGATGCATGCCACCACACCTGG + Intergenic
1182612769 22:31563133-31563155 CAGACGCATGCCGCCACGCCTGG + Intronic
1182639597 22:31756013-31756035 CAGGTGCATGCCGCCACACCTGG + Intronic
1182666211 22:31962047-31962069 CAGGTGCATGGCACCACACCTGG + Intergenic
1182673981 22:32022836-32022858 CAGGCGCATACTGCCACACCTGG - Intergenic
1182726222 22:32448209-32448231 CAGGCGCATGCCACCACACCTGG + Intronic
1183132932 22:35856887-35856909 CAGGCGCACGTGGCCACGCCTGG - Intronic
1183203318 22:36401291-36401313 CAGGCGCATGCCACCACACCTGG + Intergenic
1183554147 22:38512115-38512137 CAGGCGCATGCCACCACACCCGG + Intergenic
1183677761 22:39309325-39309347 CAGCTGCATGGGGCTACATCTGG + Intergenic
1183719110 22:39552018-39552040 CAGGCGCATGCTGCCACGCCCGG + Intergenic
1183837793 22:40470804-40470826 CAGGCGCCTGTTGCCACACCTGG - Intronic
1183925330 22:41201921-41201943 CAGGCGCATGTCACCACACCCGG + Intergenic
1183926248 22:41208270-41208292 CAGGCGCATGCCACCACACCTGG + Intronic
1183954928 22:41373904-41373926 CAGGCGCATGCTACCACACCCGG + Intronic
1183993818 22:41618218-41618240 CAGGCGCATGCCACCACACCTGG - Intronic
1184095149 22:42312434-42312456 CTGAGGCCTGGGGCCCCACCTGG - Intronic
1184480296 22:44742852-44742874 CAGACACATGCCACCACACCTGG + Intronic
1184804984 22:46788941-46788963 CAGAAACATGAGCCCACACCCGG - Intronic
949291002 3:2465532-2465554 CAGGCGCACGCTGCCACACCCGG - Intronic
949479402 3:4479091-4479113 CAGACGCGTGCCACCACACCTGG - Intergenic
949945750 3:9188556-9188578 AAGATGAATGGGGCCACACCAGG + Intronic
949961199 3:9313849-9313871 CAGGCGCATGCCACCACACCCGG - Intronic
950071883 3:10159337-10159359 CAGGCGCATGCCACCACACCTGG - Intergenic
950081671 3:10226801-10226823 CAGGCACATGCGACCACACCTGG - Intronic
950376716 3:12578458-12578480 CAGGCGCATGCCGCCACGCCTGG + Intronic
950645830 3:14376188-14376210 CAGGTGCCTGGGCCCACACCTGG + Intergenic
950655940 3:14436341-14436363 CAGGCGCACGTGACCACACCTGG + Intronic
950805165 3:15595751-15595773 CAGACGCATGCCACCACACCAGG + Intronic
950807432 3:15618666-15618688 CAGACGCCTGCCACCACACCTGG + Intronic
950836403 3:15923476-15923498 CAGATGCATGCCACCACACCTGG - Intergenic
951140491 3:19152791-19152813 CAGGTGCATGCCGCCACACCCGG - Intronic
951456969 3:22903694-22903716 CAGACACGTGCCGCCACACCTGG - Intergenic
951903526 3:27680616-27680638 CAGACACATGCCACCACACCTGG + Intergenic
952284318 3:31953548-31953570 CAGATGCATGCCACCACACCTGG + Intronic
952326078 3:32321738-32321760 CAGGCGCATGCCACCACACCTGG + Intronic
952370599 3:32719104-32719126 CAGGCGCATGCCACCACACCTGG - Intronic
952619063 3:35314003-35314025 CAGGCGCATGCCACCACACCCGG - Intergenic
952793529 3:37218746-37218768 CAGGCGCATGCCACCACACCTGG - Intergenic
953125050 3:40083992-40084014 CAGACGCCTGCCACCACACCCGG - Intronic
953261935 3:41348064-41348086 CAGATGCATGCCACCACACCTGG - Intronic
953326664 3:42017116-42017138 CACACGCATGCTGCCACGCCCGG - Intronic
953432102 3:42848358-42848380 CAGATGCATGCCACCACACCTGG + Intronic
953590779 3:44251261-44251283 CAGGTGCATGCCGCCACACCTGG + Intronic
953804534 3:46056614-46056636 CAGGCGCATGCCACCACACCTGG + Intergenic
953821549 3:46211339-46211361 CAGGTGCATGGCACCACACCTGG + Intronic
953989253 3:47471510-47471532 CAGGCGCATGCCACCACACCTGG + Intronic
954051921 3:47986481-47986503 CAGGCGCATGCCACCACACCTGG + Intronic
954157120 3:48691973-48691995 CAGGCGCATGCCACCACACCGGG + Intronic
954180142 3:48875243-48875265 CAGACGCCTGCTACCACACCTGG + Intronic
954203354 3:49038882-49038904 CAGGTGCATGCTGCCACACCCGG - Intronic
954266532 3:49474195-49474217 CAGGCGCATGCCACCACACCCGG + Intronic
954336472 3:49921298-49921320 CAGACGCCTGCCACCACACCCGG + Intronic
954466135 3:50655949-50655971 CAGGCGCATGCCACCACACCCGG - Intergenic
954743990 3:52776557-52776579 CAGACGCATGCCACCATACCTGG + Intergenic
954830319 3:53415946-53415968 CAGGCGCATGCCACCACACCTGG + Intergenic
955170996 3:56565414-56565436 CAGGCGCATGCCACCACACCCGG + Intronic
955316186 3:57941102-57941124 CAGACGCCTGCCACCACACCCGG - Intergenic
955323979 3:57995491-57995513 CAGGCACATGCCGCCACACCTGG - Intergenic
955682204 3:61513993-61514015 CAGGCGCATGCCACCACACCTGG - Intergenic
955969966 3:64429062-64429084 CAGGCGCATGCCACCACACCTGG + Intronic
957120137 3:76079624-76079646 GAGGCGCATGCCGCCACACCCGG + Intronic
957195204 3:77058813-77058835 CAGAGGCAAGCCGCCACACCTGG + Intronic
957713753 3:83897933-83897955 CAGGCGCATGCCACCACACCTGG - Intergenic
958007583 3:87832468-87832490 CAGGCGCACGCCGCCACACCCGG + Intergenic
958254603 3:91311037-91311059 CAGGCGCATGCTGCCACGCCTGG - Intergenic
958935666 3:100253065-100253087 CAGGCGCATGCCACCACACCTGG + Intergenic
959012518 3:101094654-101094676 CAGGCGCATGCCACCACACCTGG + Intergenic
959286312 3:104415466-104415488 CAGGCGCATGCTGCCACTCCCGG - Intergenic
959451795 3:106513864-106513886 CAGATGCATGCCACCACACCCGG - Intergenic
959463080 3:106650782-106650804 CAGGCGCATGCCGCCACGCCTGG + Intergenic
959479121 3:106849590-106849612 CAGGCGCATGCCACCACACCCGG - Intergenic
959639695 3:108618916-108618938 CAGGCGCATGCCACCACACCTGG - Intronic
960098101 3:113707648-113707670 CAGGCGCATGCCACCACACCCGG - Intergenic
960132817 3:114075649-114075671 CAGGTGCATGCTGCCACACCCGG + Intronic
960318087 3:116202276-116202298 CAGGCGCATGCCACCACACCTGG + Intronic
960833738 3:121881650-121881672 CAGGCGCATGCTGCCACACCCGG + Intronic
960896558 3:122512579-122512601 CAGGGGCATGAGGCCACACTCGG - Intronic
961005215 3:123400799-123400821 CAGGCGCATGCCACCACACCTGG - Intronic
961252350 3:125518317-125518339 CAGATGCATGCCACCACACCTGG - Intronic
961581155 3:127883603-127883625 CAGGCGCATGCCACCACACCTGG + Intergenic
961610737 3:128135388-128135410 CAGGTGCATGCCGCCACACCTGG - Intronic
961666230 3:128494567-128494589 CAGACACATGGGCAAACACCTGG - Intergenic
961710192 3:128822531-128822553 CAGGCGCATGCCACCACACCTGG - Intergenic
961778607 3:129307773-129307795 CAGACGCATGCCACCACACCCGG + Intergenic
962304002 3:134269965-134269987 CAGATGCATGCTGCCACACCTGG + Intergenic
962336051 3:134531438-134531460 CAGGCGCATGCCACCACACCTGG - Intronic
962528244 3:136255017-136255039 CAGGCGCATGCCACCACACCCGG + Intronic
962559908 3:136594911-136594933 CAGACACATGCCACCACACCTGG + Intronic
962579642 3:136786211-136786233 CAGACGCATGCCACCACACCTGG + Intergenic
962770574 3:138607452-138607474 CAGACGCATGCCACCACGCCCGG + Intergenic
962793077 3:138828928-138828950 CAGGCGCATGCCACCACACCAGG + Intronic
963157815 3:142117953-142117975 CAGGCGCATGCCACCACACCCGG - Intronic
963170316 3:142243591-142243613 TAGACGCATGCCACCACACCTGG + Intergenic
964003241 3:151802167-151802189 CAGACGCCTGCCACCACACCTGG + Intergenic
964494671 3:157275431-157275453 CAGGCGCATGCCACCACACCCGG - Intronic
964551515 3:157890104-157890126 CAGGAGCATGGCACCACACCCGG + Intergenic
964629827 3:158798430-158798452 CAGGCGCATGTCACCACACCTGG + Intronic
965106362 3:164360250-164360272 CAGGCGCATGCCACCACACCTGG - Intergenic
965161906 3:165143854-165143876 CAGGCGCACGCTGCCACACCTGG + Intergenic
965916079 3:173847727-173847749 CAGGCGCATGCCACCACACCTGG - Intronic
965982620 3:174711940-174711962 CAGGCGCATGCCACCACACCTGG + Intronic
966417639 3:179705863-179705885 CAGGCGCATGCCACCACACCTGG + Intronic
966700544 3:182845145-182845167 CAGGCGCATGCCGCCACGCCTGG + Intronic
966748134 3:183297599-183297621 CAGATGCATGCCACCACACCAGG + Intronic
966788167 3:183639056-183639078 CAGCCGCCTGCGGCCACACCCGG - Intronic
967163824 3:186762712-186762734 CAGACGCATGCCACCACGCCTGG + Intergenic
967640005 3:191851160-191851182 CAGGCGCATGCCGCCACGCCCGG - Intergenic
967804893 3:193707130-193707152 CAGGCGCATGCCACCACACCCGG + Intergenic
967893079 3:194376846-194376868 CAGGCGCCTGCCGCCACACCCGG - Intergenic
968330697 3:197867132-197867154 CAGGCGCCTGCTGCCACACCCGG - Intronic
1202741168 3_GL000221v1_random:57537-57559 CAGGTGCATGGCACCACACCTGG - Intergenic
968508542 4:983965-983987 CAGACGCATGCCACCACGCCCGG + Intronic
968597558 4:1493232-1493254 CAGACCCATGGGGCCACCCAGGG + Intergenic
968611979 4:1561446-1561468 CAGACACATGTGGACACACGTGG - Intergenic
969248096 4:5948650-5948672 CAGGTGCATGGCACCACACCCGG - Intronic
969320742 4:6411011-6411033 CAGGCGCATGCCACCACACCTGG + Intronic
970448831 4:16147512-16147534 CAGGTGCATGCCGCCACACCCGG + Intergenic
970517351 4:16845964-16845986 CAGGCGCATGCTGCCACGCCTGG - Intronic
970533504 4:17005872-17005894 CAGATGCATGCTACCACACCGGG - Intergenic
970556953 4:17243419-17243441 CAGGCGCATGCCACCACACCCGG - Intergenic
970607146 4:17691541-17691563 CAGGCGCATGCCACCACACCAGG - Intronic
971321004 4:25606108-25606130 CAGGCGCATGCCACCACACCCGG + Intergenic
971346035 4:25812567-25812589 CAGATGCCTGCAGCCACACCTGG - Intronic
971679721 4:29681571-29681593 CAGACCCATGCCACCACACCTGG + Intergenic
972005584 4:34099788-34099810 CAGACACATGACACCACACCTGG + Intergenic
972054450 4:34781638-34781660 CAGGCGCCTGCCGCCACACCCGG + Intergenic
972054705 4:34785040-34785062 CAGACGCATGCCACCACGCCTGG + Intergenic
972234291 4:37112618-37112640 CAGGCGCATGCCACCACACCAGG + Intergenic
972287303 4:37661420-37661442 CAGGCGCACGCTGCCACACCTGG + Intronic
972422418 4:38901428-38901450 CAGGCGCCTGCCGCCACACCCGG + Intronic
972454385 4:39239118-39239140 CAGGCGCATGCCACCACACCCGG + Intronic
972499193 4:39661885-39661907 CAGATGCATGTCACCACACCCGG - Intergenic
972505576 4:39717371-39717393 CAGATGCATGCTGCCACACCCGG + Intronic
972516696 4:39816015-39816037 CAGGCGCATGCCGCCACGCCCGG - Intergenic
972731284 4:41797895-41797917 CAGGCACATGCCGCCACACCCGG + Intergenic
972792480 4:42386498-42386520 CAGATGCATGCCACCACACCTGG - Intergenic
972983092 4:44728992-44729014 CAGGCGCATGCCACCACACCCGG + Intergenic
973065075 4:45780023-45780045 CAGGCGCATGCCACCACACCTGG + Intergenic
973363131 4:49183672-49183694 CAGGTGCATGGCACCACACCTGG + Intergenic
973766645 4:54168983-54169005 CAGACACATGCCACCACACCTGG - Intronic
974048105 4:56914074-56914096 CAGACGCATGCCACCACACCTGG + Intronic
974771353 4:66418135-66418157 TAGATGCATGGCACCACACCGGG - Intergenic
975094755 4:70444907-70444929 CAGGCGCATGCCCCCACACCTGG - Intronic
975103811 4:70545871-70545893 CAGGCACATGGTACCACACCTGG - Intergenic
975242802 4:72081628-72081650 CAGATGCATGCCACCACACCTGG + Intronic
975587856 4:75968887-75968909 CAGGCGCATGCCACCACACCTGG - Intronic
975866189 4:78726182-78726204 CAGGCACATGCTGCCACACCTGG - Intergenic
976177211 4:82366701-82366723 CAGGCGCATGTAACCACACCTGG + Intronic
976259319 4:83130473-83130495 CAGACGCCTGCCACCACACCCGG - Intronic
976305913 4:83559464-83559486 CAGGCGCATGCTGCCACGCCTGG + Intronic
976711880 4:88081384-88081406 CAGACGCCTGACACCACACCCGG + Intergenic
976714228 4:88106278-88106300 CAGACACATGCCACCACACCTGG + Intronic
976776791 4:88715670-88715692 CAGACGCCTGCCACCACACCTGG - Intergenic
976800059 4:88979826-88979848 CAGACACATGCCACCACACCTGG - Intronic
977055789 4:92188751-92188773 CAGGCGCCTGCCGCCACACCCGG + Intergenic
977251525 4:94694219-94694241 CAGACGCATGCCACCACGCCCGG + Intergenic
977523792 4:98120221-98120243 CAGGTGCATGGTACCACACCTGG + Intronic
977603133 4:98955577-98955599 CAGGCGCATGCCACCACACCCGG + Intergenic
977686011 4:99848368-99848390 CAGACGCATGCCACCACGCCTGG + Intronic
978361839 4:107939018-107939040 CAGGCGCATGCCACCACACCCGG - Intronic
978362325 4:107944444-107944466 CAGATGCATGCCACCACACCCGG + Intronic
978560391 4:110027850-110027872 CAGGCGCATGCCACCACACCTGG + Intergenic
978567027 4:110094104-110094126 CAGACGCATGCCACCGCACCTGG - Intronic
978717077 4:111857653-111857675 CAGGCGCATGCCACCACACCTGG - Intergenic
978758934 4:112334288-112334310 CAGGCGCATGCCACCACACCTGG - Intronic
978790475 4:112658943-112658965 CAGGCGCATGCCGCCACTCCTGG + Intergenic
978802355 4:112767416-112767438 CAGACACATGCCACCACACCCGG - Intergenic
978868862 4:113550313-113550335 CAGGTGCATGCTGCCACACCTGG + Intronic
979598262 4:122557902-122557924 CAGGCGCATGCTGCCACGCCCGG - Intergenic
979710412 4:123772669-123772691 CACACGCATGGGGGCACTCAGGG + Intergenic
979861897 4:125704574-125704596 CAGGCGCCTGCCGCCACACCAGG - Intergenic
979864568 4:125737550-125737572 CAGGCGCGTGGCACCACACCTGG - Intergenic
980040875 4:127938438-127938460 CAGGCGCATGCCGCCACGCCTGG - Intronic
980676149 4:136084271-136084293 CAGACACATGCCACCACACCTGG - Intergenic
980747931 4:137044764-137044786 CAGGCGCATGCCACCACACCTGG + Intergenic
981021977 4:140038974-140038996 TAGGCGCATGCTGCCACACCTGG - Intronic
981216820 4:142179328-142179350 CAGGTGCATGCTGCCACACCTGG - Intronic
981609633 4:146579461-146579483 CAGACGTATGCCACCACACCTGG - Intergenic
981666768 4:147236749-147236771 CAAAGGCAGGGGGCTACACCAGG - Intergenic
981683534 4:147427549-147427571 CAGGCGCATGCTGCCACACCTGG + Intergenic
981710018 4:147699735-147699757 CAGACGCATGCCACCACATCTGG - Intergenic
981719646 4:147788302-147788324 CAGGCGCATGCCACCACACCTGG - Intronic
981755563 4:148138524-148138546 CAGACACATGCCACCACACCTGG + Intronic
981838336 4:149081247-149081269 CAGGCACATGCTGCCACACCTGG + Intergenic
981920756 4:150081853-150081875 CAGGCGCCTGCCGCCACACCCGG - Intronic
982007906 4:151080499-151080521 CAGGCGCATGCCACCACACCCGG - Intergenic
982201905 4:152969810-152969832 CAGGCGCATGTCACCACACCAGG + Intronic
982211213 4:153038219-153038241 CAGATGCATGCCACCACACCTGG - Intergenic
982844640 4:160234465-160234487 CAGATGCATGCCACCACACCTGG + Intergenic
982930020 4:161393019-161393041 CAGATGCATGGCACCATACCTGG - Intronic
983207122 4:164922172-164922194 CAGACGCATGCCACCACACATGG + Intergenic
983541699 4:168918054-168918076 CAGATGCATGCCACCACACCTGG - Intronic
983597883 4:169490998-169491020 CAGGCGCATGCCACCACACCTGG - Intronic
984475273 4:180227276-180227298 CAGACACATGCCACCACACCTGG - Intergenic
984591807 4:181625669-181625691 CAGGCGCCTGCCGCCACACCCGG - Intergenic
984705683 4:182845589-182845611 CAGGCGCATGCCACCACACCTGG + Intergenic
984999753 4:185471493-185471515 CGGACGCAGGGGGCCGCAGCGGG + Intronic
985011700 4:185588944-185588966 CAGAGGCTTGTGGCCGCACCAGG + Intronic
985254363 4:188055170-188055192 CAGGCACATGCCGCCACACCTGG - Intergenic
985274415 4:188223935-188223957 CAGGCACATGCCGCCACACCTGG - Intergenic
985432363 4:189893721-189893743 CAGGCGCATGCCACCACACCTGG - Intergenic
986175126 5:5345886-5345908 CAGATGCATGCCACCACACCAGG - Intergenic
986750663 5:10784381-10784403 CAGGCGCATGTTACCACACCTGG - Intergenic
987311440 5:16684902-16684924 CAGGCGCTTGCCGCCACACCCGG - Intronic
987793031 5:22592885-22592907 CAGGCGCATGCCACCACACCTGG - Intronic
987933415 5:24431305-24431327 CAGGCGCATGCCACCACACCTGG + Intergenic
988563409 5:32300930-32300952 CAGGCGCATGCCACCACACCCGG - Intronic
988787260 5:34576669-34576691 CAGATGTATGCTGCCACACCTGG - Intergenic
988827106 5:34948720-34948742 CAGGCGCATGGCACCACGCCCGG - Intronic
989163233 5:38411283-38411305 CAGGCGCATGCCACCACACCCGG - Intronic
990257994 5:53991397-53991419 CAGGCGCATGCAACCACACCTGG - Intronic
991071757 5:62490896-62490918 CAGGCGCATGCCACCACACCTGG + Intronic
991297776 5:65099953-65099975 CAGGCGCTTGCGACCACACCGGG - Intergenic
991709852 5:69397972-69397994 CAGGCGCACGCCGCCACACCCGG - Intronic
992321621 5:75618886-75618908 CAGACGCACGCCACCACACCCGG + Intronic
992343550 5:75851790-75851812 CAGGCGCATGGCGCCACGCCAGG + Intergenic
992401925 5:76419477-76419499 CAGACACATGCCACCACACCTGG + Intronic
992448691 5:76856340-76856362 CAGGTGCATGGCACCACACCTGG + Intronic
992588949 5:78273260-78273282 CAGGCGCATGTCACCACACCTGG - Intronic
992627041 5:78645723-78645745 CAGATGCATGCCACCACACCCGG + Intronic
992835468 5:80636616-80636638 CAGGCGCATGCCACCACACCTGG - Intronic
992837135 5:80652619-80652641 CAGACGCCTGCCACCACACCTGG - Intronic
992857611 5:80878738-80878760 CAGGCGCATGCCACCACACCTGG - Intergenic
992943033 5:81781832-81781854 CAGGCGCATGCCACCACACCTGG + Intergenic
993155286 5:84214859-84214881 CAGGCGCATGCTGCCACACCTGG + Intronic
993233075 5:85264709-85264731 CAGGCGCATGCCACCACACCCGG - Intergenic
993447254 5:88028444-88028466 CAGGCGCATGCCACCACACCTGG + Intergenic
993616397 5:90117641-90117663 CAGGCGCATGCTACCACACCTGG - Intergenic
993720267 5:91315135-91315157 CAGACGCCTGCCACCACACCTGG + Intergenic
993738595 5:91507937-91507959 CAGGCGCATGCCACCACACCTGG + Intergenic
993784111 5:92107545-92107567 CAGGCGCATACTGCCACACCTGG - Intergenic
994625696 5:102215717-102215739 CAGGCGCATGCTGCCACGCCCGG - Intergenic
994894347 5:105683315-105683337 CAGGCGCATGCCACCACACCAGG + Intergenic
995031085 5:107482161-107482183 CAGGCGCATGCTACCACACCTGG - Intronic
995081686 5:108058625-108058647 CAGGCACATGCTGCCACACCCGG + Intronic
995130010 5:108620244-108620266 CAGGTGCATGCCGCCACACCCGG - Intergenic
995317196 5:110788774-110788796 CAGGCGCACGCTGCCACACCTGG + Intergenic
995509438 5:112893265-112893287 CAGACGCCTGCCACCACACCTGG - Intronic
995550272 5:113274500-113274522 CAGGCGCATGCCACCACACCCGG + Intronic
995564246 5:113417110-113417132 CAGACGCATGCCACCACGCCTGG + Intronic
995781520 5:115781167-115781189 CAGGCGCATGCCACCACACCCGG + Intergenic
996381992 5:122871625-122871647 CAGGCGCATGTCACCACACCCGG - Intronic
996434451 5:123419402-123419424 CAGGCGCATGCCACCACACCCGG - Intronic
996730696 5:126714926-126714948 CAGGCGCATGCCACCACACCCGG + Intergenic
997144547 5:131418605-131418627 CAGGCGCATGCTACCACACCCGG - Intergenic
997497772 5:134344920-134344942 CAGGCGCATGGCACCACACCCGG - Intronic
997554856 5:134787063-134787085 CAGACGCATGCTACCACACCCGG + Intronic
998250130 5:140547048-140547070 CAGGCGCATGCTGCCGCACCCGG + Intronic
998260757 5:140630134-140630156 CAGACACATGCCACCACACCCGG + Intergenic
998464009 5:142328598-142328620 CAGGCGCATGCCGCCACGCCCGG - Intergenic
998909104 5:146938921-146938943 CAGGCGCATGCTGCCACACCTGG + Intronic
999929360 5:156413617-156413639 CAGACACATGCCACCACACCTGG + Intronic
1000117775 5:158169602-158169624 CAGGCACACGTGGCCACACCCGG + Intergenic
1000608886 5:163354197-163354219 CAGGCGCATGCCACCACACCCGG + Intergenic
1000993822 5:167938798-167938820 CAGGCGCATGCCACCACACCCGG - Intronic
1001059458 5:168476145-168476167 CAGGCGCATGCCGCCACACCCGG - Intergenic
1001078256 5:168646127-168646149 CAGGCGCATGCCACCACACCCGG - Intergenic
1001322686 5:170695874-170695896 CAGGCGCATGCCACCACACCTGG - Intronic
1001325516 5:170720994-170721016 CAGGCCCATGGGGACACAGCTGG - Intronic
1001375597 5:171254102-171254124 CAGGCGCATGCCACCACACCCGG - Intronic
1001482891 5:172100642-172100664 CAGACGCCTGCCACCACACCCGG - Intronic
1001555782 5:172636226-172636248 CAGGCGCATGCTACCACACCTGG + Intergenic
1001641993 5:173251052-173251074 CAGGCACATGCGGCCACACCCGG + Intergenic
1001716309 5:173818990-173819012 CAGGCGCATGCCACCACACCCGG - Intergenic
1001890413 5:175333579-175333601 CAGGCGCATGCCCCCACACCTGG - Intergenic
1002067391 5:176658828-176658850 CAGGGGCATGGGGCCAAAGCTGG - Exonic
1002078180 5:176722023-176722045 CAGGCACATGGCACCACACCTGG + Intergenic
1002215700 5:177630997-177631019 CAGGCGCATGCTGCCACGCCCGG - Intergenic
1002346228 5:178549134-178549156 CAGGCGCATGCCACCACACCCGG + Intronic
1002498013 5:179628836-179628858 CAGACGTATGCCACCACACCCGG - Intronic
1003420769 6:5956573-5956595 CAGGCGCATGCTGCCACGCCCGG - Intergenic
1003553292 6:7118261-7118283 CAGGCGCATGCCACCACACCTGG + Intronic
1003678030 6:8225086-8225108 CAGGCGCATGTCACCACACCCGG + Intergenic
1003880189 6:10473529-10473551 CAGATGCATGCCACCACACCTGG + Intergenic
1003889191 6:10548899-10548921 CAGGCGCATGCCACCACACCCGG + Intronic
1004387409 6:15184920-15184942 CAGGCGCATGCCACCACACCTGG - Intergenic
1004549505 6:16632852-16632874 CAGGCGCATGCCACCACACCCGG - Intronic
1004646202 6:17563608-17563630 CAGGCGCATGTCACCACACCTGG - Intergenic
1004723374 6:18288611-18288633 CAGGTGCATGCCGCCACACCTGG - Intergenic
1004847517 6:19661748-19661770 CAGATGCATGCCACCACACCCGG - Intergenic
1005462378 6:26081416-26081438 CAGACCCAGGGTGCAACACCAGG - Intergenic
1005468292 6:26136864-26136886 CAGGTGCATGCTGCCACACCTGG + Intronic
1005476783 6:26215729-26215751 CAGACGCAAGCCGTCACACCTGG + Intergenic
1005628981 6:27689596-27689618 CAGGCGCGTGCTGCCACACCCGG - Intergenic
1005803887 6:29455731-29455753 CAGGCGCATGCTGCCACACCCGG - Intronic
1006035766 6:31210718-31210740 CAGACGCCTGCCACCACACCTGG - Intergenic
1006118407 6:31788355-31788377 CAGGCGCATGCCACCACACCTGG - Intronic
1006231070 6:32587237-32587259 CAGGCGCATGCCACCACACCTGG - Intronic
1006505995 6:34489036-34489058 CAGGGGCATGCCGCCACACCTGG - Intronic
1006544381 6:34767475-34767497 CAGGTGCATGGCACCACACCTGG - Intronic
1006760241 6:36454482-36454504 CAGATGCATGCCACCACACCCGG + Intronic
1006846472 6:37065516-37065538 CAGGCGCATGTCACCACACCTGG + Intergenic
1007019577 6:38505820-38505842 CAGACGCATGCCACCACACCTGG - Intronic
1007579002 6:42944543-42944565 CAGGCGCATGCCACCACACCAGG - Intergenic
1007637815 6:43310044-43310066 CAGACACATGCCACCACACCTGG + Intronic
1007755054 6:44094049-44094071 CAGAAACATGAGGCCACCCCTGG + Intergenic
1007861979 6:44920019-44920041 CAGGCGCATGCCACCACACCCGG + Intronic
1007865418 6:44963854-44963876 CAGCCGCATGCAACCACACCCGG - Intronic
1007885524 6:45225134-45225156 CAGACGCATGCCACCACACCCGG - Intronic
1007989829 6:46243665-46243687 CAGGCGCATGCCACCACACCTGG - Intronic
1008251943 6:49251018-49251040 CAGACGCGTGACACCACACCTGG - Intergenic
1008594532 6:53028002-53028024 CAGGCGCATGCCACCACACCCGG - Intronic
1008708101 6:54187862-54187884 CAGGCGCGTGCTGCCACACCTGG - Intronic
1008871435 6:56276948-56276970 CAGGCGCATGCCGCCACGCCTGG + Intronic
1008900762 6:56612885-56612907 CAGACACATGCCACCACACCTGG - Intronic
1008987398 6:57561372-57561394 CAGGCGCACGCCGCCACACCCGG + Intronic
1010107498 6:72186986-72187008 CAGGCGCATGCCACCACACCTGG - Intronic
1010115986 6:72311826-72311848 CAGGCGCACGGTGCCACACCTGG - Intronic
1010195074 6:73231026-73231048 CAGACGCGTGCCACCACACCCGG + Intronic
1010205892 6:73322415-73322437 CAGGCGCATGCCACCACACCTGG - Intergenic
1010253182 6:73729654-73729676 CAGGCGCATGCCACCACACCTGG + Intronic
1010806046 6:80238238-80238260 CAGGCGCATGCCACCACACCCGG + Intronic
1011053421 6:83179166-83179188 CAGATGCATGCCACCACACCTGG - Intronic
1011558361 6:88591469-88591491 CAGACGCATGCCACCACACCTGG - Intergenic
1011594863 6:89006635-89006657 CAGATACATGCTGCCACACCTGG - Intergenic
1011639422 6:89405209-89405231 CAGGCGCACGCTGCCACACCTGG - Intronic
1011646196 6:89460576-89460598 CAGACGCCTGCCACCACACCTGG + Intronic
1012123463 6:95396498-95396520 CAGGCGCCTGCTGCCACACCTGG - Intergenic
1012180708 6:96149011-96149033 CAGGCACATGGCACCACACCTGG - Intronic
1012227004 6:96716236-96716258 CAGAGGCATAGGTCCTCACCGGG + Intergenic
1012238796 6:96849075-96849097 CAGGCGCATGCCGCCACGCCCGG - Intergenic
1012276939 6:97285222-97285244 CAGGCACATGGCGCCATACCCGG - Intergenic
1012461258 6:99463667-99463689 CAGGCGCATGTCACCACACCCGG - Intronic
1012899946 6:104993690-104993712 CAGATGCATGCCACCACACCTGG - Intronic
1012908631 6:105095184-105095206 CAGGCGCATGCCACCACACCTGG + Intergenic
1013030992 6:106332728-106332750 CAGGCGCATGCCACCACACCTGG - Intergenic
1013032121 6:106343771-106343793 CAGGCGCATGCCACCACACCTGG - Intergenic
1013060392 6:106628322-106628344 CAGGCGCATGCCACCACACCGGG - Intronic
1013082233 6:106822831-106822853 CAGGCGCATGCCGCCACGCCTGG - Intergenic
1013090604 6:106897074-106897096 CAGATGCATGCCACCACACCCGG - Intergenic
1013100967 6:106986465-106986487 CAGGCGCATGCCACCACACCCGG - Intergenic
1013311959 6:108903023-108903045 CAGACGCTTGTCACCACACCTGG - Intronic
1013441128 6:110170363-110170385 CAGGTGCATGTGACCACACCTGG + Intronic
1013507920 6:110817464-110817486 CAGACACATGCTACCACACCTGG - Intronic
1013509568 6:110832145-110832167 CAGGCGCATGCCACCACACCTGG + Intronic
1013657459 6:112260559-112260581 CAGGCGCATGCCACCACACCCGG + Intergenic
1013802397 6:113962819-113962841 CAGGCGCATGCCACCACACCTGG - Intronic
1014240644 6:119014914-119014936 CAGGCGCATGCCACCACACCTGG - Intronic
1014325078 6:119984184-119984206 CAGGCACATGCCGCCACACCTGG + Intergenic
1014379025 6:120715398-120715420 CAGATGCATGCCACCACACCCGG - Intergenic
1014388444 6:120830435-120830457 CATACTCATGTGGCCACAACTGG + Intergenic
1014441443 6:121478521-121478543 CAGGCGCATGCCACCACACCTGG - Intergenic
1014815683 6:125933257-125933279 CAGGTGCATGCTGCCACACCTGG - Intergenic
1014847257 6:126292806-126292828 CAGACACATGTCACCACACCTGG + Intergenic
1015218474 6:130777399-130777421 CAGGCGCTTGCCGCCACACCTGG - Intergenic
1015380430 6:132560930-132560952 CAGGTGCATGCTGCCACACCGGG - Intergenic
1015384176 6:132603157-132603179 CAGACACATACTGCCACACCAGG - Intergenic
1015761422 6:136665487-136665509 CAGAAGCATGCCACCACACCGGG + Intronic
1015917625 6:138233517-138233539 CAGGCGCATGCCACCACACCTGG + Intronic
1015934891 6:138398840-138398862 CAGGCGCATGCTACCACACCTGG - Intergenic
1015958448 6:138622359-138622381 CAGGCGCATGCGGCCACGCCCGG - Intronic
1016235861 6:141865555-141865577 CAGGAGCATGCTGCCACACCTGG - Intergenic
1016336062 6:143006328-143006350 CAGGCGCATGCCACCACACCTGG - Intergenic
1016340614 6:143058600-143058622 CAGGCGCATGCCACCACACCTGG - Intergenic
1016441250 6:144085754-144085776 CAGATGCATGCCACCACACCTGG - Intergenic
1016671811 6:146718202-146718224 CAGGCGCATGCCACCACACCTGG - Intronic
1016971481 6:149768231-149768253 CAGGCACATGGCACCACACCTGG + Intronic
1017195704 6:151697953-151697975 CAGGCGCATGCTGCCACACGGGG - Intronic
1017316510 6:153037566-153037588 CAGGCGCATGCCACCACACCCGG + Intronic
1017468522 6:154717245-154717267 CAGGCACATGGCACCACACCTGG - Intergenic
1017497965 6:154997779-154997801 CAGACGCGTGCCACCACACCTGG + Intronic
1017562336 6:155642111-155642133 CAGGCGCATGCTACCACACCTGG + Intergenic
1018666101 6:166139999-166140021 CAGGCCCATGCCGCCACACCCGG + Intergenic
1019391971 7:793539-793561 CAGGCGCATGCCACCACACCTGG + Intergenic
1019502560 7:1371760-1371782 CAGACGCATGCCGCCATGCCTGG - Intergenic
1019651804 7:2163514-2163536 CAGGCGCATGACACCACACCTGG + Intronic
1019680279 7:2344059-2344081 CAGGCGCACGGCACCACACCTGG - Intronic
1019681207 7:2350787-2350809 CAGGCGCCTGCGGCCACACCCGG + Intronic
1019981758 7:4626720-4626742 CAGATGCATGCCACCACACCTGG - Intergenic
1020003006 7:4766223-4766245 CAGAACCATGAGGCCACACTCGG - Exonic
1020283048 7:6660554-6660576 CAGACACATGCCACCACACCTGG - Intergenic
1020292608 7:6733720-6733742 CAGGCGCACGCTGCCACACCCGG + Intergenic
1020657641 7:10946216-10946238 CAGTCGCATGCCACCACACCTGG - Intergenic
1020806245 7:12793847-12793869 CAGGCGCCTGCCGCCACACCTGG - Intergenic
1021025657 7:15663473-15663495 CAGGCGCATGCCACCACACCCGG + Intronic
1021225581 7:18022055-18022077 CAGGCGCATGCCACCACACCTGG - Intergenic
1021377982 7:19932198-19932220 CAGGCGCATGCCACCACACCTGG - Intergenic
1021449346 7:20768212-20768234 CAGGCGCATGCCACCACACCCGG - Intronic
1021520804 7:21537343-21537365 CAGGCGCATGCTGCCACGCCCGG + Intergenic
1021553503 7:21896930-21896952 CAGTCGCATGCCACCACACCTGG - Intronic
1021703137 7:23340107-23340129 CAGAGGCAGTGGGCCAGACCTGG + Intronic
1021720440 7:23499542-23499564 CAGGCGCATGCTACCACACCCGG + Intergenic
1021847205 7:24774673-24774695 CAGGCGCATGCCACCACACCTGG + Intergenic
1022068773 7:26888814-26888836 CAGATGCATGTCACCACACCTGG - Intronic
1022086744 7:27075818-27075840 CAGACACATGCCACCACACCTGG - Intergenic
1022322938 7:29303915-29303937 CAGGCGCATGCCACCACACCTGG - Intronic
1022732101 7:33036952-33036974 CAGGCGCATGCCGCCACGCCTGG + Intronic
1022759312 7:33330154-33330176 CAGATGCATGCCACCACACCCGG + Intronic
1022762219 7:33366685-33366707 CAGGCGCATGCCACCACACCCGG + Intronic
1023075006 7:36473636-36473658 CAGGCACATTGGGCCACCCCAGG + Intergenic
1023236221 7:38091677-38091699 CAGACACATGCTACCACACCTGG - Intergenic
1023408106 7:39857961-39857983 CAGACGCCTGTCACCACACCTGG + Intergenic
1023717069 7:43055422-43055444 CAGGCGCATGCCACCACACCCGG + Intergenic
1023809349 7:43900000-43900022 CAGGCGCATGCCACCACACCTGG - Intronic
1023917447 7:44600657-44600679 CAGATGCATGCCACCACACCTGG - Intergenic
1025137755 7:56434577-56434599 CAGACGCCTGTCACCACACCTGG - Intergenic
1025186399 7:56863100-56863122 CAGGCGCATGCCACCACACCCGG - Intergenic
1025628539 7:63245389-63245411 CAGGCGCATGCCGCCACGCCAGG - Intergenic
1025685523 7:63713795-63713817 CAGGCGCATGCCACCACACCCGG + Intergenic
1025859919 7:65317054-65317076 CAGGCGCATGCCACCACACCTGG - Intergenic
1026158048 7:67844496-67844518 CAGATGCATGCCACCACACCTGG + Intergenic
1026197464 7:68185436-68185458 CAGACGCCTGCCACCACACCCGG + Intergenic
1026349501 7:69503447-69503469 CAGAGGCATGCCACCACACCAGG + Intergenic
1026443293 7:70462107-70462129 CAGACGCATGCCACCACACCTGG - Intronic
1026518066 7:71089895-71089917 CAGACGCACGCCACCACACCCGG - Intergenic
1026636584 7:72088023-72088045 CAGACGCGTGCAACCACACCTGG - Intronic
1026687579 7:72524555-72524577 CAGACGCCTGCCACCACACCTGG + Intergenic
1026775590 7:73229219-73229241 CAGACGTATGCCACCACACCCGG - Intergenic
1027071581 7:75163345-75163367 CAGACGTATGCCACCACACCCGG + Intergenic
1027121308 7:75523847-75523869 CAGATGCACGCTGCCACACCTGG - Intergenic
1027343511 7:77234590-77234612 CAGGCGCATGCCACCACACCTGG - Intronic
1027768809 7:82380835-82380857 CAGGCGCATGCCACCACACCCGG + Intronic
1028011932 7:85656629-85656651 CAGATGCATGCCACCACACCTGG - Intergenic
1028214519 7:88115100-88115122 CAGGCGCATGCCACCACACCTGG - Intronic
1028266389 7:88731995-88732017 CAGACGCATGCCACCACGCCCGG - Intergenic
1028270113 7:88777703-88777725 CAGACACATGCCACCACACCTGG - Intronic
1028420481 7:90627350-90627372 CAGGCGCATGCCACCACACCTGG + Intronic
1028510790 7:91624134-91624156 CAGGCGCATGCCACCACACCTGG + Intergenic
1028542766 7:91961699-91961721 CAGGCGCCTGGCACCACACCCGG - Intronic
1028568426 7:92259094-92259116 CAGATGCATGCCACCACACCTGG + Intronic
1029031632 7:97474201-97474223 CAGGCGCATGCCACCACACCTGG - Intergenic
1029181023 7:98701872-98701894 CAGGCGTATGCTGCCACACCCGG + Intergenic
1029205173 7:98865463-98865485 CAGGCGCATGCCACCACACCTGG - Intronic
1029214628 7:98938029-98938051 CAGATGCACGCTGCCACACCAGG - Intronic
1029534365 7:101147399-101147421 CAGGCGCATGCCACCACACCTGG - Intergenic
1029829652 7:103243436-103243458 CAGGCGCATGCTGCCACGCCCGG + Intergenic
1030023148 7:105295067-105295089 CAGGCGCATGCCACCACACCTGG - Intronic
1030056872 7:105590918-105590940 CAGACACATGCCACCACACCTGG + Intronic
1030068213 7:105676695-105676717 CAGACACATGCCACCACACCTGG - Intronic
1030539605 7:110813568-110813590 CAGACGCATGCCACCACACCTGG + Intronic
1030562810 7:111112088-111112110 CAGGCGCATGCCACCACACCCGG + Intronic
1030604117 7:111621042-111621064 CAGGCGCATGACACCACACCTGG - Intergenic
1030755147 7:113278618-113278640 CAGGTGCATGCTGCCACACCAGG + Intergenic
1031163023 7:118190960-118190982 CAGGCGCATGCCACCACACCCGG - Intronic
1031533543 7:122906316-122906338 CAGACGCATGCCACCACGCCCGG + Intergenic
1031851365 7:126868163-126868185 CAGACCCACTGGGCCACAGCTGG + Intronic
1031933076 7:127706397-127706419 CAGGCGCATGCCACCACACCTGG + Intronic
1031944492 7:127825251-127825273 CAGGCGCATGCCACCACACCTGG + Intronic
1032036696 7:128526782-128526804 CAGACGCATGCTGCCACGCCTGG + Intergenic
1032208277 7:129888615-129888637 CAGGCGCCTGGCACCACACCTGG + Intronic
1032407878 7:131670366-131670388 CAGGCGCATGATACCACACCAGG + Intergenic
1032633347 7:133678751-133678773 CAGGCGCATGCCTCCACACCTGG + Intronic
1032673923 7:134110778-134110800 CAGACGCATGCCACCACACCCGG + Intergenic
1033056678 7:138061393-138061415 CAGGCGCATGCCACCACACCTGG - Intronic
1033667640 7:143457894-143457916 CAGGCGCATGCGACCACACCTGG - Intergenic
1033714977 7:143991569-143991591 CAGGCGCATGCCACCACACCTGG + Intergenic
1034216655 7:149412663-149412685 CAGGCGCACGCCGCCACACCTGG - Intergenic
1034587813 7:152111295-152111317 CAGGCGCATGCCGCCACACCTGG + Intronic
1034611270 7:152371754-152371776 CAGACACATGCCACCACACCTGG + Intronic
1034616160 7:152418572-152418594 CAGGCGCATGCCACCACACCTGG + Intronic
1034624828 7:152484631-152484653 CAGACACATGCCCCCACACCTGG + Intergenic
1036613899 8:10373687-10373709 CAGGCACAGGGGGCAACACCAGG + Intronic
1036931798 8:12963288-12963310 CAGACGCATGCCACCACACCAGG - Intronic
1037262559 8:17025351-17025373 CAGGCGCATGCCACCACACCTGG + Intergenic
1037328236 8:17716695-17716717 CAGGCGCCCGCGGCCACACCCGG + Intronic
1037385369 8:18334274-18334296 CAGGTGCATGGCACCACACCTGG - Intergenic
1037454762 8:19052327-19052349 CAGGCGCATGTCACCACACCTGG - Intronic
1037701306 8:21276355-21276377 CAGGCGCCTGCTGCCACACCAGG + Intergenic
1037869087 8:22474559-22474581 CAGAAGCATGCCACCACACCTGG - Intronic
1038375296 8:27034152-27034174 CAGAAGCATGCCACCACACCTGG - Intergenic
1038543590 8:28408936-28408958 CAGGCGCATGCCGCCACGCCCGG - Intronic
1038767086 8:30438914-30438936 CAGGCGCATGCCACCACACCCGG + Intronic
1039077610 8:33706816-33706838 CAGGAGCATGCCGCCACACCTGG + Intergenic
1039141816 8:34399284-34399306 CAGACACATGCCACCACACCTGG + Intergenic
1039166585 8:34687959-34687981 CAGGCGCATGCCGCCACGCCCGG + Intergenic
1039530717 8:38259361-38259383 CAGTCGCATGCTGCCACGCCTGG + Intronic
1039562959 8:38527808-38527830 CAGACACCTGGGTCCACACCTGG + Intronic
1039721417 8:40168589-40168611 CAGGCGCATGCCACCACACCTGG + Intergenic
1039802933 8:40975557-40975579 CAGATGCATGCCACCACACCAGG + Intergenic
1039807364 8:41012103-41012125 CAGGCGCATGCCACCACACCTGG + Intergenic
1039899014 8:41737154-41737176 CAGACGCGTGTCACCACACCTGG - Intronic
1039966302 8:42286606-42286628 CAGGTGCATGGCACCACACCTGG + Intronic
1039972638 8:42333333-42333355 CAGCCGCATGCCACCACACCCGG - Intergenic
1040046401 8:42968470-42968492 CAGACGCATGCTGCCACACCTGG + Intronic
1040851036 8:51899977-51899999 CAGGCGCACGGCACCACACCCGG - Intergenic
1041038393 8:53819387-53819409 CAGGCACATGCCGCCACACCCGG - Intronic
1041075694 8:54167628-54167650 CAGGCGCAGGGTACCACACCAGG - Intergenic
1041088013 8:54274557-54274579 CAGGCGCATGCCACCACACCTGG - Intergenic
1041118707 8:54565420-54565442 CAGGCGCATGACACCACACCAGG - Intergenic
1041155558 8:54982014-54982036 CAGACACATGCCACCACACCAGG - Intergenic
1041458902 8:58090300-58090322 CAGGCGCATGCCGCCACACCTGG + Intronic
1041633141 8:60110895-60110917 CAGGCGCATGCCACCACACCTGG + Intergenic
1041674753 8:60526824-60526846 CAGGCGCATGCCGCCACGCCTGG - Intronic
1042017941 8:64337898-64337920 CAGGCGCATGACACCACACCCGG - Intergenic
1042248469 8:66731675-66731697 CAGGCGCATGCCACCACACCTGG + Intronic
1042555920 8:70033620-70033642 CAGGCGCATGCCGCCACGCCCGG - Intergenic
1042724297 8:71856278-71856300 CAGAGTCAAGGGGCCACATCTGG - Intronic
1042815212 8:72870832-72870854 CAGGTGCATGGCACCACACCTGG - Intronic
1042822886 8:72951291-72951313 CAGGCGCATGCCACCACACCTGG + Intergenic
1042859556 8:73298668-73298690 CAGGCACATGCTGCCACACCTGG + Intronic
1042895679 8:73664847-73664869 CAGGCGCATGCCACCACACCTGG - Intronic
1042930752 8:74011714-74011736 CAGGCGCATGCCACCACACCTGG - Intronic
1043142535 8:76608149-76608171 CAGGCGCGTGCTGCCACACCCGG + Intergenic
1044047664 8:87457982-87458004 CAGGCGCATGCCACCACACCAGG - Intronic
1044081827 8:87894881-87894903 CAGGCGCATGCCACCACACCAGG - Intergenic
1044124992 8:88448932-88448954 CAGGCGCATGCCACCACACCCGG - Intergenic
1044412506 8:91900034-91900056 CAGACGCGTGCCACCACACCTGG - Intergenic
1044527110 8:93264618-93264640 CAGGTGCATGCTGCCACACCTGG - Intergenic
1045291942 8:100841239-100841261 CAGGTGCATGCCGCCACACCCGG + Intergenic
1045292485 8:100845853-100845875 CAGGCGCATGCCACCACACCTGG - Intergenic
1045491032 8:102669513-102669535 CAGGCGCATGCCACCACACCTGG - Intergenic
1045582088 8:103492979-103493001 CAGGTGCATGCCGCCACACCTGG + Intergenic
1046233819 8:111394217-111394239 CAGGCGCATGCCACCACACCTGG - Intergenic
1046408043 8:113800627-113800649 CAGACGCATGCCACCACACCTGG - Intergenic
1046631613 8:116627455-116627477 CAGGCGCATGCCACCACACCTGG - Intergenic
1046730232 8:117717555-117717577 CAGATGCATGCTACCACACCTGG - Intergenic
1046849931 8:118960640-118960662 CAGGCGCATGCCACCACACCAGG - Intergenic
1046869097 8:119184912-119184934 CACACGCATGCAACCACACCAGG - Intronic
1047067495 8:121301671-121301693 CAGGCGCATGCCACCACACCTGG - Intergenic
1047311600 8:123697050-123697072 CAGATGCATGGCGCCACACCTGG + Intronic
1047397606 8:124516443-124516465 CATACGCATGCCACCACACCTGG + Intronic
1047398762 8:124528314-124528336 CAGGCGCCTGCCGCCACACCCGG + Intronic
1047594256 8:126361278-126361300 CAGGTGCATGCCGCCACACCTGG - Intergenic
1047912341 8:129544057-129544079 CAGATGCATGCCACCACACCAGG + Intergenic
1048005472 8:130416091-130416113 CAGGCGCAGCGGGCCACACCTGG + Intronic
1048024957 8:130577850-130577872 CAGACGCAGGCTGCCACGCCCGG + Intergenic
1048335844 8:133501604-133501626 CAGACGCCTGCCACCACACCTGG - Intronic
1048601588 8:135924026-135924048 CAGGCGCATGCCACCACACCCGG - Intergenic
1049110602 8:140640149-140640171 CAGGCGCATGCCACCACACCCGG + Intergenic
1049505615 8:142995023-142995045 CAGACACATGCCACCACACCTGG + Intergenic
1049597503 8:143491540-143491562 GAGACGCAGTGTGCCACACCCGG + Intronic
1049736511 8:144209761-144209783 CAGATGCATGCTACCACACCTGG - Intronic
1049863124 8:144914387-144914409 CAGGTGCATGCTGCCACACCCGG + Intergenic
1049911468 9:272526-272548 CAGGCGCATGCCACCACACCTGG + Intronic
1049947525 9:611859-611881 CAGGCGCATGCCACCACACCCGG + Intronic
1050368070 9:4890903-4890925 CAGGCACATGGCCCCACACCTGG - Intergenic
1050529758 9:6578260-6578282 CAGATGCATGCCACCACACCTGG + Intronic
1050530315 9:6582684-6582706 CAGGCGCATGCCACCACACCCGG - Intronic
1050550242 9:6742884-6742906 GAGACCCATGGGGTCTCACCAGG + Intronic
1050786943 9:9415329-9415351 CAGACACATGCCACCACACCTGG - Intronic
1050827976 9:9973327-9973349 CAGACGCAAGCGACCACACCTGG - Intronic
1051333995 9:16050027-16050049 CAGGCGCATGCCACCACACCTGG + Intronic
1051412482 9:16804917-16804939 CAGGCGCATGCCACCACACCCGG - Intronic
1051629921 9:19131517-19131539 CAGGCGCATGCCACCACACCCGG - Intronic
1051630612 9:19137186-19137208 CAGGCGCATGCCACCACACCTGG + Intronic
1051632459 9:19152852-19152874 CAGGCGCATGCCACCACACCTGG + Intergenic
1051653406 9:19353483-19353505 CAGGCGCACGCCGCCACACCTGG - Intronic
1051691512 9:19718117-19718139 CAGGCACATGCTGCCACACCCGG + Intronic
1051989151 9:23130101-23130123 CAGGCGCATGCCACCACACCTGG + Intergenic
1052267705 9:26593302-26593324 CAGGCGCATGCCACCACACCTGG + Intergenic
1052629446 9:31018981-31019003 CAGACACATGCCACCACACCTGG - Intergenic
1052777324 9:32745329-32745351 CAGGAGCATGCCGCCACACCTGG - Intergenic
1052905004 9:33825998-33826020 CAGGCGCATGCCACCACACCCGG - Intronic
1052910413 9:33876217-33876239 CAGGCGCATGCCACCACACCTGG - Intronic
1052925166 9:34009374-34009396 CAGACGCAAGCCACCACACCTGG + Intronic
1053172110 9:35895341-35895363 CAGGCGCACGCCGCCACACCTGG + Intergenic
1053178842 9:35950199-35950221 CAGATGCATGCCACCACACCTGG - Intergenic
1053245202 9:36529096-36529118 CAGGCGCATGCTGCCACGCCCGG - Intergenic
1053330820 9:37205657-37205679 CAGGCACATGCGACCACACCTGG + Intronic
1053400165 9:37812035-37812057 CAGGCGCATGCCACCACACCCGG - Intronic
1053561101 9:39194933-39194955 CAGAAGCATGCCACCACACCTGG + Intronic
1053897673 9:42759869-42759891 CAGGCGCATGCCACCACACCCGG + Intergenic
1054136018 9:61424014-61424036 CAGAAGCATGCCACCACACCTGG - Intergenic
1054799800 9:69335820-69335842 CAGGCGCATGTCACCACACCTGG - Intronic
1055023694 9:71696626-71696648 CAGGTGCATGTGACCACACCTGG - Intronic
1055039993 9:71859364-71859386 CAGAGGCATGCCACCACACCTGG + Intergenic
1055060177 9:72060187-72060209 CAGGCGCATGCTGCAACACCCGG + Intronic
1055370368 9:75592120-75592142 AAGACGCTTGGGGCCAGATCTGG + Intergenic
1055438322 9:76314777-76314799 CAGGCGCATGCCACCACACCTGG + Intronic
1055571631 9:77623070-77623092 CAGGCGCATGCCACCACACCTGG - Intronic
1055894582 9:81160551-81160573 CAGGCGCGTGGCACCACACCAGG - Intergenic
1056167627 9:83954437-83954459 CAGGCGCATGCCACCACACCTGG - Intronic
1056350831 9:85746994-85747016 CAGACGCATACCACCACACCTGG + Intergenic
1056364365 9:85888605-85888627 CAGACGCATGCCACCACGCCTGG + Intergenic
1056371745 9:85962346-85962368 CAGATGCATGCCACCACACCTGG - Intronic
1056375990 9:86011499-86011521 CAGGCTCATGGCACCACACCTGG + Intronic
1056590895 9:87964755-87964777 CAGGCGCATGCCACCACACCTGG + Intergenic
1056646052 9:88412824-88412846 CAGGCGCATGCCACCACACCCGG + Intronic
1056817215 9:89810857-89810879 CAAATGCATGGGGCCATCCCTGG + Intergenic
1056881494 9:90397908-90397930 CAGGCGCATGCTACCACACCTGG - Intergenic
1057052470 9:91936001-91936023 CAGACTCATGAGGCCAGTCCTGG - Intronic
1057061594 9:92008915-92008937 CAGGCGCATGCCACCACACCTGG + Intergenic
1057122441 9:92588388-92588410 CAGACGCCCGGCACCACACCCGG + Intronic
1057124592 9:92606759-92606781 CAGACGCGTGCCACCACACCTGG - Intronic
1057144855 9:92751291-92751313 CAGACACCTGGGACCACGCCCGG + Intronic
1057169330 9:92951531-92951553 CAGGCGCATGCCACCACACCTGG - Intronic
1057377284 9:94536544-94536566 CAGAAGCATGCCACCACACCTGG + Intergenic
1057395171 9:94673822-94673844 CAGGCGCATGCCACCACACCTGG + Intergenic
1057449368 9:95143189-95143211 GAGATGCATGGGGCCAGGCCTGG + Intronic
1057472124 9:95367329-95367351 CAGGCGCATGCCACCACACCTGG - Intergenic
1057643560 9:96852502-96852524 CAGGCGCATGCCACCACACCTGG - Intronic
1057661183 9:97004796-97004818 CAGGCGCATGCCACCACACCTGG - Intronic
1057722515 9:97544391-97544413 CAGGCGCATGCCACCACACCTGG - Intronic
1058042154 9:100314228-100314250 CAGATGCATGCCACCACACCTGG + Intronic
1058089407 9:100787369-100787391 CAGACGCCTGCCACCACACCCGG - Intergenic
1058174191 9:101719274-101719296 CAGGCGCATGCCACCACACCCGG - Intronic
1058249263 9:102670707-102670729 CAGGCGCATGCTGCCACGCCTGG + Intergenic
1058534697 9:105946577-105946599 CAGGCGCATGCCACCACACCTGG + Intergenic
1058689235 9:107505522-107505544 CAGGTGCATGCTGCCACACCTGG + Intergenic
1058995779 9:110297589-110297611 CAGGCACATGCCGCCACACCTGG + Intergenic
1059146880 9:111907765-111907787 CAGGCACGTGAGGCCACACCTGG + Intronic
1059239115 9:112787937-112787959 CAGACGCATGCCACCACACCTGG + Intronic
1059297599 9:113285720-113285742 CAGGCGCATGCCACCACACCTGG - Intronic
1059437584 9:114285810-114285832 CAGAGGCCTTGGGGCACACCAGG - Intronic
1059513181 9:114868510-114868532 CAGGCGCATGCCACCACACCTGG + Intergenic
1059671745 9:116498453-116498475 CAGACACATGCCACCACACCTGG - Intronic
1059687950 9:116655831-116655853 CAGACACATGCCACCACACCTGG + Intronic
1059930519 9:119255810-119255832 CAGGCGCATGCTGCCACGCCTGG - Intronic
1060011848 9:120050632-120050654 CAGATGCATGCCACCACACCTGG - Intergenic
1060346925 9:122825302-122825324 CAGCCGCATGCCCCCACACCTGG + Intronic
1060475733 9:123985212-123985234 CAGATGCATGCCACCACACCTGG + Intergenic
1060691924 9:125669335-125669357 CAGGCGCATGCCACCACACCTGG - Intronic
1060697424 9:125721272-125721294 CAGACGCCTGCCACCACACCTGG - Intergenic
1060902190 9:127269139-127269161 CAGATGCATGCCACCACACCGGG + Intronic
1061109715 9:128560224-128560246 CAGGCGCACGCCGCCACACCTGG + Intronic
1061146141 9:128799876-128799898 CAGGCGCCTGCGACCACACCTGG - Intronic
1061421622 9:130475897-130475919 CAGGCGCATGCCGCCATACCCGG + Intronic
1061484477 9:130913422-130913444 CAGACGCCTCGGGTCAGACCGGG - Intronic
1061658690 9:132113115-132113137 CAGGCGCATGCTACCACACCTGG - Intergenic
1061864010 9:133482875-133482897 CAGATGCATGTCACCACACCTGG + Intergenic
1061933179 9:133843799-133843821 CAGACCCTGGTGGCCACACCGGG - Intronic
1203733507 Un_GL000216v2:113496-113518 CAGGCGCATGCCACCACACCCGG - Intergenic
1203751121 Un_GL000218v1:81436-81458 CAGGCGCATGGAAACACACCTGG - Intergenic
1203482865 Un_GL000224v1:22922-22944 CAGGCGCATGGAAACACACCTGG + Intergenic
1203709806 Un_KI270742v1:87466-87488 CAGGTGCATGGCACCACACCTGG - Intergenic
1185757618 X:2664421-2664443 CAGGCGCATGCTGCCACGCCCGG + Intergenic
1185913483 X:4008388-4008410 CAGGCGCATGCCGCCACACCTGG - Intergenic
1185935359 X:4250558-4250580 CAGGTGCATGGCACCACACCCGG + Intergenic
1186264876 X:7821321-7821343 CAGGCACATGGCACCACACCTGG - Intergenic
1186893062 X:13979077-13979099 CAGACACATGCCACCACACCAGG - Intergenic
1187058335 X:15762125-15762147 CAGGCGCATGCCACCACACCCGG - Intronic
1187063600 X:15811565-15811587 CAGGCGCATGCCACCACACCTGG + Intronic
1187114360 X:16334043-16334065 CAGGTGCATGCCGCCACACCTGG + Intergenic
1187129938 X:16492820-16492842 CAGGCGCATGCCACCACACCCGG - Intergenic
1187151025 X:16681686-16681708 CAGGCGCATGCCACCACACCCGG + Intronic
1187158966 X:16746728-16746750 CAGACGCATGCCACCACGCCTGG + Intronic
1187198948 X:17116350-17116372 CAGGCGCATGCCACCACACCTGG + Intronic
1187548158 X:20273484-20273506 CAGGCGCATGCCACCACACCCGG - Intergenic
1187890161 X:23926874-23926896 CAGGCGCATGCCACCACACCTGG - Intronic
1188301812 X:28513922-28513944 CAGGCGCATGCCGCCACACCTGG + Intergenic
1188493493 X:30759540-30759562 CAGGCGCATGCCACCACACCCGG - Intergenic
1188560280 X:31460722-31460744 CAGACACATGCCACCACACCTGG + Intronic
1189287227 X:39860372-39860394 CAAATGCATGGGGCCATGCCAGG + Intergenic
1189461594 X:41247759-41247781 CAGGCGCATGCCACCACACCCGG + Intergenic
1189761555 X:44326869-44326891 CAGGCGCATGCCACCACACCTGG + Intronic
1189997643 X:46654245-46654267 CAGATGCGTGTGACCACACCCGG - Intronic
1190101365 X:47524923-47524945 CAGGCGCCTGCCGCCACACCTGG + Intergenic
1190163513 X:48052009-48052031 CAGGCGCATGCCACCACACCCGG - Intronic
1190626847 X:52345168-52345190 CAGACACATGCCACCACACCTGG + Intergenic
1190866716 X:54391029-54391051 CAGACGCATGCTACCACACCTGG - Intergenic
1190886760 X:54537162-54537184 CAGGTGCATGCCGCCACACCTGG + Intronic
1190914010 X:54796539-54796561 CAGGCGCATGCCACCACACCCGG - Intronic
1191844838 X:65539391-65539413 CAGGCGCATGCTGCCACGCCTGG - Intergenic
1192176577 X:68889954-68889976 CAGAGAAATGGGGCCACATCTGG + Intergenic
1192213215 X:69140734-69140756 GAGACGCATGCCACCACACCTGG + Intergenic
1192222732 X:69208371-69208393 CAGAGGCATGCCACCACACCAGG + Intergenic
1192367121 X:70483139-70483161 CAGACACATGCCACCACACCTGG - Intronic
1192531175 X:71887667-71887689 CAGGGGCATGTTGCCACACCTGG + Intergenic
1192534150 X:71913105-71913127 CAAAAGCAAGAGGCCACACCAGG - Intergenic
1192815665 X:74588326-74588348 CAGGCGCATGCCACCACACCTGG - Exonic
1192859610 X:75052634-75052656 CAGGCGCATGACACCACACCTGG - Intergenic
1193146664 X:78083655-78083677 CAGGCACAGGCGGCCACACCCGG + Intronic
1193319137 X:80099238-80099260 CAGGCACATGGCACCACACCTGG - Intergenic
1193331553 X:80240355-80240377 CAGGCGCACGCTGCCACACCCGG - Intergenic
1193536030 X:82716523-82716545 CAGGCGCATGCCACCACACCGGG + Intergenic
1193952267 X:87814223-87814245 CAGGCGCATGCTGCCACATCCGG - Intergenic
1194198020 X:90920120-90920142 CAGACGCATGCCACCACACCTGG + Intergenic
1194453701 X:94076877-94076899 CAGACACATGCCACCACACCCGG - Intergenic
1194685233 X:96905984-96906006 CAGGCGCCTGCCGCCACACCCGG - Intronic
1194743837 X:97607116-97607138 CAGGCGCATGCCGCCACACCTGG + Intergenic
1195043954 X:101039210-101039232 CAGGCGCATGCCACCACACCTGG + Intronic
1195116674 X:101706330-101706352 CAGGCGCATGCCACCACACCTGG + Intergenic
1195897937 X:109767248-109767270 CAGATGCATGCCACCACACCTGG - Intergenic
1195898289 X:109771304-109771326 CAGGCGCATGCCACCACACCTGG - Intergenic
1195956500 X:110336570-110336592 CAGAAACATGCGACCACACCTGG - Intronic
1196309682 X:114149157-114149179 CAGGCGCATGCCACCACACCTGG + Intergenic
1196417281 X:115484823-115484845 CAGGTGCATGGCACCACACCTGG + Intergenic
1196703152 X:118693347-118693369 CAGGCCCATGGCACCACACCTGG + Intergenic
1196722827 X:118870997-118871019 CAGACGTATGCCACCACACCAGG + Intergenic
1196727822 X:118913072-118913094 CAGACACATGCCACCACACCCGG + Intergenic
1196751551 X:119122206-119122228 CAGACGCCTGCAACCACACCTGG + Intronic
1196753801 X:119140384-119140406 CAGCCGCATGCCACCACACCCGG - Intronic
1196842286 X:119869936-119869958 CAGGCGCATGCCACCACACCCGG - Intergenic
1196900696 X:120380085-120380107 CAGATGCATGCCACCACACCCGG - Exonic
1197196301 X:123704713-123704735 CAGGCGCATGCCACCACACCCGG - Intronic
1198210048 X:134507973-134507995 CAGGCGCATGCAACCACACCCGG - Intronic
1199084849 X:143616832-143616854 CAGGCGCATGCCACCACACCCGG + Intergenic
1199367514 X:147004243-147004265 CAGGCGCATGTAACCACACCTGG + Intergenic
1199526305 X:148795658-148795680 CAGGCGCATGTCACCACACCTGG - Intronic
1199548130 X:149029813-149029835 CAGGCGCATGCCACCACACCTGG - Intergenic
1199841411 X:151653332-151653354 CAGGCGCATGCCACCACACCTGG + Intronic
1199923720 X:152439273-152439295 CAGACGCCTGCCACCACACCAGG + Intronic
1199977540 X:152903244-152903266 CAGACGCCTGCCACCACACCTGG - Intergenic
1200282344 X:154787747-154787769 CAGGCGCATGCCACCACACCTGG + Intronic
1200404592 Y:2796955-2796977 CAGGCGCATGCCACCACACCCGG - Intergenic
1200492730 Y:3848120-3848142 CAGGCACATGGCACCACACCCGG - Intergenic
1200543720 Y:4492705-4492727 CAGACGCATGCCACCACACCTGG - Intergenic
1200587260 Y:5022475-5022497 CAGCCGCATGCCACCACACCTGG - Intronic
1200773324 Y:7147429-7147451 CAGGCGCATGCCACCACACCTGG + Intergenic
1200780764 Y:7213459-7213481 CAGGCGCATGACACCACACCCGG + Intergenic
1201482113 Y:14451051-14451073 CAGGTGCATGCTGCCACACCTGG - Intergenic
1201689371 Y:16745849-16745871 CAGACACCTGTGACCACACCTGG + Intergenic
1202627503 Y:56874921-56874943 CAGGCGCATGCCACCACACCCGG + Intergenic